downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure...

SUPPLEMENTARY MATERIAL

Figure S1. Electrostatic potential surface representations of AraC/XylS family members. The electrostatic potentials were calculated

with the software DelPhi version 4 release 1.1 and the surfaces and images were generated with PyMOL. A) View on the side of the

proteins facing DNA. B) View on the opposite side of the protein, by rotation of the proteins by 180 degrees. Blue color indicates a

positive potential, red color indicates a negative potential and white color indicates a neutral potential.

Figure S2. Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription factors.

Distance (in base pairs) from the hypothetical binding site is provided for each gene. In blue are genes with

a function related with the proposed biological role of the AraC/XylS transcription factor. In black, genes

with unknown or not obviously related function. In the majority of the cases, the function of these genes

was obtained by sequence similarity to other genes or by the annotation of the InterPro database for their

families.

Table S1. List of 62 well-characterized AraC/XylS-family transcriptional regulators with

known biological function

Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d

AarP (P43463)

Providencia stuartii

Antibiotic resistance

Regulates the transcription of 2'-N-acetyltransferase, which is capable of acetylating both peptidoglycan and certain aminoglycoside antibiotics.

S + V 7768849, 10390241

Ada (P06134)

Escherichia coli (strain K12)

DNA damage response

Repairs O6-methylguanine and O4-methylthymine and induces transcription of genes involved in the adaptive response to alkylation damage in DNA

S + V 3529081

Ada (P26189)

Salmonella typhimurium

DNA damage response


S + V 1904855

AdaA (P19219)

Bacillus subtilis DNA damage response


S + V 8376346, 2120677

AdiY (P33234)


Acid resistance Regulates arginine-dependent acid resistance, is involved in glutamate-dependent response to acid stress, and is associated with activation of virulent strains of E. coli in the stomage

S + V 8795195, 21034467

AggR (P43464)

Escherichia coli Cell adhesion Transcriptional activator of aggregative adherence fimbria I expression in enteroaggregative E. coli

V 7913930

AlkR (O31249)

Acinetobacter sp. (strain ADP1)

Alkane metabolism

Activates the expression the alkane 1-monooxygenase that permits the use of alkanes with at least twelve carbon atoms as the sole source of carbon and energy

M 9811637

AppY (P05052)


Phosphate starvation response

Induces the synthesis of acid phosphatase (AppA) and several other polypeptides (such as AppBC) during the deceleration phase of growth in response to phosphate starvation. Also involved in the stabilization of the sigma stress factor RpoS during stress conditions

S 18383615

AraC (P07642)

Erwinia chrysanthemi

Plant carbohydrates metabolism

Controls the expression of at least six genes that are involved in the transport and catabolism of L-arabinose an aldopentose sugar found in plant gums, pectins and bacterial cell wall polysaccharides

M 3902795


AraC (P0A9E0)



Controls the expression of at least six genes that are involved in the transport and catabolism of L-arabinose an aldopentose sugar found in plant gums, pectins and bacterial cell wall polysaccharides

M 12596232

Caf1R (P26950)

Yersinia pestis Capsule formation

Regulates the caf1M1A1 operon. The caf operon products constitute a fimbrial chaperone-usher system that acts to assemble and export F1 capsule components

V 1633857, 19103769

CfaD (P25393)

Escherichia coli Cell adhesion Transcriptional activator of the CFA/I adhesin (cfAA) gene of enterotoxigenic E. coli

V 1971911

ChbR (P17410)


Carbohydrates metabolism

Regulates the expression of the chbBCARFG operon for the uptake and metabolism of chitobiose (the major breakdown product of chitin degradation)

M 15066032

CsvR (P43460)

Escherichia coli Cell adhesion Transcriptional activator of the fimbrial gene in enterotoxigenic E. coli

V 1685133

EnvY (P10805)


Temperature stress response

Regulates the temperature-dependent expression of several E. coli envelope proteins, most notably the porins ompF and ompC and the lambda receptor, lamB

S 2536924

EutR (P36547)


Amine metabolism

Activates the transcription of the eut operon, neccesary for uptake and metabolism of ethanolamine. It was suggested that the breakdown of ethanolamine contributes to disrupting gut functions, in particular innate immune functions

M + V 20234377

ExsA (P26993)

Pseudomonas aeruginosa

Type III secretion system

Promotes the expresion of type III secretion system in response of low levels of Ca2+

V 16714561, 9618447, 11119548

FapR (P23774)

Escherichia coli Cell adhesion Regulates the expression of the 987P operon for the fimbrial protein in enterotoxygenic E. coli

V 2077360

FeaR (Q47129)


Amine metabolism

Regulates tynA/maoA and feaB/padA genes necessary for 2-phenylethylamine catabolism

M 9043126

GadW (P63201)


Acid resistance GadW regulates the gadA and gadBC genes that regulate acid tolerance and virulence gene expression in response to environmental cues within the gastrointestinal tract

S + V 12730179

GadX (Q9EYV5)

Escherichia coli O127:H6

Cell adhesion, Type III secretion system, Acid resistance

GadX regulates perABC and gadA and gadB, that regulate acid tolerance and virulence gene expression in response to environmental cues within the gastrointestinal tract

S + V 17576759

HilD (P0CL08)



Regulates the expression of the main transcriptional regulator of the Salmonella pathogenicity island 1 (SPI1) hilA

V 11442828


HrpB (P31778)

Ralstonia solanacearum (Pseudomonas solanacearum)


Regulates the hrp operon. hrp genes encode a specialized type III secretion system

V 12374732

InvF (P69343)



Regulates the expression of genes encoding the secreted effector molecules Sip/Ssp ABCD, SigD, SptP and SopE, necessary for type III secretion system

V 11296219

LacR (O33813)

Staphylococcus xylosus

Mammalian carbohydrates metabolism

Regulates the expression of lacPH (lactose permease and the beta-galactosidase) genes for lactose utilization

M 9573174

LumQ (Q51872)

Photobacterium leiognathi

Riboflavin synthesis and/or luminescence

Probably regulates the riboflavin synthesis and/or luminescence. Is encoded in the lux operon that is linked to the luminescence genes in some photobacterium species

M 17586644

MarA (P0ACH5)



Regulates the expression of the mar regulon that confers resistance to a variety of antibiotics

S + V 9333027, 11104814

MelR (P0ACH8)



Transcriptional activator for the expression of the melAB operon in response to the availability of melibiose

M 16621812

MmsR (P28809)


Amino acid metabolism

Regulates the expression of the mmsAB operon. The operon contains two structural genes involved in valine metabolism

M 1339433

MsmR (Q00753)

Streptococcus mutans


Regulates the expression of the msm operon responsible for the transport and metabolism of melibiose, raffinose, and isomaltosaccharides

M 1537846, 8432594

MxiE (P0A2S7)

Shigella flexneri Type III secretion system

Controls transcription of a set of genes encoding proteins that transit through the type III secretion system apparatus.

V 16428428

OruR (P72171)


Amino acid metabolism

Regulates the expression of genes involved in ornithine metabolism

M 9401045

PchR (P40883)


Iron stress Regulates the expression of pyoverdin and pyochelin siderophores (iron chelators) which contribute to virulence

S + V 10722571, 15375116

PerA (P43459)

Escherichia coli O127:H6

Cell adhesion Regulates the expression of the eaeA gene that is associated with attaching and effacing lesions and encodes intimin, a 94-kDa outer membrane protein

V 7729884

PocR (Q05587)


Carbohydrates metabolism

Regulates the expression of pdu and cob operons that regulate the meabolism of the L-fucose subproduct anaerobic metabolite 1,2-propanediol

M 8071226

PqrA (Q52620)

Proteus vulgaris Antibiotic resistance, Oxidative stress response

Confers multidrug resistance in a way similar to that of the soxS and marA genes in E. coli

S + V 7726514


RafR (P43465)

Pediococcus pentosaceus


Regulates the raffinose operon. Raffinose is a trisaccharide composed of galactose, fructose, and glucose found in many plants

M 2180920

RamA (P55922)

Enterobacter cloacae


Is Involved in resistance to multiple antibiotics through the expression regulation of the OmpF porin and the efflux pump AcrAB

S + V 21811569

RhaR (P09378)



Regulates the rhaBAD operon that encode enzymes for catabolism of rhamnose

M 8757746

RhaS (P09377)



Regulates the rhaBAD operon that encode enzymes for catabolism of rhamnose

M 8230210

RhrA (Q9Z3Q6)

Rhizobium meliloti (Ensifer meliloti)

Activation of siderophores, Iron stress

Regulates the transcription of the rhbABCDEF operon involved in biosynthesis of rhizobactin 1021, a siderophore produced under iron stress. Also regulates the rhtA gene which encodes an membrane receptor protein for rhizobactin 1021

BPI + S 11274118

RipA (Q8NRR3)

Corynebacterium glutamicum

Iron stress response

Under iron limitation, RipA acts as a repressor of several genes encoding prominent iron-containing proteins (e.g. aconitase and succinate dehydrogenase)

S 21217007, 16179344

Rns (P16114)

Escherichia coli Cell adhesion Regulates the expression of the CS1 and CS2 adhesins

V 2563591

Rob (P0ACI0)



Regulates the expression of genes that confer multiple antibiotic resistance. Overexpression causes antibiotic resistance, organic solvent tolerance and heavy metal resistance

S + V 7896685, 7793951

SirC (Q8Z4A6)

Salmonella typhi Type III secretion system

Regulates the expression of the invasion-associated type III secretion system encoded within the SPI-1 plasmid

V 10322010

SoxS (P0A9E2)


Oxidative stress response

Regulates the transcriptional activation of a complex oxidative stress regulon in response to superoxide-generating agents

S + V 1653416, 7726514

TcpN (P0C6D6)

Vibrio cholerae Pilus formation Regulates the tcp gene cluster, associated with the biosynthesis and assembly of the toxin-coregulated pilus

V 1352761

TetD (P28816)

Escherichia coli Antibiotic resistance

Regulates the transcripcion of the mar regulon that confers the multiple antibiotic resistance phenotype

S + V 6094472, 9333027

ThcR (P43462)

Rhodococcus erythropolis (Arthrobacter picolinophilus)

Organosulfur compound metabolism

Regulates the transcription of the thc operon for the degradation of the thiocarbamate herbicide EPTC

M 7836301

UreR (P32326)

Escherichia coli Urease activation

Regulates the expression of the urease operon, related with uropathogenic strains of E. coli and Proteus mirabilis

V 11724879, 11119505


UreR (Q02458)

Proteus mirabilis (strain HI4320)

Urease activation

Regulates the expression of the urease operon, related with uropathogenic strains of E. coli and Proteus mirabilis

V 7678244, 18202436

VirF (P0A2T1)

Shigella flexneri Type III secretion system

Primary regulator of plasmid-encoded virulence genes. VirF activates the second essential virulence plasmid regulator VirB (type III secretion system) and the actin nucleator protein IcsA

V 18202440

VirF (P0C2V5)

Yersinia enterocolitica


Transcriptional activator of the Yersinia Yop virulence regulon that encodes 11 different secreted antihost proteins called Yops, as well as a type III secretion machinery that is required for their secretion

V 9841674, 9618447

VqsM (Q9I1P2)


Quorum sensing Regulates dozens of genes which are implicated in quorum sensing, virulence and multidrug resistance

V 16194239

XylR (P0ACI3)



Regulatory protein for the xylBAFGHR operon involved in the transport and metabolism of D-xylose

M 9371449

XylS (P07859)

Pseudomonas putida (Arthrobacter siderocapsulatus)

Benzene derivatives metabolism

Regulates the xylXYZLTEGFJQKIH operon of TOL plasmid, required for the degradation of toluene, m-xylene and p-xylene

M 18296514

XylS1 (Q04713)

Pseudomonas putida



M 8473862

XylS2 (Q05092)

Pseudomonas putida



M 1331988

XylS3 (Q05335)

Pseudomonas putida



M 8473862

Y4fK (P55449)

Rhizobium sp. (strain NGR234)

Nodulation induction

Regulates the nod operon that controls nodulation factors that promote nitrogen fixation in symbiotic bacteria-plant interaction

BPI 9669339

YesN (O31517)

Bacillus subtilis Plant carbohydrates metabolism

Probably activates the expression of genes that regulate the metabolism of plant cell wall polysaccharides

M 17921311, 19651770

YesS (O31522)

Bacillus subtilis Plant carbohydrates metabolism

Probably regulates the pathway involve in rhamnogalacturonan (plant cell wall polysaccharides) depolymerization

M 17449691

a Protein name and UniProt accession number in parenthesis.

b General biological process. Multiple processes are separated by a comma.

c Functional category: Bacteria-plant interaction (BPI), metabolism (M), stress response (S)

and virulence (V).

d PubMed ID of references describing the biological function.

Table S2. Details of the analysis of the genetic context for predicted binding sites of the uncharacterized AraC/XlyS transcription factors.

PDB structure 3mn2 3oio 3lsg 3oou

Organism Rhodopseudomonas palustris TIE-1

Chromobacterium violaceum ATCC 12472

Chromobacterium violaceum ATCC 12472

Fusobacterium nucleatum subsp.

nucleatum ATCC 25586Listeria innocua Listeria innocua

Genome strand of Binding Site

- - - + - -

Binding Site start / end

1283534 / 1283555 3284826 / 3284847 2429687 / 2429708 1447985 / 1448006 2208002 / 2208023 2849441 / 2849462

Binding Site sequence

GATCTGCCCGAGGGCGCCACGC

AGGCGCACCAGCTCCTTGACGA

GATGACGCCGTTTTCCGCCTTC

TCTGGATTCATGATAGTTCAAT

TCAAATAAAGGATCCCCGAACT

AGACGAACAAATCGCCCAAGCA

Gene 1 Locus: Rpal_1214 / UniProtKB: B3QHJ6

Gene: ibeB / UniProtKB: Q7NVV0

Locus: CV_3010 / UniProtKB: Q7NTP4

Locus: FN0792 / Uniprot: Q8RFC1

Locus: lin2190 / Uniprot: Q929T4

Locus: 2833 / Uniprot: Q7ANT9

Genome start / end / strand

1285065 / 1285718 / + 2430434 / 2431813 / + 3286108 / 3286602 / - 1448403 / 1450424 / + 2207728 / 2208621 / - 2849334 / 2849636 / +

DescriptionDSBA oxidoreductase /

protein disulfide oxidoreductase activity

Lipoprotein / outer membrane drug efflux

lipoprotein

oxidation-reduction process / electron carrier

activityurocanate hydratase Aminoglycoside 3'-

phosphotransferaseIIA PTS Lactose / cellobiose

uptake / enzyme IIA

Distance from sequence

1510 726 1261 419 598 0


Locus: CV_2243 / UniProtKB: Q7NVU9

Gene: flaD / UniProtKB: Q7NTP3

Locus: FN0793 / Uniprot: Q8RFC0 tRNA Locus: lin2834 / Uniprot:

Lin2834 protein


1285927 / 1286238 / + 2431827 / 2432282 / - 3286802 / 3287920 / - 1450652 / 1451851 / + 2208754 / 2208837 / + 2850081 / 2851184 / -

Description hypothetical protein conserved hypothetical protein

ciliary or flagellar motility / structural molecule

activityL-glutamato Transporter tRNA Family FtsW_RodA_SpoVE

Implicated in Cell division


2372 2140 1955 2668 731 619



Gene: nfnB / UniProtKB: Q7NVU8


Locus: FN0794 / Uniprot: Q8RFB9


Locus: lin2835 / Uniprot: Q927F4


1286243 / 1287505 / + 2432321 / 2432974 / - 3288132 / 3289388 / + 1451930 / 1452343 / - 2208964 / 2210244 / - 2851181 / 2852311 / -

Description

electron carrier activity / flavin adenine

dinucleotide binding / iron ion binding /

oxidoreductase activity

oxygen-insensitive NAD(P)H nitroreductase

/ 6,7-dihydropteridine reductase activity

proteolysis / serine-type carboxypeptidase

activityUnknown DNA binding protein (HTH

motif)Family FtsW_RodA_SpoVE Implicated in Cell division


2688 2613 3285 3964 941 1719


Gene: acrB / UniProtKB: Q7NVV1


Gene: hutH1 / Uniprot: Q8RFC2




1281779 / 1285003 / + 2427309 / 2430437 / + 3284381 / 3286096 / - 1446836 / 1448386 / + 2207105 / 2207731 / - 2847990 / 2849297 / +

Descriptiontransporter activity / acriflavin resistance

protein

transporter activity / acriflavin resistance

protein B

peptidyl-histidine phosphorylation /

regulation of transcription, DNA-dependent

Enzyme, catalyzes: L-histidine = urocanate +

NH3

Protein with structural similarity with: Regulation domain of Rob, multidrug

effect transporter regulator and heme

binding protein2

PTS, cellobiose uptake / enzyme IIC


0 0 0 0 293 166


Locus: CV_2240 / UniProtKB: Q7NVV2



Gene: crcB2 / Uniprot: Q929T6



1280787 / 1281782 / + 2426145 / 2427305 / + 3283449 / 3284312 / + 1445384 / 1446547 / - 2206609 / 2206998 / - 2847548 / 2847853 / +

Descriptionefflux transporter, RND family, MFP subunit /

transmembrane transport

transmembrane transport / probable

multidrug efflux protein

regulation of transcription, DNA-dependent / two-

component response regulator activity

Xylose repressor Protein CrcB homolog 2 PTS Lactose / cellobiose uptake / enzyme IIB



1774 2404 536 1438 1026 1610


Gene: fepB / UniProtKB: Q7NVV3

Gene: fhiA / UniProtKB: Q7NTP7


Gene: crcB1 / Uniprot: Q929T7

Gene: kdpA / Uniprot: Q927F9


1280444 / 1280785 / + 2424881 / 2425849 / - 3281425 / 3283137 / + 1444526 / 1445368 / - 2206263 / 2206619 / - 2845522 / 2847207 / -

Description

Transcriptional regulator, ArsR family / sequence-specific DNA

binding transcription factor activity / HTH

arsR-type DNA-binding domain

high-affinity iron ion transport /

ferrienterobactin-binding periplasmic protein

precursor

protein secretion Unknown Protein CrcB homolog 1 Potassium-transporting ATPase A chain,l


2771 3860 1708 2617 1404 2256

downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure...

Documents

Transcript of downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure...