Visualizing ENCODE Data in the UCSC Genome Browser · Variant Annotation Integrator 1. Go to the...
64
Visualizing ENCODE Data in the UCSC Genome Browser Pauline Fujita, Ph.D. UCSC Genome Bioinformatics Group
Transcript of Visualizing ENCODE Data in the UCSC Genome Browser · Variant Annotation Integrator 1. Go to the...
Visualizing ENCODE Data in the
UCSC Genome Browser
Pauline Fujita PhD13 UCSC Genome Bioinformatics Group 13
13
Training Resources13 genomesoeucscedu
bull Genomewiki genomewikiucscedu13 bull Mailing list archivesgenomeucsceduFAQ13
bull Training page 13 genomeucscedutraininghtml13
bull Twitter GenomeBrowser13 bull Tutorial videos YouTube channel13 bull Open Helix openhelixcomucsc13
Outline
bull Basics search display more info bull Tools for finding ENCODE data bull Annotating a BED file RNAseq example
bull Annotating a VCF file bull Track Hubs What are they How do I
make one bull Exercises
Basic Navigation Main Display genomeucsceducgi-binhgTracksdb=hg19
Display Configuration
bull Visibility hide dense squish pack full
bull Track ordering drag and drop
bull Drag and zoomhighlighting bull Configuration page
bull Right click menu
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
13
Training Resources13 genomesoeucscedu
bull Genomewiki genomewikiucscedu13 bull Mailing list archivesgenomeucsceduFAQ13
bull Training page 13 genomeucscedutraininghtml13
bull Twitter GenomeBrowser13 bull Tutorial videos YouTube channel13 bull Open Helix openhelixcomucsc13
Outline
bull Basics search display more info bull Tools for finding ENCODE data bull Annotating a BED file RNAseq example
bull Annotating a VCF file bull Track Hubs What are they How do I
make one bull Exercises
Basic Navigation Main Display genomeucsceducgi-binhgTracksdb=hg19
Display Configuration
bull Visibility hide dense squish pack full
bull Track ordering drag and drop
bull Drag and zoomhighlighting bull Configuration page
bull Right click menu
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Outline
bull Basics search display more info bull Tools for finding ENCODE data bull Annotating a BED file RNAseq example
bull Annotating a VCF file bull Track Hubs What are they How do I
make one bull Exercises
Basic Navigation Main Display genomeucsceducgi-binhgTracksdb=hg19
Display Configuration
bull Visibility hide dense squish pack full
bull Track ordering drag and drop
bull Drag and zoomhighlighting bull Configuration page
bull Right click menu
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Basic Navigation Main Display genomeucsceducgi-binhgTracksdb=hg19
Display Configuration
bull Visibility hide dense squish pack full
bull Track ordering drag and drop
bull Drag and zoomhighlighting bull Configuration page
bull Right click menu
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Display Configuration
bull Visibility hide dense squish pack full
bull Track ordering drag and drop
bull Drag and zoomhighlighting bull Configuration page
bull Right click menu
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
How to find more info
Track Description
Item Description
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
More info Track Description
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
More info Item Description
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Super-track Settings
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Track Settings
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Item Details
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Tools
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE
ENCODE genomeucsceduENCODE
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Experiment Matrix
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE ChIP-Seq Matrix
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Experiment Summary
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
ENCODE Track Search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
AAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
GAAC
CTT
TCGA
TCTCCT
File Formats Scale chr2
GM12878 Ht 2 GM12878 Pk 2
2 kb hg19191876000 191877000 191878000 191879000 191880000 191881000
Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
STAT1 STAT1 STAT1 STAT1 STAT1
AG
-
TC CT TC G
CT
GM12878 Sg 2 100 _
1 _
K562 Z143 IgR 40 _
3 _
bitlyfileformatsession
BED
wig(gle)
BAM
VCF
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
File Formats hg19
191878000 191879000 191880000 191881000Basic Gene Annotation Set from GENCODE Version 19
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysisK562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
BED
wig(gle)
BAM
VCF
Positional annotations (ex Regions w enriched ChIP-seq signal for TF binding Δrsquol methylation splice jxns from RNA-seq) Continuous signal data of reads (ex DNase I HS and ChIP-seq signals)
Alignments of seq reads mapped to genome (ex RNA-seq alignments)
Variation data SNPs indels Copy Number Variants Structural Variants (ex ExAC data)
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Scalechr2
GM12878 Ht 2GM12878 Pk 2
2 kb191876000 191877000
STAT1STAT1STAT1STAT1STAT1
AGGAAC
CTT-
TCGATCCTTCGAAGGACTGAACTCAGGCAGAGTCCAAGAGTCGCAG
CTTCTCCT
GM12878 Sg 2100 _
1 _
K562 Z143 IgR40 _
3 _
DNaseI Hypersensitivity by Digital DNaseI from ENCODEUniversity of Washington
K562 Znf143 IgG-rab ChIP-seq Peaks from ENCODESYDH
K562 polyA+ IFNa30 RNA-seq Alignments from ENCODESYDH
191879000
Indexed File Formats 191878000
Basic Gene Annotation Set from GENCODE Version 19
GM12878 DNaseI HS Raw Signal Rep 2 from ENCODEUW
K562 TFBS Uniform Peaks of Znf143_(16618-1-AP) from ENCODEStanfordAnalysis
K562 Znf143 IgG-rab ChIP-seq Signal from ENCODESYDH
Exome Aggregation Consortium (ExAC) - Variants from 60706 Exomes
hg19191880000 191881000
BED bigBed
wig(gle) bigWig
BAM
VCF
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Indexed File Formats
bull Only displayed portions of files transferred to UCSC
bull Display large files (would time out) bull File + index on your web-accessible
server (http https or ftp)bull Faster display bull More user control
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
File Formats
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
File Formats
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
File Formats
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
File Formats wwwencodeprojectorghelpfile-formats
Help File formats
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Custom Tracks
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Custom Tracks genomeucsceducgi-binhgCustom
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Custom Tracks genomeucsceducgi-binhgCustom
track name=rdquoBED_custom_trackrdquo13 chr7 127471196 127472363 Gene1
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Annotating your data BED
Tools Data Integrator
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Data Integrator genomeucsceducgi-binhgIntegrator
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Data Integrator
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Data Integrator
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
httpgenomeucsceducgi-binhgIntegratorhgsid=43297266
1 of 1 62615 320 PM
Data Integrator ct_SYDHTFBS_4733chrom ct_SYDHTFBS_4733chromStart ct_SYDHTFBS_4733chromEnd ct_SYDHTFBS_4733name ct_SYDHTFBS_4733score wgEncodeGencodeBasicV19name wgEncodeGencodeBasicV19name2chr21 33031473 33032186 608 ENST000004493391 AP0002531 chr21 33031473 33032186 608 ENST000002701426 SOD1 chr21 33031473 33032186 608 ENST000003899954 SOD1 chr21 33031473 33032186 608 ENST000004709441 SOD1
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Annotating your VCF file
1 Make a VCF custom track 2 Go to the Variant Annotation Integrator 3 Choose your track 4 Add annotations
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Remotely Hosted Custom Tracks bull Put data file (bigBedbigWigBAMVCF etc)
in internet accessible location bull Must have 1 track info 2 bigDataUrl bull VCF example
track type=vcfTabix name=VCF_Example description=VCF Ex 1 1000 Genomes phase 1interim SNVs bigDataUrl= httphgwdevcseucscedu~paulinepresentationsvcfExamplevcfgz
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Variant Annotation Integrator13
bull Upload pgSnp or VCF custom track13 bull Associate UCSC annotations with your
uploaded variant calls13 bull Add dbSNP info if dbSNP identifier
found13 bull Select custom track and VAI options13
3713
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Variant Annotation Integrator13
Tools Variant Annotation Integrator
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Variant Annotation Integrator13 genomeucsceducgi-binhgVai
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Track Data Hubs 13
bull Remotely hosted13 bull Data persistence13 bull File formats 13
bigBED bigWig BAM VCF13 bull Track organization 13
groups supertracks13 bull multiWigs13 bull Assembly hubs13
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Track Hubs
My Data Track Hubs
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
My Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Make Your Own Track Hub
You will need bull Data (compressed binary index formats
bigBed bigWig BAM VCF) bull Text files to define properties of the
track hub bull Internet-enabled webftp server bull Assembly Hubs
a twoBit sequence file
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Track Hubs genomeucsceducgi-binhgHubConnect
My Data Track Hubs
myHub - directory containing track hub files
hubtxt - a short description of hub properties
genomestxt - list of genome assemblies included
hg19 - directory of data for the hg19 human assembly
Data files BAM bigBed bigWig VCF
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
An Example Assembly Hub
An Arabidopsis hub13 httpgenome-testcseucscedu
~paulinehubsPlantshubtxt13 13
131313
13
1313
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Acknowledgements UCSC Genome Browser team
ndash David Haussler ndash co-PI ndash Jim Kent ndash Browser Concept BLAT Team Leader PI ndash Bob Kuhn ndash Associate Director Outreach ndash co-PI ndash Donna Karolchik Ann Zweig ndash Project Management
Engineering QA Docs Support Sys-admins
Angie Hinrichs Katrina Learned Jorge Garcia Pauline Fujita Erich Weiler Kate Rosenbloom
Hiram Clawson Luvina Guruvadoo Gary Moro Steve Heitner Galt Barber
Brian Raney Brian Lee
Max Haeussler Jonathan Caspar Matt Speir
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
THE GB TEAM
UC Santa Cruz Genomics Institute
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Funding Sources
National Human Genome Research Institute (NHGRI)
National Cancer Institute (NCI)
National Institute for Dental and Cranio-Facial Research (NIDCR)
National Institute for Child Health and Human Development (NICHD)
QB3 (UCBerkeley UCSF UCSC)
American Recovery and Reinvestment Act (ARRA) stimulus funds
UC Santa Cruz Genomics Institute
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
genomeucscedu
THANK YOU
UC Santa Cruz Genomics Institute
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Exercises 1 Load example BED and VCF tracks via url 2 Look at custom track data by pasting url into a
web browser 3 Annotate the TFBS custom track using the Data
Integrator 4 Annotate the VCF custom track using the Variant
Annotation Integrator
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Exercise 1 Load example BED and VCF tracks via url
1 Go to the Custom tracks menu bull My Data -gt Custom Tracks
2 Input this url httpbitlycustomtracks (note that you must include the rdquohttprdquo part of this url or you will get an error) and click [submit]
3 Click the [Go to genome browser] button 4 Once in the main Browser jump to this position
bull chr2133034804-33037719 5 See if you can drag your 2 custom tracks to the top of
the display
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Exercise 2 Exploring your BED and VCF tracks
1 Now that you have 2 custom tracks loaded take a look at the data by pasting that same url into a web browser
2 These custom tracks are actually data copied from some existing tracks see if you can find them turn them on and observe that the original tracks and custom tracks look the same in the browser bull Track 1 (BED format) Group (Regulation) Super
Track (ENC TF Binding) Track (SYDH TFBS) bull Track 2 (VCF format) Group (Variation) Track
(1000G Ph1 Vars) 3 Navigate to this position for best comparison (esp for the
VCF track) chr2133034804-33037719
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Exercise 3 Annotate your BED with the Data Integrator
1 Go to the Data Integrator 2 Once there select
1 Region to annotate chr2133031597-33041570 2 Add data source group (custom tracks) track (SYDHhellip) [click
add]3 Now choose which annotations you want to add by [add]ing more
tracks to the list ndash ex 1 Find the genes that overlap with your regions group (Genes and
Gene Prediction) track (GENCODE V19) view (Genes)subtrack (Basic) [add]
2 Find the SNPs that overlap with your regions group (Variation)track (Common SNPs) [add]
Choose which fields to include in your outputOutput options -gt Choose fields [Done] -gt [get output]
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Exercise 4 Annotate your VCF with the
Variant Annotation Integrator
1 Go to the Variant Annotation Integratorbull Tools -gt VAI
2 Select Variants bull Variants ldquoVCF Ex 1helliprdquo
3 Now choose which annotations you want to addbull To determine which gene regions your variants fall into select a
gene track (Select Genes = ldquoBasic Gene Annotation SethellipGENCODErdquo)
bull Add regulatory annotations Under ldquoSelect Regulatory Annotationsrdquo click the ldquo+rdquo button to choose which TFs to include (or select none to include all binding sites)
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Bonus Material
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Where to search genomeucsceducgi-binhgGateway
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Where to search genomeucsceducgi-binhgGateway
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Where to search Main Browser genomeucsceducgi-binhgTracks
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Public Hubs
My Data Track Hubs
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Where to search genomeucsceducgi-binhgHubConnect
Track search
Track search
Track search
Track search
Track search
Track search
Track search
Track search
Track search
![COMMUNICATIONS - USFimplemented, predicted consequences of a given variant from different annotation tools may not be in agreement [6]. Therefore, it has been suggested to obtain annotation](https://static.fdocuments.us/doc/165x107/60226535c2279471fe3b72dc/communications-implemented-predicted-consequences-of-a-given-variant-from-different.jpg)
![· Web viewINTEGRATOR AGREEMENT [SYMBOL LOGO] AGREEMENT WITH INTEGRATOR [X] VERTICAL INTEGRATOR [ ] HARDWARE INTEGRATOR [ ] SOLUTIONS INTEGRATOR](https://static.fdocuments.us/doc/165x107/5d1fee6388c9936a7a8c092a/-web-viewintegrator-agreement-symbol-logo-agreement-with-integrator-x-vertical.jpg){kind=logo}
