The FASEB Journal • FJ Express Summary

Identification and characterization of riproximin, anew type II ribosome-inactivating protein withantineoplastic activity from Ximenia americana

Cristina Voss,* Ergul Eyol,* Martin Frank,† Claus-W. von der Lieth,†

Martin R. Berger*,1

*German Cancer Research Center, Toxicology and Chemotherapy Unit, E100, Heidelberg, Germany;and †German Cancer Research Center, Central Spectroscopic Department, B090, Heidelberg,Germany

To read the full text of this article, go to http://www.fasebj.org/cgi/doi/10.1096/fj.05–5231fje

SPECIFIC AIMS

We recently showed that powdered material used inAfrican traditional medicine exerts highly potent anti-cancer activity in vitro and in vivo. The source of thematerial was identified as the semiparasitic plant Xime-nia americana. An initial physical and chemical charac-terization of the active component(s) strongly hinted toprotein(s) belonging to the family of the type II ribo-some-inactivating proteins (RIPs). The aim of this studywas to identify and characterize the active compo-nent(s).

PRINCIPAL FINDINGS

1. Purification

Purification of the biologically active protein(s) wasbased on the initial characterization of an aqueousXimenia americana extract and included four steps: 1)preextraction of the raw material with 70% acetone, todeplete tannins; 2) extraction with extraction buffer(20 mM Tris-HCl, pH�7.0); 3) ion exchange chroma-tography on diethylaminoethyl (DEAE) cellulose; 4)affinity chromatography on partially hydrolyzed Sepha-rose.

Reducing SDS-PAGE of this extract as well as of theone-step DEAE eluate (500 mM NaCl) revealed acomplex pattern of protein bands that was overlaidby a Schiff’s reagent-positive smear (Fig. 1a, lanes 1,2). Subsequent affinity purification of the DEAEeluate resulted in a biologically active sample con-taining two proteins, each consisting of two subunits(Fig. 1a, lane 3). A stepwise elution with increasingNaCl concentrations followed by affinity purificationresulted in samples differing in the relative ratios ofthe two proteins (Fig. 1b, c) and demonstrating acomparable cytotoxic activity. In a typical prepara-tion with one-step elution from DEAE-cellulose, 90

�g affinity purified proteins with cytotoxic activity(see below) were obtained from 20 g raw material.This fraction was used for all subsequent experi-ments.

2. Cytotoxicity

The antiproliferative activity of the protein samplewas determined by the MTT method in MCF7 humanbreast cancer, HELA cervix carcinoma and CC531-lacZ rat colon cancer cells (Fig. 2). The proteinsample showed a distinct cytotoxic effect in all threecell lines, as evidenced by IC50 values of 0.5 pM(MCF7), 1.1 pM (HELA), and 0.6 pM (CC531-lacZ).Despite the similar IC50, the dose-response curves ofthe three cell lines differed in their slope, as re-flected by their IC90/IC10 ratios of 83 (MCF7), 6.6(HELA), and 20 (CC531-lacZ).

3. Inhibition of protein synthesis

The protein sample clearly inhibited the synthesis ofluciferase in an in vitro reticulocyte lysate transcription/translation assay. A clear concentration-dependenttranslation inhibition was seen in response to 0.17 to 50nM nonreduced or reduced riproximin, with IC50

values of 5.5 nM (nonreduced proteins) or 2.6 nM(reduced proteins). These values reflect the activity ofthe heterodimeric protein and the separated A chain,respectively.

1Correspondence: Toxicology and Chemotherapy Unit,E100, Deutsches Krebsforschungszentrum Heidelberg, ImNeuenheimer Feld 280, Heidelberg 69120, Germany. E-mail:m.berger@dkfz.de

doi: 10.1096/fj.05-5231fje

1194 0892-6638/06/0020-1194 © FASEB

4. In vivo experiments

The protein sample was administered to male Wag Rijrats, implanted with 4 � 106 CC531-lacZ cells via theportal vein (day 0).

Experiments with crude extract had shown that thein vitro IC50 in CC531-lacZ cells (3.3 �g/ml) corre-sponded to an effective in vivo dose of 5 mg/kg forintraperitoneal (i.p.) therapy. Therefore, a similarpharmacodynamic relationship was assumed for select-ing the in vivo doses for i.p. therapy with the affinity-purified protein sample (0.25, 0.5, and 1 pmol/kg)from the respective in vitro IC50 (0.5 pM). The dose forthe peroral treatment was selected 20-fold higher (10pmol/kg), to compensate for losses associated withgastrointestinal resorption. No toxicity was observedfollowing these dosages.

Intraperitoneal administration of 0.25, 0.5, and 1pmol/kg every second day dose-dependently reducedthe increase in tumor cell number seen in untreatedtumor bearing rats as indicated by T/C % ratios of 47.4,34.9, and 22.6 (P�0.05), respectively. The effect on thenet increase in liver weight was similarly effective asshown by T/C % ratios of 39.1, 29.0, and 30.7, respec-tively.

Peroral administration of 10 pmol/kg every secondday was surprisingly effective: compared to the un-treated controls, the net increase in mean liver weightof the treated animals was significantly lower (T/C%�0.3, P�0.05), and their mean tumor cell numberwas reduced by two orders of magnitude (T/C %�1.0,P�0.05). The actual tumor cell number corresponds toan 8-fold increase related to the initial tumor cellimplant, which is formally equivalent to three celldivisions.

Identification of the protein, cDNA sequencing,sequence analysis, and molecular modeling

Two peptides showing homology to B chain sequencesof type II ribosome-inactivating proteins (RIPs) wereidentified by ESI-MS-MS mass spectrometry and subse-quent database search and de novo sequencing, respec-tively. Degenerated primers designed on these peptidesamplified a 400 bp DNA fragment containing a contin-uous open reading frame (ORF). Additional 500 bp 5�sequence were obtained by subsequent amplificationwith a degenerate primer matching the RIP A chainactive site. The complete sequence of the respectivecDNA (1990 bp) containing an ORF of 1814 bp wasobtained by the RACE method.

The homology of the translated protein sequence toknown type II RIP precursors demonstrates that thenew protein, termed “riproximin,” is so far an unknownmember of this class. As typical for type II RIPs, theriproximin precursor contains sequences correspond-ing to the type II RIP A and B chains, both showinghighest homology to toxic members of this family. Thishigh homology (45–55%) to sequences of the crystal-lographically characterized proteins ricin and viscumlectin I allowed the molecular modeling of a 3Dstructure of riproximin following the approach of com-parative protein modeling on the SWISS-MODELServer (Fig. 3, center). A “blind docking” approachusing AUTODOCK 3.05 was applied to screen thesurface of the B chain for potential Gal-� binding sites,with two strategies: one using the rigid homologymodel and a second introducing protein flexibility intothe docking protocol by generating an ensemble ofprotein conformations using molecular dynamics sim-ulation with the homology model as starting structure.

The riproximin protein sequence contains severalamino acid variations, resulting from single nucleotidepolymorphism at 28 positions. However, by comparisonto the sequence of ricin or viscum lectin I as well asmodeling of the 3D structure, it became obvious thatonly one of these 10 amino acids is involved in the

Figure 1. SDS-Polyacrylamide gel electrophoresis of samplesobtained during the purification of riproximin. Gels were runwith MOPS buffer followed by silver staining. a) Riproximinpurification grade monitored by reducing SDS-PAGE: extract(lane 1), total DEAE fraction eluted with 500 mM NaCl (lane2), the affinity-purified sample (lane 3), and MW marker (M).b) Reducing SDS-PAGE (dissociating the disulfide bonds) ofaffinity purified samples obtained from DEAE fractionseluted with 200 mM NaCl (lane 1) and 400 mM NaCl (lane2), MW marker (M). c) Nonreducing SDS-PAGE (keeping thedisulfide bonds intact) of affinity purified samples obtainedfrom DEAE fractions eluted with 200 mM NaCl (lane 1) and400 mM NaCl (lane 2), MW marker (M).

Figure 2. Concentration effect curves of the affinity-purifiedprotein sample in MCF breast cancer, HELA cervix carci-noma and CC531-lacZ rat colon carcinoma cells.

1195RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

function or structure of the protein. The only excep-tion is the asn/thr variation at position 159, which,when expressing asn159, could serve as a glycosylationsite on the riproximin A chain. Because of its singular-ity, the presence of this glycosylation site contributes toa major difference between the A chains alleles.

All of the invariant amino acids involved in theN-glycosidase activity of a RIP A chain are conservedand cluster in the 3D model within a cleft likely to bethe active site of the riproximin A chain. It can there-fore be assumed that the A chain of riproximin is a fullyactive RNA N-glycosidase. Similar to other type II RIP Achains, the A chain of riproximin has a very low lysinecontent (two of 263 amino acid residues). This featureprobably confers to the A chain resistance to ubiquiti-nation and degradation in the cytosol.

The B chain of type II RIPs consists of two homolo-gous domains termed 1 and 2, each containing threesubdomains termed 1�, 1�, 1�, and 2�, 2�, 2�. Thesubdomains 1� and 2� are reported to be responsiblefor the sugar-affinity of the B chains of most type IIRIPs. The B chain of riproximin also shows the typicaltwo-domain structure, including the conserved disul-fide bridges and glycosylation sites. In addition, most ofthe amino acids responsible for sugar binding in thericin and viscum lectin I subdomains 1� and 2� are also

present in the respective riproximin B chain subdo-mains. The blind �-Gal docking calculation using therigid homology model resulted in three binding siteswith maximum energy, two corresponding to the 1�and 2� subdomains, respectively. A third docking sitewas located close to gln583. Surprisingly, analysis of thedocking calculation with a flexible protein showed thatthe binding affinity of the trp370 binding site (1�subdomain) is significantly reduced compared to trp587

(2� subdomain).

CONCLUSIONS AND SIGNIFICANCE

A mixture of two new type II ribosome-inactivatingproteins, one of which we termed riproximin, wasidentified to be the active principle of the antineoplas-tic activity contained in Ximenia americana plant mate-rial. Figure 3 gives a schematic overview of the set ofmethods used and the main findings of this study.

Interest in type II RIPs as anticancer agents rose as earlyas 1970, when it was shown that ricin and abrin are moretoxic to tumor than to normal cells. However, ricin’s highunspecific toxicity prevented its clinical use. Recently, arecombinantly engineered viscum lectin I, rViscumin, hasbeen developed for application in cancer treatment and isbeing tested in phase II clinical studies.

Our results extend the group of type II RIPs withantineoplastic potential by a new protein, riproximin. Inaddition to its in vitro cytotoxicity, riproximin showedpotent antitumor activity in a rat metastasis model, withhighest efficacy after p.o. application. This finding issurprising, since proteins are commonly characterized bya low to very low bioavailability, as known for the viscumlectin I, which, despite a low systemic LD50 in mice (5–10�g/kg), is well tolerated at dietary dosages as high as 500mg/kg (mice) and 200 mg/kg (rats). In line with this,cancer treatment with the recombinant rViscumin isbased on systemic administration. Nevertheless, highdoses of p.o. administered viscum lectin I are associatedwith some systemic activity: a diet containing up to 10 mgviscum lectin I per day/mouse was effective in reducingthe tumor mass of a non-Hodgkin lymphoma. Notably,this dose is by more than six orders of magnitude higherthan the effective p.o. dose of riproximin (0.6 �g/kgadministered every 2nd day).

The differences in toxicity and specificity of type II RIPsare probably related to the sugar specificity of the respec-tive B chains and their intracellular fate. It is interestingthat only one of the two presumed sugar binding domainsof the riproximin B chain is supposed to bind galactoseaccording to a flexible docking simulation assay. Whetherthis could be a reason for the high therapeutic efficacy ofriproximin at a relatively low and well tolerated p.o. doseremains to be elucidated.

In conclusion, these results suggest that riproximindiffers considerably in its pharmacological propertiesfrom other type II RIPs, thus indicating distinct poten-tial for cancer treatment.

Figure 3. Schematic overview of the set of methods used toisolate and sequence the active principle from Ximenia ameri-cana plant material (upper region) as well as of the in vitroand in vivo effects of the isolated proteins (lower region). Themolecular model of the new type II RIP, termed riproximin,is depicted in the center of the drawing and shows thecatalytic site of the A chain (red), the intermolecular disulfidebridge (yellow), the B chain sugar binding domains 1�(green) and 2� (pink) as well as the potential N-glycosylationsites (dark blue).

1196 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

The FASEB Journal • FJ Express Full-Length Article

Identification and characterization of riproximin, anew type II ribosome-inactivating protein withantineoplastic activity from Ximenia americana

Cristina Voss,* Ergul Eyol,* Martin Frank,† Claus-W. von der Lieth,†

Martin R. Berger*,1

*German Cancer Research Center, Toxicology and Chemotherapy Unit, E100, Heidelberg,Germany; and †German Cancer Research Center, Central Spectroscopic Department, B090,Heidelberg, Germany

ABSTRACT The aim of this study was to identify andcharacterize the active component(s) of Ximenia ameri-cana plant material used to treat cancer in Africantraditional medicine. By a combination of preextrac-tion, extraction, ion exchange and affinity chromatog-raphy, a mixture of two cytotoxic proteins was isolated.Using degenerated primers designed on the de novosequence of two tryptic peptides from one of theseproteins, a DNA fragment was amplified and the se-quence obtained was used to determine the completecDNA sequence by the RACE method. Sequence anal-ysis and molecular modeling showed that the newprotein, riproximin, belongs to the family of type IIribosome inactivating proteins. These results are ingood agreement with the ability of riproximin to inhibitprotein synthesis in a cell-free system, as well as with thecytotoxicity of riproximin, as demonstrated by its IC50value of 0.5 pM in MCF7, 1.1 pM in HELA and 0.6 pMin CC531-lacZ cells. To assess the antineoplastic effi-cacy of the purified riproximin in vivo, the CC531-lacZcolorectal cancer rat metastasis model was used. Signif-icant anticancer activity was found after administrationof total dosages of 100 (perorally) and 10 (intraperito-neally) pmol riproximin/kg. These results suggest thatriproximin has distinct potential for cancer treatment.—Voss, C., Eyol, E., Frank, M., von der Lieth, C.-W.,Berger, M. R. Identification and characterization ofriproximin, a new type II ribosome-inactivating proteinwith antineoplastic activity from Ximenia americana.FASEB J. 20, E334–E345 (2006)

Key Words: anticancer agent � plant protein � lectin � peroralactivity � liver metastasis model

Powdered material used in African traditional med-icine has been shown recently to exert highly potentanticancer activity in vitro and in vivo (1). The sourceplant of this material was determined to be the semi-parasitic subtropical plant Ximenia americana. Physicaland chemical characterization of the active compo-nent(s) strongly hinted to protein(s) with galactoseaffinity. An initial mass spectrometry analysis of the

active protein components identified a peptide identi-cal to a tryptic peptide from the ribosome-inactivatingprotein ricin.

Ricin belongs to the family of type II ribosome-inactivating plant proteins (RIPs) consisting of twopolypeptide chains termed A- and B-chain, which arehold together by a disulfide bridge (2, 3). The A-chainof type II RIPs is an rRNA N-glycosidase able tohydrolyze a specific adenine from the ricin/sarcin loopof the ribosome large subunit. The B-chain is a lectinwhich shows affinity for certain sugar moieties, mainlyfor galactose. Based on their toxicity to mammals, thisfamily is divided into two groups: the toxic and non-toxic type II RIPs. The former group includes, e.g.,ricin, abrin, viscum lectin I, and volkesin, which areamong the most potent plant toxins. Conversely, Rici-nus agglutinin (RCA), Sambucus RIPs, and cinnamo-mins belonging to the latter group show little or notoxicity in higher animals (4). The toxic effects of typeII RIPs are based on a mechanism involving the cellularuptake of the protein mediated by the binding of theB-chain to sugar moieties on the cell surface, followedby an internalization of the A-chain, which inactivates theribosomes and thus terminates protein synthesis (5).

Interest in type II RIPs as anticancer agents rose asearly as 1970, when Lin et al. showed that ricin andabrin were more toxic to tumor than to normal cells(6). However, ricin’s high unspecific toxicity preventeda clinical use. To improve the selectivity, ricin or ricinA-chain were conjugated to antibodies raised againstspecific tumor antigens (7, 8). Another type II RIP,which recently has been developed for application incancer treatment is rViscumin (aviscumine), a recom-binantly produced viscum lectin I, is currently tested inphase I/II clinical studies (9, 10).

Here we report the identification and characteriza-tion of a new type II RIP from Ximenia americana. This

1 Correspondence: Toxicology and Chemotherapy Unit,E100, Deutsches Krebsforschungszentrum Heidelberg, ImNeuenheimer Feld 280, 69120 Heidelberg, Germany. E-mail:m.berger@dkfz.de

doi: 10.1096/fj.05-5231fje

E334 0892-6638/06/0020-0334 © FASEB

new RIP, termed riproximin, is the active component ofthe plant material used in African traditional medicineto treat some forms of cancer.

MATERIALS AND METHODS

Materials

Plant material was obtained from Tanzania (1). MTT wasobtained from Serva (Heidelberg, Germany), culture mediafrom Invitrogen (Karlsruhe, Germany). Sepharose was par-tially hydrolyzed to obtain free galactose ends as described inref 11. In brief, Sepharose 4B (Amersham GE Healthcare,Freiburg, Germany) was incubated with 1M HCl for 3 h at50°C, washed with distilled water and equilibrated with trans-fer buffer (see below).

Purification

Dry plant material was extracted three times with 70% ace-tone followed by one extraction with 100% acetone to depletetannins. The residue was dried by air stream and extractedwith extraction buffer (20 mM Tris-HCl, pH�7.0).

The extract was applied on a diethylaminoethyl (DEAE)-cellulose (Whatman, Maidstone, UK) column pre-equili-brated with extraction buffer and the column washed withextraction buffer until no proteins could be detected in theeluate. For eluting all biologically active components, 500mM NaCl were added to the extraction buffer. Alternatively,a step gradient elution was performed with extraction buffercontaining increasing NaCl concentrations (100, 200, 300,and 400 mM NaCl, respectively).

Eluted fractions containing the biological activity wereapplied on a column containing partially hydrolyzed Sepha-rose. The column was washed with transfer buffer until theeluate was free of proteins. The bound proteins were elutedwith elution buffer (20 mM Tris-HCl, 500 mM NaCl, 100 mMgalactose, pH�7.0). The protein fraction was collected andconcentrated by ultrafiltration on a Microcon YM10 (MWcutoff 10 kDa) membrane (Millipore, Schwalbach, Germany).Where possible, the dry protein weight was determined byreplacing the elution buffer with water and subsequentlyophilization. In addition, protein molar concentrationswere calculated from the respective 280 nM absorbance(A280 nM) of the purified samples by using a molecularabsorption coefficient which was estimated based on theriproximin sequence (12). Purification degree and yield weremonitored by SDS-PAGE and in vitro tests for cytotoxicactivity. To analyze the purified fractions, SDS-PAGE wasperformed under reducing (addition of dithiothreitrol to thesample in order to reduce the disulfide bonds) or nonreduc-ing (without dithiothreitrol, keeping the disulfide bondsintact) conditions. The purified proteins were analyzed bymass spectrometry as described below.

Deglycosylation assay

The affinity-purified proteins were heated for 5 min to 99°Cin a buffer containing 50 mM sodium phosphate buffer,pH � 7.0, 0.1% SDS, and 0.05% �-mercaptoethanol. Toobtain a better visualization of the effects of deglycosylationon each of the four proteins, the bands separated underreducing conditions by SDS-PAGE were cut out after visual-ization by Coomassie blue staining and heated as describedabove. After cooling to room temperature, Triton X-100 andN-glycosidase F (Calbiochem, Merck Biosciences GmbH, Bad

Soden, Germany) were added to a final concentration of0.75% and 100 U/ml, respectively. The reaction mix wasincubated over night at 37°C. The deglycosylated proteinswere analyzed by SDS-PAGE under reducing conditions.

Cytotoxic activity

In brief, MCF7 human breast carcinoma, HELA cervix carci-noma cells or CC531-lacZ rat colon carcinoma cells wereseeded into 96-well microtiter plates at an initial cell densityof 8000 (MCF7) or 4000 cells/well (HELA; CC531-lacZ). Onthe next day, medium with (treated) or without (control)extract or purified fractions was added to the wells. The cellswere incubated for three more days in an incubator understandard culture conditions (humidified atmosphere, 37°Cand 5% CO2 in air). The viable cell count was measured bythe MTT (3-(4,5-dimethyldiazol-2-yl)-2,5 diphenyl tetrazoliumbromide) assay as described in (13) with some modifications.In brief, 0.1 � vol MTT solution (10 mg/ml in PBS) wasadded to each well at the end of the incubation period exceptfor the blank. After 3 h incubation the medium containingthe excess MTT was removed. The formazan crystals weredissolved in 200 �l isopropanol containing 0.4 M HCl.Extinctions were measured by a microplate reader at 540 nM(reference 690 nM).

Inhibition of protein synthesis

The efficacy in inhibiting the protein synthesis was deter-mined for both native and reduced riproximin (riproximintreated with 1% �-mercaptoethanol for 1h at 37°C, to disso-ciate the A- and B-chains), obtained by affinity purification, asdescribed above.

A nonradioactive method based on the TNT Quick Cou-pled Transcription/Translation System (Promega, Mann-heim, Germany) was used to determine the protein synthesis-inhibiting activity (14). Equal amounts (8�28.5 �l) of atranscription/translation mix (240 �l TNT Quick Master Mix,6 �l 1 mM methionine, 12 �l T7 luciferase control DNA, and27 �l H2O) were distributed into separate tubes (two controland six inhibition reactions) and incubated at 30°C. After 5,7, 9, 11, 13, and 15 min incubation, 2 �l samples of the firstcontrol tube were diluted in 80 �l bioluminescence buffer(20 mM Tricin, 0.05% (w/v) BSA, pH�7.8) and immediatelyfrozen in liquid nitrogen to stop the reaction. Thereafter, 1.5�l Tris-HCl buffer (20 mM Tris-HCl, pH�7.0, control) orTris-HCl buffer containing appropriate riproximin dilutions(inhibiton reactions) were added to the reaction mix in theremaining seven tubes and further incubated at 30°C. Sam-ples (2 �l) were collected from each reaction at 18, 20, 22, 24,26, 28, and 30 min, respectively, and treated as describedabove. The relative luciferase content of the samples wasdetermined with the Luciferase Assay System (Promega,Mannheim, Germany) on a MicroLumat Plus luminometer(Berthold Technologies, Bad Wildbach, Germany). Five mi-croliters of each diluted sample were mixed with 50 �lluciferase reagent and the chemoluminescence (cpm) wasmeasured for 10 s after an initial delay of 2 s. For eachreaction, the absolute luminescence count of the 18 minsample was subtracted from that of the 24 min sample (valuesin sqrt), yielding the relative amount of luciferase generatedwithin this interval. The results were calculated as percent ofthe luciferase amount generated in the control reaction(100%) and plotted against the riproximin concentration.

In vivo efficacy

For determining the effect of the purified protein (riprox-imin) in a rat liver metastasis model, the rat colon cancer cell

E335RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

line CC531-lacZ was used (15,16). In short, 4 � 106 CC531-lacZ cells were implanted via the portal vein on day 0 intomale Wag/Rij rats (Charles-River, Sulzfeld, Germany). Tu-mor-bearing rats were treated perorally (by gavage) or intra-peritoneally (i.p.) with the aqueous extract starting on day 1,as shown in Table 1. Three weeks later (day 21) the experimentwas terminated, the liver of the animals was removed, weighed,and kept at –80°C until analysis. The number of tumor cells perliver was determined by the �-galactosidase assay (AppliedBiosystems, Darmstadt, Germany) as described earlier (15), bycomparing to a standard curve established with a mixture ofhealthy liver tissue and rising numbers of tumor cells.

Mass spectroscopy

After nonreducing SDS-PAGE separation of the affinity-puri-fied protein mixture and staining with Coomassie blue, theupper protein band was cut out from a nonreducing gel andan in-gel digestion was performed with trypsin as described in(17). The eluted tryptic peptides were analyzed by electro-sprayionisation mass spectrometry (MS-MS) on a hybrid Q-TOF mass spectrometer type Q-Tof2 (Waters Micromass,Manchester). For the obtained mass spectra, a databasesearch was performed using the program Mascot search fromMatrix science (18). Additional de novo peptide sequenceswere obtained from the MS-MS spectra analysis as describedin (19) (courtesy of Dr. W. Lehmann).

Cloning and sequencing

RNA was isolated from fresh Ximenia americana leaves andcDNA synthesized. A schematic overview of the sequencing

procedure is given in Fig. 1. Degenerated primers (deg-senseand deg-antisense, Table 2) were designed from peptide se-quences obtained by mass spectrometry and a polymerase chainreaction (PCR) amplification was performed (Fig. 1a). Theamplified fragment (�400 bp) was sequenced and gene-specificprimers were designed (Table 2). The specific antisense primersp31rew3Xa and p31rew4Xa (nested) were used together withthe degenerated primer RMLA2-frw (20) to 5� extend thesequence (Fig. 1b). Amplification of the 5� and 3� cDNA endswas performed by the RACE method using the SMART-RACEkit from BD Biosciences (Heidelberg, Germany) as shown in Fig.1c. The sequence was confirmed by amplification with a proof-read polymerase and subsequent sequencing. Sequencing of thePCR-amplified DNA fragments was performed on an ABI PRISM310 Genetic Analyzer (Applied Biosystems, Darmstadt, Ger-many) as described by the manufacturer.

For N-terminal sequencing by Edman degradation, theaffinity-purified proteins were separated by SDS-PAGE underreducing conditions, blotted onto a PDVF membrane andvisualized with Coomassie blue. Each of the four proteinbands was cut out from the membrane and sequenced on aProcise 494 protein sequencer (Applied Biosystems, Darm-stadt, Germany, courtesy of Dr. H. Heid).

An independent mass spectrometric investigation was per-formed for each of the four protein bands separated byreducing SDS-PAGE. The Coomassie blue-stained proteinbands were submitted for ESI MS-MS analysis to the Proteomefactory, (Berlin, Germany).

Sequence analysis

For sequence analysis, programs from the HUSAR package(DKFZ, Heidelberg, Germany) were used. Database search

TABLE 1. Antineoplastic effect of riproximin in the CC531-lacZ rat liver metastasis model

GroupNo.

No. ofanimals

Treatment1 Liver weightNet increase in liver

weight3 Tumor cell no./Liver2

Dosage(pmol/kg) Route

Total dose(pmol/kg) Mean � sd (g) T/C4 % Mean (g) T/C4 % Mean � sd T/C4 %

1 4 Control — — 26.5 � 15.2 100.0 18.5 � 15.2 100.0 235 � 197�107 100.02 25 10 p.o. 100 8.1 � 0.1 30.46 0.1 � 0.1 0.36 3 � 2�107 1.06

3 4 1 i.p. 10 13.7 � 10.2 51.6 5.7 � 10.2 30.7 58 � 99�107 22.66

4 5 0.5 i.p. 5 13.4 � 6.6 50.4 5.4 � 6.6 29.0 89 � 117�107 34.95 4 0.25 i.p. 2.5 15.2 � 7.6 57.5 7.2 � 7.6 39.1 121 � 138�107 47.4

1Administration started on day 1 and was repeated every second day until day 19, on day 21 the animals were sacrificed.24 � 106 CC531-lacZ cells were implanted on day 0.3The net increase in liver weight was calculated by subtracting the initial liver weight (8 g, corresponding to the mean weight of a normal

rat liver) from the observed liver weight, respectively.4Treated over control x 100.5The small number of animals tested was due to the limited amount of protein available.6p � 0.05 (Wilcoxon rank sum test).

Figure 1. Schematic overview of proceduresinvolved in determining the complete cDNAsequence of riproximin. a) Initial amplificationwith degenerated primers; b) 5� extension of thesequence using the RMLA2-frw degeneratedprimer designed on the type II RIP A-chainactive site; c) RACE amplification of the 5� and3� ends.

E336 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

with newly obtained peptide/DNA sequences was performedwith the program FASTA. The respective DNA sequenceswere assembled with the program CAP. The resulting proteinsequence was aligned with other RIP sequences with theprogram CLUSTAL. Homology and identity to known RIP-sequences were calculated with the program GAP.

Homology modeling of the riproximin 3D structure

Based on the alignment of the riproximin precursor se-quence with known type II RIP-sequences, the putative se-quences for the A and B riproximin chains were chosen anda FASTA-search of the PDB-database (www.pdb.com) wasperformed. For modeling the riproximin A-chain, the struc-ture of the recombinant ricin R213D A-chain was chosen(PDB accession no. 1UQ4; 21). Modeling of the riproximinB-chain was based on the structure of the mistletoe lectin IB-chain, refined to 2.05 (PDB accession no. 1SZ6). The A-and B-chain models were calculated following the approachof comparative protein modeling on the SWISS-MODELAutomated Protein Modeling Server (22). The quality of themodels was checked with the programs WHAT_CHECK (23)as well as PROCHECK (24).

Galactose docking simulation

A “blind docking” approach using AUTODOCK 3.05 (25) wasapplied to screen the surface of the B-chain for potential�-Gal binding sites. The various files required as input forAUTODOCK were created with the help of “AutoDockTools”(http://www.scripps.edu/�sanner/python/adt/) and theConformational Analysis Tools (CAT) program (http://www.md-simulations.de/cat/). The genetic algorithm withlocal search option (GA-LS) as implemented in AUTODOCKwas used to dock the flexible ligand. Two docking strategieswhere employed: one using the rigid homology model astarget for the docking and a second introducing proteinflexibility into the docking protocol by generating an ensem-ble of protein conformations using molecular dynamics (MD)simulation with the homology model as starting structure. Forthe MD simulation the GROMACS software (www.gromacs.org) was used (GROMOS 96 force field, 300 K, 1 ns simula-tion time, integration step 2 fs, particle-mesh Ewald electro-statics, explicit water molecules as solvent, ions added tocounterbalance charges of protein). For the rigid protein 100AUTODOCK jobs were started each performing 256 GA-LSruns giving rise to 20510 docked �-Gal structures. Thedocking protocol with flexible protein implied 1000 startingstructures derived from the MD simulation and 20 GA-LSruns were performed for each of them resulting in 27631

docked solutions. CAT was used to merge the output data ofthe AUTODOCK runs to perform the analysis of the entiredataset and organize the results in such a way that areas onthe protein surface exhibiting a strong binding affinity can beeasily visualized using standard display programs.

RESULTS

Purification

Purification of riproximin was performed according toa four-step procedure. Preextraction of the raw mate-rial with 70% acetone reduced the concentration oftannins in the subsequent water extract below detectionlimit (1). Reducing SDS-PAGE of this extract as well asof the subsequently obtained one-step DEAE eluate(500 mM NaCl) revealed a complex pattern of proteinbands which was overlaid by a Schiff’s-reagent-positivesmear (Fig. 2a, lanes 1 and 2). Following affinitychromatography, the biologically active fractionshowed only four bands with apparent MW of 34, 31, 29and 27 kDa, respectively, in a reducing SDS-PAGE gel(Fig. 2a, lane 3). Nonreducing SDS-PAGE revealed thepresence of only two proteins with apparent MW of 56and 51 kDa, respectively (see ref. 1), implying that theaffinity-purified sample consists of two heterodimericproteins. In a typical preparation with one-step elutionfrom DEAE-cellulose, 90 �g affinity-purified proteinswith cytotoxic activity (see below) were obtained from20g raw material. This affinity-purified protein fraction(shown in Fig. 2a, lane 3) was used for all subsequentexperiments. One of the two proteins, for which thecDNA sequence was determined, was termed “riprox-imin.”

When a stepwise elution from the DEAE-cellulosewith increasing NaCl concentrations was performed,only the fractions following 200 and 400 mM NaClshowed detectable cytotoxic activity. These fractionsshowed a very complex band pattern with only slightdifferences when analyzed by reducing or nonreducingSDS-PAGE (data not shown). When the 200 mM NaCland the 400 mM NaCl DEAE fractions were subse-quently processed by affinity chromatography, the pu-

TABLE 2. Sequences of primer used for amplification and sequencing of the riproximin cDNA.

Amplification Primer Direction Sequence (5�-3�)1

1st amplification deg-sense forward TGCNAAYCAGCTSTGGACdeg-antisense reverse CNGGRTARAGWGCCCA

5� extension RMLA2-frw forward ATICAGATGGTIIIIGAGGCIGCIIIITTTGGATCCATp31rev3Xa reverse CGTCCCGCTCGTTCCCAACp31rev4Xa reverse GCAGTCAAAACAAGCGAGGATGCAG

5� RACE XaRev2 antisense CTGCCACGTGTTTATGAACCTGXaRev4 antisense GTTGAATCCCAGGGTAATACTGTCTXaRev5 antisense GTAGTCTCTTTGGGTGAGGCCG

3� RACE p31frw2Xa sense TGCGGAGTTGGGAACGAGCGGGp31frw3 sense CAAGCAACTGGAAATGGGGTGTGGC

1The abbreviations for wobbled nucleotides are used according to the IUPAC-IUB rules: N � A, G, C or T; Y � T or C; S � G or C; R �A or G; W � A or T. I � inosine

E337RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

rified samples contained different ratios of the four(reducing SDS-PAGE, Fig. 2b) or two bands (nonreduc-ing SDS-PAGE, Fig. 2c), respectively. The 34 and 29 kDabands (reducing SDS-PAGE, Fig. 2b, lane 1) and the 56kDa band (nonreducing SDS-PAGE, Fig. 2c, lane 1)prevailed in the affinity-purified sample originatingfrom the 200 mM NaCl DEAE fraction, while the 31 and27 (reducing SDS-PAGE, Fig. 2b, lane 2) and the 51 kDaband (nonreducing SDS-PAGE, Fig. 2c lane 2) pre-

vailed in the affinity-purified sample originating fromthe 400 mM NaCl DEAE fraction. Thus it becameobvious that the protein with the apparent MW of 56kDa consists of two subunits of 34 and 29 kDa, whereasthe 31 and 27 kDa bands are subunits of the smallerprotein (apparent MW 51 kDa). Since both fractionsshowed comparable cytotoxic activity (see below), it canbe assumed that both proteins are cytotoxic.

Deglycosylation experiments

On treatment with N-glycosidase F, there was a shift ofthe four bands toward lower MW. To better define theeffect on each subunit, they were treated individuallyafter excision from gel. This experiment showed thatthe 34 and 31 kDa protein bands were shifted to anapparent MW of 30 and 29 kDa, respectively (Fig. 2d,lanes 4 and 5), indicating an extensive N-glycosylationof the original protein subunit. Conversely, the sub-units with the apparent MW of 29 and 27 kDa areprobably not N-glycosylated, since no MW shift wasobserved upon treatment with N-glycosidase F (Fig. 2d,lanes 2 and 3).

Cytotoxicity

The antiproliferative activity of the affinity-purifiedprotein fractions was determined in MCF7 humanbreast cancer, HELA cervix carcinoma and CC531-lacZrat colon cancer cells (Fig. 3).

The affinity-purified sample obtained after a one-stepDEAE-cellulose elution with 500 mM NaCl showed adistinct cytotoxic effect in all three cell lines (Fig. 3a),as evidenced by IC50 values of 0.5 pM (MCF7), 1.1 pM(HELA) and 0.6 pM (CC531-lacZ). Despite the verysimilar IC50, the dose-response curves of the three celllines differed in their slope, as reflected by theirIC90/IC10 ratios of 83 (MCF7), 6.6 (HELA), and 20(CC531-lacZ).

When the total biological activity was separated bystep gradient DEAE elution and the activity of the 200and 400 mM NaCl fractions tested after affinity purifi-cation, comparable cytotoxic effects were observed inMCF7 cells. The concentration of the two fractions wasbelow the detection limit (A280nm�0.02). However,since the SDS gel lanes showed a comparable proteincontent (Fig. 2c, d), the respective volumes were usedfor a dilution series. IC50 values in MCF7 cells wereachieved by a 30,000-fold dilution of the affinity-puri-fied sample originating from the 400 mM NaCl frac-tion, and by a 15,000-fold dilution of that from the 200mM NaCl fraction (Fig. 3b). Given that the detectionlimit (A280�0.02) corresponds to a concentration of 0.1�M, the IC50 values derived from the respective dilu-tions are below 3.3 and 6.6 pM for the affinity-purifiedsamples originating from the 400 and 200 mM NaClfractions, respectively. These values relate well to theIC50 value measured for the complete protein fractionobtained by affinity purification of the 500 mM NaClfraction (0.5 pM in MCF7 cells, see above).

Figure 2. SDS-Polyacrylamid-gel electrophoresis of samplesobtained during the purification of riproximin. Gels a, b, andc were run with MOPS buffer, followed by silver staining. Forbetter resolution at low MW, gel d was run with MES bufferand stained with Coomassie blue. a) Riproximin purificationgrade monitored by reducing SDS-PAGE: extract (lane 1),total DEAE fraction eluted with 500 mM NaCl (lane 2), theaffinity-purified sample (lane 3), and MW marker in kDa (M).b) Reducing SDS-PAGE (dissociating the disulfide bonds) ofaffinity-purified samples obtained from DEAE fractionseluted with 200 mM NaCl (lane 1) and 400 mM NaCl (lane2), MW marker in kDa (M). c) Nonreducing SDS-PAGE(keeping the disulfide bonds intact) of affinity-purified sam-ples obtained from DEAE fractions eluted with 200 mM NaCl(lane 1) and 400 mM NaCl (lane 2), MW marker in kDa (M).d) Reducing SDS-PAGE showing the affinity-purified sampleobtained from the complete DEAE fraction (500 mM NaClelution) (lane1) in comparison with the protein subunitsafter treatment with N-glycosidase F (lanes 2–5) and MWmarker in kDa (M). The protein subunits were deglycosylatedby N-glycosidase F treatment of each of the four bandsexcised from a previously run SDS-PAGE. Lane 2 shows nodiscernible shift of the 27 kDa band, lane 3 shows nodiscernible shift of the 29 kDa band, lane 4 shows a shift of the31 kDa band to 29 kDa, and lane 5 shows a shift of the 34 kDaband to 30kDa.

E338 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

Inhibition of protein synthesis

The affinity-purified protein sample clearly inhibitedthe synthesis of luciferase in an in vitro reticulocytelysate transcription/translation assay (Fig. 4). A clearconcentration-dependent translation inhibition wasseen in response to 0.17 to 50 nM nonreduced orreduced protein (Fig. 4a, b), reflecting the activities ofthe heterodimeric protein and the separated A-chain,respectively. For calculating the relative luciferaseamounts synthesized in each reaction, the linear phaseof the kinetics was chosen (18–24 min). The IC50 fortranslation-inhibition was achieved at a riproximin con-centration of 5.5 nM (nonreduced) or 2.6 nM (re-duced), (Fig. 4c).

In vivo experiments

As shown in Table 1, the affinity-purified protein sam-ple obtained after a one-step DEAE-cellulose elution

was administered to male tumor-bearing Wag Rij ratsvia the peroral and the i.p. route. No toxicity wasobserved after total dosages of i.p. up to 10 pmol/kgand p.o. up to 100 pmol/kg. Intraperitoneal adminis-tration of 0.25, 0.5, and 1 pmol/kg every second daydose-dependently reduced the increase in tumor cellnumber seen in untreated tumor-bearing rats as indi-cated by T/C % (treated/control�100) ratios of 47.4,34.9, and 22.6 (P�0.05), respectively (Table 1). Theeffect on the liver wt was less prominent, with T/C %ratios of 57.5, 50.4, and 51.6, respectively. Peroraladministration of 10 pmol/kg every second day wassurprisingly effective: compared wtih the untreatedcontrols, the mean liver wt of the treated animals was

Figure 3. a) Concentration-effect curves of the affinity-puri-fied protein sample in MCF7 breast cancer, HELA cervixcarcinoma and CC531-lacZ rat colon carcinoma cells. T/C %(treated/control�100) � ratio of surviving cells in percent ofcontrol. b) Cyototoxicity curves of the affinity-purified proteinsamples originating from the 200 and 400 mM NaCl DEAEfractions, respectively, in MCF7 breast cancer cells. Since theprotein concentration of the samples was below the detectionlimit, the cytotoxic effect was plotted against the dilutionfactor.

Figure 4. Effect of the affinity-purified protein sample in an invitro translation assay. a) Kinetics of luciferase synthesis in thepresence of various concentrations of the nonreduced pro-teins; b) kinetics of luciferase synthesis in the presence ofvarious concentrations of the reduced proteins; c) compari-son of the concentration-dependent translation efficacies inresponse to reduced and nonreduced proteins.

E339RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

significantly lower (T/C %�30.5, P�0.05, Table 1) andtheir mean tumor cell number was reduced by twoorders of magnitude (T/C %�1.0, P�0.05, Table 1).

Identification of the affinity-purified protein andcDNA sequencing

Two peptides showing homology to B-chain sequencesof type II ribosome-inactivating proteins (RIPs) wereidentified by database search and de novo sequencing,respectively. Aligning of these peptides allowed thedesign of degenerated primers and the amplification ofa ca. 400 bp DNA fragment containing a continuousopen reading frame (ORF). The translation of thisframe resulted in a protein sequence showing highhomology to the B-chain of known type II RIPs. Thecomplete sequence of the respective cDNA (1990 bp),containing an ORF of 1814 bp, was obtained as de-scribed under Materials and Methods and as shown inFig. 1. The sequence preceding the frame-start codonATG (pos. 177–179) contains several stop-codons inframe with the ORF, as common for 5� untranslatedregions. At 28 positions of the cDNA sequence singlenucleotide polymorphisms (SNPs) were identified, 10of which lead to the translation of different aminoacids.

The homology of the translated protein sequence toknown type II RIP precursor protein sequences dem-onstrates that the new protein termed “riproximin” is aso far unknown member of this class. The riproximincDNA sequence was submitted to the EMBL database(accession no. AM114537).

A second MS-MS analysis for each of the four proteinsubunits separated by SDS-PAGE under nonreducingconditions resulted in information on tryptic peptidesthat are identical or highly homologous with the cDNA-derived riproximin sequence. Two tryptic peptides,CLSTSFGR and SNTDANQLWILK, were obtainedfrom the 31 kDa band; both are identical to stretches ofthe cDNA-derived riproximin sequence (amino acids396 – 403 and 374 – 385, respectively). The proteinband with an apparent MW of 34 kDa revealed apeptide with the sequence SNTDANQLWTLK, whichdiffers by a single amino acid (T at position 10 of thepeptide, shown in bold) from the cDNA-derived se-quence (amino acids 396 – 403 with I at position 383).It can be therefore assumed that the protein subunitswith apparent MW of 34 and 31 kDa are B-chains of thetype II RIP molecules riproximin and of a so farunknown homologue. For the respective A-chains, theN-terminal sequences were obtained by Edman degra-dation (see below).

Figure 5 shows an alignment of the riproximinsequence to the database sequences of ricin (SwissProt:riciricco, P02879) and viscum lectin I (SwissProt:ml1_visal, P81446). At the positions affected by thecDNA SNPs, both amino acids were specified. Two ofthe 10 amino acid variations are contained in theN-terminal signal peptide, six in the sequence of theA-chain and two in that of the B-chain.

Sequence analysis

The sequence of the riproximin precursor proteinshares 55% similarity and 47% identity with that of thericin precursor as well as 53% similarity and 45%identity with the sequence of the viscum lectin I pre-cursor, both of which belong to the subgroup of toxictype II RIPs. On the other hand, the sequence homol-ogy to the nontoxic Sambucus type II RIPs ebulin 1(EMBL: SEB400822, AJ400822) and nigrin b (Swiss-Prot: NIGRB_SAMNI, P33183) was lower (48% and45% similarity as well as 40% and 37% identity, respec-tively). These homology data suggest that riproximin isa toxic member of the type II RIP family.

N-terminal blockade prevented determining the N-terminal sequence of the B-chains (apparent MW 34 and31 kDa) by Edman degradation. The A-chains alsoshowed a high extent of N-terminal blocking. However, byincreasing the amount of protein, both of the A-chains(apparent MW�27 and 29 kDa, respectively) revealed theN-terminal sequence DYP, a sequence found at position57–59 of the cloned riproximin precursor. The probableC-terminal end of the A- and the beginning of the B-chainwere estimated based on homology to other type two RIPsincluding ricin, viscum lectin I, abrin, cinnamomin, ebu-lin, and nigrin, as described below. The sequence of thepresumed A- and B-chains is indicated in Fig. 5. However,since the exact positions of the A-chain C-terminus andB-chain NH2 terminus have not yet been experimentallyverified, the amino acid numbering was based on thesequence of the precursor protein. The MW calculatedfor the riproximin A- and B-chains varied between 29 and31 kDa, pending on the exact A-chain C-terminus andB-chain NH2 terminus positions and the allelic variation.

The presumed A-chain shows 49% similarity and42–43% identity to that of viscum lectin I, 49–50%similarity and 41–42% identity to the ricin A-chain, and42% similarity and 33–35% identity to that of nigrin b.The invariant residues within the active site are allconserved within the sequence of the riproximin A-chain: tyr73, arg81, tyr133, tyr172, glu230, arg233 and trp267

correspond to ricin tyr21, arg29, tyr80, tyr123, glu177,arg180, and trp211. In addition, the conserved C-termi-nal cysteine residue (cys259 in the A-chain of ricin)which is involved in the intermolecular disulfide bond-ing corresponds to cys317 in riproximin and signals theend of the riproximin A-chain. A second cysteine-residue within the A-chain, cys224, corresponds to cys171

in the A-chain of ricin but is not present in the viscumlectin I A-chain. While the ricin A-chain contains twoglycosylation sites, the only potential glycosylation siteof the riproximin A-chain was identified within thesequence of one of the alleles (asn159), and is replacedby thr159 in the other allele.

The riproximin B-chain shares 65% and 57–58%similarity as well as 57–58% and 49–50% identity withthe B-chains of the toxic RIPs ricin and viscum lectin I,respectively. The homology to the nontoxic RIPs ebulin1 and nigrin b is lower, as shown by 53% and 51%similarity as well as 45–46% and 43–44% identity,

E340 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

respectively. The eight cysteine residues known to beinvolved in four conserved intramolecular disulfide-bridges in the type II RIP B-chains (cys20–cys39, cys63–cys80, cys151–cys164

, cys190–cys207 in ricin), as well as theB-chain N-terminal cysteine involved in the formationof the intermolecular disulfide-bridge between the A-and B-chains (cys4 in ricin), are all found in theriproximin B-chain as cys353–cys372, cys396–cys415,cys487–cys500, cys526 – cys546 (intramolecular bridges)and cys337 (N-terminal, binding A-chain cys317). Inaddition, the B-chain of riproximin contains anothercysteine residue (cys529) aligning to cys194 of the viscumlectin I B-chain. All highly conserved residues previ-ously reported to be involved in building the hydropho-bic core of the B-chain are conserved or replaced bysimilar hydrophobic amino acids. The riproximinB-chain contains two potential glycosylation sites,asn430 and asn470, which correspond to highly con-served glycosylation sites within the B-chain sequence

of other type II RIPs (asn95 and asn135 in the B-chainof ricin).

A comparison of the two sugar affinity domainsfound in the B-chains of type II RIPs shows that most ofthe amino acid residues involved in sugar binding areconserved in the B-chain of riproximin. The 1 subdo-main amino acid residues asp22, trp37, asn46 and gln47

of the ricin B-chain correspond to asp355, trp370, asn379,and gln380 in the 1 subdomain of the riproximinB-chain, whereas gln35 in ricin is replaced by ile368 inriproximin. The 2 subdomain amino acid residuesasp234, asn255 and gln256 of ricin correspond to asp573,asn594, and gln595 in the 2 subdomain of riproximin,whereas ile246 and tyr248 in ricin are replaced by leu585

and trp587 in riproximin, respectively.

Homology modeling

According to the PROCHECK* analysis (Ramachand-ran plot), 88.6% of the A-chain-amino acids were in

Figure 5. Protein sequence alignment of riprox-imin (submitted to the EMBL database, acc. no.AM114537) with ricin (acc. no. P02879) andviscum MLI (acc. no. P81446). The sequencesof the ricin and viscum MLI A- and B-chains, aswell as the presumed sequence of the riprox-imin A- and B-chains, are given in black, se-quences of the N-terminal signal and of thelinker peptides are given in gray. Cystein resi-dues are high-lighted in yellow, the positions ofthe intramolecular and intermolecular disulfidebonds are indicated by solid and dashed lines,respectively. The amino acids involved in thecatalytically active center of the A-chain and thesugar binding sites of the B-chain are high-lighted in pink. Potential N-glycosylation sitesare highlighted in green. Amino acids buildingthe hydrophobic core of the B-chain are high-lighted in gray.

E341RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

favored, 11.0% in allowed and only 0.4% (arg155) indisallowed conformation. For the B-chain, 80.7% and18.5% of the amino acids were in favored or allowedconformation, respectively, and only 0.8% (tyr413,ile417) was found within the disallowed area. The over-all average G factor (ideally � –0.5) was calculated tobe –0.03 for the A chain model and as –0.15 for the Bchain model, respectively.

The 3-dimensional model of riproximin (Fig. 6)clearly visualizes the A- and B-chains as well as thedisulfide bridge linking the chains. The amino acidresidues predicted to be involved in the ribonucleaseactivity of the A-chain cluster within a cleft on thesurface and probably constitute the active catalytic site.The B-chain is characterized by a two-domain structure,each of them containing a potential sugar binding site.The location of eight cysteine residues allows theformation of the four predicted intramolecular disul-fide bridges within the B-chain. The three potentialglycosylation sites of riproximin are located on thesurface of the molecule and thus are probably glycosy-lated in the mature protein. Except for asn159, which isthe only glycosylation site on the A-chain, none of theallelic variations of riproximin shows a significant effecton the 3-dimensional structure, glycosylation, disulfidebridge formation, catalytic site, or sugar binding do-mains.

Galactose docking simulation

The blind docking docking calculation using the rigidhomology model as target for docking resulted in three

binding sites with maximum energy (Fig. 7). Two of thebinding sites found are analogous to those found forthe mistletoe lectin I structure (next to trp370 andtrp587, corresponding to the 1 and 2 subdomains,respectively). A third docking site of similar affinity waslocated close to gln583. A binding site found recently inthe 1� subdomain of Himalayan mistletoe RIP (26) waspredicted for riproximin from the docking as well (nextto phe401 and tyr413) but with slightly lower affinity.Surprisingly, the analysis of the docking calculationwith a flexible protein showed that the binding affinityof the trp370 binding site (1 subdomain) is signifi-cantly reduced compared with trp587 (2 subdomain).This seems not to be an artifact of the method used,since an application of the same protocol using themistletoe lectin I structure (PDB code 1OQL) with anile368 mutation resulted in a comparable affinity forboth binding sites (data not shown).

DISCUSSION

A mixture of two new type II ribosome-inactivatingproteins was identified to be the active principle of the

Figure 6. Molecular model of riproximin, showing the cata-lytic site of the A-chain (red), the intermolecular disulfidebridge (yellow), the B-chain sugar binding domains 1(green) and 2 (pink) as well as the potential N-glycosylationsites (dark blue).

Figure 7. Surface-model of the riproximin B-chain showingpotential �-galactose binding sites as revealed by a blind-docking approach using AUTODOCK 3.05. Whereas bothexpected �-Gal binding sites (1 and 2) are found by thedocking approach using the rigid molecular model (a), theflexible docking approach (b) predicts a complete loss ofaffinity of the sugar binding site in the 2 subdomain (arrow).

E342 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

antineoplastic activity contained in Ximenia americanaplant material.

The initial characterization of an aqueous Ximeniaamericana extract had hinted at a ribosome-inactivatingprotein (1). Subsequently, a fraction containing twoproteins could be purified, with both proteins showingcytotoxic activity.

Alignment of de novo sequenced peptides obtained bytryptic digestion of one of these proteins allowed thedesign of degenerated primers, which amplified �400bp of a corresponding gene. This fragment in turn wasstarting point for sequencing the complete cDNA. Thetranslated protein sequence was found to be homolo-gous to type II RIP precursor sequences and thusconfirmed the protein, which we termed riproximin, tobe a member of this family.

All known type II RIPs are encoded by a single geneand post-translationally processed into the typical two-chain structure by cleaving off an N-terminal signal anda linker peptide. Moreover, many RIP expressing plantscontain more than one RIP precursor gene and thuscontain mixtures of RIP isoenzymes (27). Similarly, theXimenia americana extract analyzed here contains amixture of two homologous proteins, most probablytype II RIP isoenzymes.

This conclusion is derived from the biological activityof each of the two proteins as well as from MS-MS andN-terminal sequence analysis, showing the presence oftwo B-chains and two A-chains in the mixture. Notably,the protein sequence information obtained from oneof the B-chains as well as from the A-chain N-terminalsequences is identical to the cDNA derived sequencestretches of riproximin. MS-MS sequences derived fromthe other B-chain show high homology but no identityto the riproximin sequence, suggesting that the differ-ences between the two homologous proteins are relatedto a different primary structure and not merely theresult of differences in glycosylation. This is also sup-ported by the fact that the bands show different MWeven after deglycosylation. It is also unlikely that thedifferences observed in MW result from other types ofposttranslational processing, since no other modifica-tions have been described for type II RIPs so far. Theobserved cDNA allelic variation can not account for thepresence of two discernable proteins in the mixture,since MW-differences resulting from the exchange ofsix (A-chain) or two (B-chain) amino acids are too lowto be detected by SDS-PAGE separation.

On comparison with the sequences of ricin or viscumlectin I as well as after modeling the 3D structure of theriproximin A- and B-chains it became obvious that nonebut one of these amino acids affected by single nucle-otide polymorphism is involved in the function orstructure of the protein. The only exception is theasn/thr variation at position 159, which, when express-ing asn159, could serve as a glycosylation site on theriproximin A-chain. Because of its singularity, the pres-ence of this glycosylation site could contribute to amajor difference between the A-chains alleles.

All of the invariant amino acids involved in the

N-glycosidase activity of a RIP A-chain are conservedand cluster in the 3D model within a cleft likely to bethe active site of the riproximin A-chain. It can betherefore assumed that the A-chain of riproximin is afully active RNA N-glycosidase. Similar to other type IIRIP A-chains, the A-chain of riproximin has very lowlysine content (two of 263 amino acid residues). Thelow lysine content has been shown to be involved in theRIP-cytotoxicity, since it helps the RIP A-chain to escapeubiquitination and subsequent degradation on reloca-tion to the cytosol (28, 29).

The B-chain of type II RIPs consists of two homolo-gous domains termed 1 and 2, each containing threesubdomains termed 1, 1�, 1 and 2, 2�, 2 (30). Thesubdomains 1 and 2 are reported to be responsiblefor the sugar affinity of the B-chains of ricin (31),viscum lectin I (32) and other type II RIPs (3). TheB-chain of riproximin also shows this typical structure,including the conserved disulfide bridges and glycosyl-ation sites. In addition, most of the amino acids whichare responsible for sugar binding in ricin and viscumlectin I, are also present in the respective riproximinB-chain subdomains.

The cytotoxic effects of riproximin in vitro are char-acterized by a low IC50, which is comparable to that ofthe toxic RIP ricin (33), and a relatively steep, lineardose-response curve. The low IC50 is in line withclassifying riproximin into the subgroup of toxic type IIRIPs, as assumed from sequence homology. The IC50for translation-inhibition in a cell-free system washigher for the heterodimer than for the A-chain sepa-rated by reducing the intermolecular disulfide bridge.This is typical for a type II RIP since the RNA-glycosy-dase activity of the A-chain is inhibited to some degreeas long as the B-chain is attached. Moreover, the ratio issimilar to values reported e.g., for Sambucus nigra or Irishybrid type II RIPs (4).

Experiments with crude extract had shown that thein vitro IC50 in CC531-lacZ cells (3.3 �g/ml) corre-sponded to an in vivo effective dose of 5 mg/kg afteri.p. therapy. Equivalent anticancer activity was seenafter peroral administration of 100 mg/kg (1). Byextrapolating, a similar relationship of pharmacody-namic activities was assumed for the affinity-purifiedprotein sample. Therefore, the in vivo doses for intra-peritoneal therapy (0.25, 0.5, and 1 pmol/kg) wereselected from the respective in vitro IC50 (0.5 pM). Thedose for the peroral treatment was selected 20-foldhigher (10 pmol/kg), as had been done for the peroraltherapy with the crude extract.

The mean number of CC531-lacZ tumor cells grow-ing in the liver of Wag-Rij rats increased �600-fold inuntreated controls. This increase corresponds formallyto more than 9 cell divisions and was paralleled by amore than threefold increase in mean liver weight (15).

After p.o. treatment with the affinity-purified proteinsample, both the liver weight and the tumor cellnumber were significantly reduced when comparedwtih the untreated tumor-bearing control. The actualtumor cell number of p.o. treated rats corresponded to

E343RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP

an 8-fold increase relative to the initial tumor cellimplant, which is formally equivalent to 3 cell divisions.As observed for the extract, the i.p. route was associatedwith a lower effect than the p.o. route: A significantlyreduced tumor cell number was seen in response to thehighest dose only, causing �77% tumor growth inhibi-tion (defined as 100% � T/C%), whereas the differ-ence in mean liver weight was not significant whencompared with the control. When considering the netincrease in mean liver weight, which is a more specificindicator of tumor proliferation than the raw meanliver weight, the higher inhibition expressed in percentof untreated control (�69%) reflects the results ob-tained by determining the tumor cell number withinthe variation of a bioassay.

The high efficacy of the p.o. application is surprising,since proteins are commonly characterized by a low tovery low bioavailability, which is due to degradation inthe acidic stomach environment, to proteolytic en-zymes as well as to a poor uptake through the intestinalwall. Accordingly, the viscum lectin I is only poorlyabsorbed via the gastrointestinal tract. Despite a lowsystemic LD50 in mice (5–10 �g/kg), dietary dosages ashigh as 500 mg/kg (mice) and 200 mg/kg (rats) arewell tolerated (34, 35). In line with this, cancer treat-ment with the recombinant rViscumin is based onsystemic administration (9, 10). Nevertheless, highdoses of p.o. administered viscum lectin I are associatedwith some systemic activity: a diet containing up to 10mg viscum lectin I per day and mouse was effective inreducing the tumor mass of a non-Hodgkin lymphoma(35). Notably, this dose is by more than six orders ofmagnitude higher than the effective p.o. dose of riprox-imin (0.6 �g/kg administered every 2nd day).

The differences in toxicity and specificity of type IIRIPs are probably related to the sugar-specificity of therespective B-chains and their intracellular fate (36–39).It is interesting that only one of the two presumed sugarbinding domains of the riproximin B-chain is supposedto bind galactose according to a flexible docking sim-ulation assay. Whether this could be a reason for thehigh therapeutic efficacy of riproximin at a relativelylow p.o. dose remains to be elucidated.

In conclusion, these results suggest that riproximindiffers considerably in its pharmacological propertiesfrom other type II RIPs, thus indicating distinct poten-tial for cancer treatment.

We are indebted to Prof. Dr. M. Wink, Institute of Phar-macy and Biotechnology, University of Heidelberg, Germany,for his generous help in answering questions regarding plantbiology. We thank furthermore Dr. W. Lehmann (CentralSpectroscopy Unit, German Cancer Research Center, Heidel-berg) for the mass spectrometrical analysis of the protein andhis help with de novo sequencing of tryptic peptides as well asDr. H. Heid (Division of Cell Biology, German CancerResearch Center, Heidelberg) for the N-terminal sequencingof the protein chains. We are grateful to Dr. C. Kliem andProf. M. Wiessler (Department of Molecular Toxicology,German Cancer Research Center, Heidelberg) for kindlyproviding access to equipment for chromatographic separa-tions. Finally, we thank Dr. D. Kubler (Department of Patho-

chemistry, German Cancer Research Center, Heidelberg) forhelpful discussions.

REFERENCES

1. Voss, C., Eyol, E., and Berger, M. R. (2005) Identification ofpotent anticancer activity in Ximenia americana aqueous ex-tracts used by African traditional medicine. Toxicol. Appl. Phar-macol. (epub ahead of print, doi: 10.1016/j.taap. 2005.05.016)

2. Barbieri, L., Battelli, M. G., and Stirpe, F. (1993) Ribosome-inactivating proteins from plants. Biochim. Biophys. Acta 1154,237–282

3. Stirpe, F. (2004) Ribosome-inactivating proteins. Toxicon 44,371–383

4. Battelli, M. G. (2004) Cytotoxicity and toxicity to animals andhumans of ribosome-inactivating proteins. Mini. Rev. Med. Chem.4, 513–521

5. Lord, M. J., Jolliffe, N. A., Marsden, C. J., Pateman, C. S., Smith,D. C., Spooner, R. A., Watson, P. D., and Roberts, L. M. (2003)Ricin. Mechanisms of cytotoxicity. Toxicol. Rev. 22, 53–64

6. Lin, J. Y., Tserng, K. Y., Chen, C. C., Lin, L. T., and Tung, T. C.(1970) Abrin and ricin: new anti-tumour substances. Nature 227,292–293

7. Girbes, T., Ferreras, J. M., Iglesias, R., Citores, L., De Torre, C.,Carbajales, M. L., Jimenez, P., De Benito, F. M., and Munoz, R.(1996) Recent advances in the uses and applications of ribo-some-inactivating proteins from plants. Cell Mol. Biol. (Noisy-le-grand) 42, 461–471

8. Kreitman, R. J. (2003) Recombinant toxins for the treatment ofcancer. Curr. Opin. Mol. Ther. 5, 44–51

9. Schoffski, P., Riggert, S., Fumoleau, P., Campone, M., Bolte, O.,Marreaud, S., Lacombe, D., Baron, B., Herold, M., Zwierzina,H., Wilhelm-Ogunbiyi, K., Lentzen, H., and Twelves, C. (2004)Phase I trial of intravenous aviscumine (rViscumin) in patientswith solid tumors: a study of the European Organization forResearch and Treatment of Cancer New Drug DevelopmentGroup. Ann. Oncol. 15, 1816–1824

10. Schoffski, P., Breidenbach, I., Krauter, J., Bolte, O., Stadler, M.,Ganser, A., Wilhelm-Ogunbiyi, K., and Lentzen, H. (2005)Weekly 24 h infusion of aviscumine (rViscumin): A phase I studyin patients with solid tumours. Eur. J. Cancer 41, 1431–1438

11. Adam, K. P., and Becker, H. (2000) Peptide-Proteine. In Analytikbiogener Arznei-stoffe (Adam, K. P., and Becker, H., eds) pp.470–474, Wissenschaftliche Verlagsgesellschaft, Stuttgart, Ger-many

12. Pace, C. N., Vajdos, F., Fee, L., Grimsley, G., and Gray, T. (1995)How to measure and predict the molar absorption coefficient ofa protein. Protein Sci. 4, 2411–2423

13. Konstantinov, S. M., Topashka-Ancheva, M., Benner, A., andBerger, M. R. (1998) Alkylphosphocholines: Effects on humanleukemic cell lines and normal bone marrow cells. Int. J. Cancer77, 778–786

14. Langer, M., Rothe, M., Eck, J., Mockel, B., and Zinke, H. (1996)A nonradioactive assay for ribosome-inactivating proteins. Anal.Biochem. 243, 150–153

15. Wittmer, A., Khazaie, K., and Berger, M. R. (1999) Quantitativedetection of lac-Z-transfected CC531 colon carcinoma cells in anorthotopic rat liver metastasis model. Clin. Exp. Metastasis 17,369–376

16. Saenger, J., Leible, M., Seelig, M. H., and Berger, M. R. (2004)Chemoembolization of rat liver metastasis with irinotecan andquantification of tumor cell reduction. J. Cancer Res. Clin. Oncol.130, 203–210

17. Kinter M., and Sherman N.E. (2000) An ingel digestion proto-col. In Protein Sequencing and Identification using Tandem MassSpectrometry (Desiderio, D. M., and Nibbering, M. M., eds) pp.152–160, Wiley-Interscience, New York, U. S. A.

18. Perkins, D. N., Pappin, D. J., Creasy, D. M., and Cottrell, J. S.(1999) Probability-based protein identification by searchingsequence databases using mass spectrometry data. Electrophoresis20, 3551–3567

19. Kinter M., and Sherman N.E. (2000) Interpretation of theProduct ion Spectra of Tryptic Peptides. In Protein Sequencingand Identification using Tandem Mass Spectrometry (Desiderio,

E344 Vol. 20 June 2006 VOSS ET AL.The FASEB Journal

D. M., and Nibbering, M. M., eds) pp. 81–114, Wiley-Inter-science, New York

20. Eck, J., Langer, M., Mockel, B., Baur, A., Rothe, M., Zinke, H.,and Lentzen, H. (1999) Cloning of the mistletoe lectin geneand characterization of the recombinant A-chain. Eur. J. Bio-chem. 264, 775–784

21. Marsden, C. J., Fulop, V., Day, P. J., and Lord, J. M. (2004)The effect of mutations surrounding and within the activesite on the catalytic activity of ricin A chain. Eur. J. Biochem.271, 153–162

22. Schwede, T., Kopp, J., Guex, N., and Peitsch, M. C. (2003)SWISS-MODEL: An automated protein homology-modelingserver. Nucleic Acids Res. 31, 3381–3385

23. Hooft, R. W., Vriend, G., Sander, C., and Abola, E. E. (1996)Errors in protein structures. Nature 381, 272

24. Pontius, J., Richelle, J., and Wodak, S. J. (1996) Deviations fromstandard atomic volumes as a quality measure for protein crystalstructures. J. Mol. Biol. 264, 121–136

25. Morris, G. M., Goodsell, D. S., Halliday, R. S., Huey, R., Hart,W. E., Belew, R. K., and Olson, A. J. (1998) Automated dockingusing a Lamarckian genetic algorithm and an empirical bindingfree energy function. J. Comp. Chem. 19, 1639–1662

26. Mishra, V., Bilgrami, S., Sharma, R. S., Kaur, P., Yadav, S.,Krauspenhaar, R., Betzel, C., Voelter, W., Babu, C. R., andSingh, T. P. (2005) Crystal structure of himalayan mistletoeribosome-inactivating protein reveals the presence of a naturalinhibitor and a new functionally active sugar binding site. J. Biol.Chem. 280, 20712–20721

27. Hartley, M. R., Lord, J. M. (2004) Genetics of ribosome-inactivating proteins. Mini. Rev. Med. Chem. 4, 487–492

28. Deeks, E. D., Cook, J. P., Day, P. J., Smith, D. C., Roberts, L. M.,and Lord, J. M. (2002) The low lysine content of ricin A chainreduces the risk of proteolytic degradation after translocationfrom the endoplasmic reticulum to the cytosol. Biochemistry 41,3405–3413

29. Lord, J. M., Deeks, E., Marsden, C. J., Moore, K., Pateman,C., Smith, D. C., Spooner, R. A., Watson, P., and Roberts,L. M. (2003) Retrograde transport of toxins across theendoplasmic reticulum membrane. Biochem. Soc. Trans. 31,1260 –1262

30. Rutenber, E., Ready, M., and Robertus, J. D. (1987) Structureand evolution of ricin B chain. Nature 326, 624–626

31. Rutenber, E., Katzin, B. J., Ernst, S., Collins, E. J., Mlsna, D.,Ready, M. P., and Robertus, J. D. (1991) Crystallographicrefinement of ricin to 2.5 A. Proteins 10, 240–250

32. Krauspenhaar, R., Eschenburg, S., Perbandt, M., Kornilov, V.,Konareva, N., Mikailova, I., Stoeva, S., Wacker, R., Maier, T.,Singh, T., Mikhailov, A., Voelter, W., and Betzel, C. (1999)Crystal structure of mistletoe lectin I from Viscum album.Biochem. Biophys. Res. Commun. 257, 418–424

33. Munoz, R., Arias, Y., Ferreras, J. M., Jimenez, P., Rojo, M. A., andGirbes, T. (2001) Sensitivity of cancer cell lines to the novelnontoxic type 2 ribosome-inactivating protein nigrin b. CancerLett. 167, 163–169

34. Pusztai, A., Grant, G., Gelencser, E., Ewen, S. W. B., Pfuller, U.,Eifler, R., and Bardocz, S. (1998) Effects of an orally adminis-tered mistletoe (type-2 RIP) lectin on growth, body composi-tion, small intestinal structure, and insulin levels in young rats.J. Nutr. Biochem. 9, 31–36

35. Pryme, I. F., Bardocz, S., Pusztai, A., Ewen, S. W., and Pfuller, U.(2004) A mistletoe lectin (ML-1)-containing diet reduces theviability of a murine non-Hodgkin lymphoma tumor. CancerDetect. Prev. 28, 52–56

36. Barbieri, L., Ciani, M., Girbes, T., Liu, W. Y., Van Damme, E. J.,Peumans, W. J., and Stirpe, F. (2004) Enzymatic activity of toxicand non-toxic type 2 ribosome-inactivating proteins. FEBS Lett.563, 219–222

37. Girbes, T., Ferreras, J. M., Arias, F. J., Munoz, R., Iglesias, R.,Jimenez, P., Rojo, M. A., Arias, Y., Perez, Y., Benitez, J., Sanchez,D., and Gayoso, M. J. (2003) Non-toxic type 2 ribosome-inactivating proteins (RIPs) from Sambucus: occurrence, cellu-lar and molecular activities and potential uses. Cell Mol. Biol.(Noisy-le-grand) 49, 537–545

38. Citores, L., Munoz, R., Rojo, M. A., Jimenez, P., Ferreras, J. M.,and Girbes, T. (2003) Evidence for distinct cellular internaliza-tion pathways of ricin and nigrin b. Cell Mol. Biol. (Noisy.-le-grand)49 Online Pub, OL461-OL465

39. Battelli, M. G., Musiani, S., Buonamici, L., Santi, S., Riccio, M.,Maraldi, N. M., Girbes, T., and Stirpe, F. (2004) Interaction ofvolkensin with HeLa cells: binding, uptake, intracellular localiza-tion, degradation and exocytosis. Cell Mol. Life Sci. 61, 1975–1984

Received for publication October 10, 2005.Accepted for publication January 17, 2006.

E345RIPROXIMIN, A NEW ANTINEOPLASTIC TYPE II RIP