Proc. Natl. Acad. Sci. USAVol. 90, pp. 3496-3500, April 1993Biochemistry

Visualization of the interaction of a regulatory protein with RNAin vivo

("in vivo" footprinting/RNA-protein interaction/iron-responsive element/transferri receptor)

EDOUARD BERTRAND*, MICHELINE FROMONT-RACINE, RAYMOND PICTET, AND THIERRY GRANGEInstitut Jacques Monod du Centre National de la Recherche Scientifique, Universitd Paris 7, Tour 43, 2 Place Jussieu, 75251 Paris Cedex 05, France

Communicated by Mary Edmonds, January 8, 1993 (receivedfor review October 22, 1992)

ABSTRACT We have adapted to RNA molecules the liga-tion-mediated polymerase chain reaction (LMPCR) procedureof genomic sequencing [Mueller, P. R. & Wold, B. (1989)Science 246, 780-786]. This new procedure, the reverse liga-tion-mediated PCR (RLPCR), is sufficiently sensitive to allow"in vivo" footprinting of minor RNA species. It is based on theligation of an RNA linker of known sequence to every 5' endresulting from the cleavage of total cellular RNA. Target RNAmolecules are specifically reverse-transcribed and the resultingproducts are amplified by PCR. The localization of the initial5' ends is ultimately determined on a sequencing gel. Todemonstrate the validity of this strategy, we have used RNaseTi treatment of permeabilized cells and RLPCR and havedetected in vivo iron-depletion-dependent footprints on twoiron-responsive elements of the transferrin receptor mRNA.

RNA-protein interactions play a critical role in many bio-logical processes (for a review, see ref. 1). Dedicated RNA-binding proteins recognize specific RNA sequences and/orstructures that participate in the regulation of gene expres-sion at levels as diverse as transcription initiation (2), pre-mRNA splicing and polyadenylylation (3), nucleocytoplas-mic transport of mRNA (4), specific mRNA localization inthe cytoplasm (5), mRNA stability (6, 7), and translation (8,9). A well-studied example is the regulation mediated by theiron-responsive element-binding protein (IRE-BP; ref. 10; fora review, see ref. 11). This protein interacts specifically withsequences involved in the iron-dependent regulation of fer-ritin mRNA translation (8, 9) and transferrin receptor (TfR)mRNA stability (6, 7). The affinity of the IRE-BP for theiron-responsive element (IRE) is dependent upon the intra-cellular iron level; it is roughly 200-fold higher in the presenceof an iron chelator than in the presence of an iron source (12).Iron is believed to modulate this affinity through directinteraction with the protein (13). The interaction of theIRE-BP with the IRE has different functional consequencesdepending on the location of the IRE inside the mRNA andthe overall arrangement of the regulatory sequences. In theferritin mRNA, the IRE is localized within the 5' untranslatedregion (UTR) and the interaction of the IRE-BP is believed torepress translation of the mRNA (9). In the TfR mRNA, fiveIREs are localized in the 3' UTR, and the interaction of theIRE-BP is believed to prevent mRNA degradation (6, 14).The so-called "footprinting" method is one of the most

informative techniques to analyze the interaction of proteinswith nucleic acids. It relies on the protein-induced changes ofthe reactivity of nucleic acids toward a modifying agent. Thistechnique has been instrumental in the characterization ofthelarge number of DNA-binding proteins currently known ineukaryotic cells. Further insight into the participation ofthese proteins in the regulation ofgene expression was gained

when it became possible to analyze their interaction withDNA inside the cell by "in vivo" footprinting (15). Thecornerstone of the in vivo footprinting approach, especiallywhen one works with higher eukaryotes, is the ability todetect events involving rare molecules diluted in a complexpopulation. For example, in mammals, a given base in a givenregulatory sequence will represent less than -10-9 of theDNA initially present inside the cell. The most sensitivemethod for the visualization of in vivo footprints is theligation-mediated PCR (LMPCR) procedure of Mueller andWold (16), which allows exponential amplification of thesignal.Our current knowledge of RNA-binding proteins is much

less advanced than that of DNA-binding proteins in partbecause of technical limitations. In particular, no amplifica-tion method suitable for in vivo footprinting of RNA mole-cules is available. Since the average amount ofRNA existingin a mammalian cell corresponds to 5 x 1010 nucleotides (17),the in vivo analysis of the interaction of proteins with RNApresent at most in a few hundred copies per cell requiresmethods with a sensitivity similar to those used for the in vivofootprinting of a single-copy gene. We present a procedurederived from the LMPCR method (16) that allows mapping atsingle-base resolution of cleavage points introduced into aspecific RNA species diluted in a complex RNA population.We illustrate the power of this technique by the detection invivo of iron-depletion-dependent footprints on two IREs ofthe human TfR mRNA.

MATERIALS AND METHODSNuclease Treatment in Vivo and Preparation of RNA. Ex-

ponentially multiplying human hepatoma cells (Hep G2; ref.18) were treated for 20 hr with either desferrioxamine (100,uM) or hemin (100 ,uM). Cells from one 100-mm plate (107cells) were recovered in 10 ml of serum-containing mediumafter trypsinization, rinsed successively with 10 ml of phos-phate-buffered saline and 1 ml of physiological buffer (11 mMKH2PO4/K2HPO4, pH 7.4/108 mM KCl/22 mM NaCl/1 mMMgCl2/1 mM dithiothreitol/1 mM ATP; ref. 19), and sus-pended in 600 ,l of physiological buffer. Cells were perme-abilized and treated with RNase Ti after dilution of 100 ,ul ofthe cell suspension in 100 ,ul of ice-cold physiological buffersupplemented with 0.2% Nonidet P-40 and various amountsof RNase Ti (Boehringer Mannheim). After a 3-min incuba-tion on ice, the nuclei were pelleted by a 15-sec centrifugationat 5500 x g and the supernatant was transferred to a tubecontaining 200 ,ul of 10mM Tris HCl, pH 7.5/150mM NaCl/5mM EDTA/1% SDS and 400 ,ul of phenol/isoamyl alcohol,

Abbreviations: LMPCR, ligation-mediated PCR; RLPCR, reverseligation-mediated PCR; IRE, iron-responsive element; IRE-BP,IRE-binding protein; TfR, transferrin receptor; UTR, untranslatedregion.*Present address: Beckman Research Institute of the City of Hope,1450 East Duarte Road, Duarte, CA 91010-0269.

3496

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 90 (1993) 3497

30:1. The contents of the tube were immediately mixedthoroughly. The aqueous phase was extracted two moretimes with phenol/isoamyl alcohol and then with chloroform,and the RNA was precipitated with ethanol. The RNA wassuspended in 100 ,ul of water and the concentration of thesolution was estimated on a gel by comparison with an RNAsample of known concentration. The RNA was precipitatedagain and suspended at 1 mg/ml in water. Untreated RNAused for chemical sequencing was prepared identically ex-cept that no RNase Ti was added.The reaction conditions for in vivo footprinting must be

optimized to obtain a reliable footprint. The modification ofthe target RNA should be as close as possible to "single-hit"conditions in order to avoid destabilization ofthe RNA-RNAor RNA-protein complexes. However, the extent of thedigestion should be sufficient to provide a good signal-to-noise ratio and a number of modified molecules large enoughto be statistically significant (see discussion related to thispoint in ref. 20). We have observed high background atRNase Ti concentrations that were too low relative toendogenous RNase activity (most reacting bases were notguanines) and disappearance of the footprints at high RNaseconcentrations (data not shown). Therefore, the use of afootprinting reagent with a defined base specificity simplifiesoptimization of the footprinting conditions because the spe-cific and expected pattern is easily discerned from back-ground.

Reverse Ligation-Mediated PCR (RLPCR). Oligodeoxyri-bonucleotides were synthesized by phosphoramidite chem-istry on a Gene Assembler (Pharmacia) and purified byelectrophoresis in a denaturing polyacrylamide gel followedby reverse-phase chromatography on Sep-Pack C18 car-tridges (Waters). The "melting" temperature (Tm) of theoligonucleotide primers was estimated by using the formulaTm (C) = 4(G + C) + 2(A + T) (21). The hybridizationtemperature used during the PCR was equal to the Tm ofeither primer 2 or 3 minus 5°C (21). The nucleotide sequences(5' to 3') of the primers were as follows: DNA linker primer,GGGCAUAGGCUGACCCUCGCUGAAA; Pit-i primer 1,TACCACAGGCAAGTCT; Pit-1 primer 2, TATCTGCACT-CAAGATGCTCCTT; TfR primer 1, CTAAATCTTAGCT-TCAAC; TfR primer 2, AACTTTATTCAATTACATTTG-GCTG; TfR primer 3, ATTCAATTACATTTGGCTGACG-GCTG.

Synthesis of the RNA linker. The RNA linker was synthe-sized by in vitro transcription of a synthetic oligonucleotidetemplate with 17 RNA polymerase (22). The sequences oftheoligonucleotides were 5'-TAATACGACTCACTATAG-3'and 5'-TTTCAGCGAGGGTCAGCCTATGCCCTATAGT-GAGTCGTATTA-3'. The resulting RNA linker was purifiedby electrophoresis in a 10% polyacrylamide sequencing gelfollowed by reverse-phase chromatography.

Phosphorylation ofRNA 5' ends. RNase Ti-treated RNA(7 ,ug) was incubated for 30 min at 37°C with 10 units of T4polynucleotide kinase (Amersham) in 10 /l ofPNK buffer (50mM Tris HCl, pH 7.6/10 mM MgCl2/5 mM dithiothreitol/0.1mM spermine/0.1 mM EDTA) supplemented with 1 mMATP. The samples were then kept at -70°C.RNA linker ligation. One hundred nanograms of RNA

linker was ligated to 700 ng of 5' phosphorylated cellularRNA for 16 hr at 17°C in 10 ,ul of 50 mM Tris HCl, pH 7.5/10mM MgCl2/20 mM dithiothreitol/100 ,uM ATP containing 1,ug ofRNase-free bovine serum albumin (Pharmacia), 20 unitsof human placental ribonuclease inhibitor (Amersham), and3 units of T4 RNA ligase (Pharmacia). The ligated productswere precipitated by the addition of 1l,u of 3 M sodiumacetate (pH 6.0) and 30 Al of ethanol. The pellet was rinsedwith 70% ethanol and resuspended in 12 Al of water.Reverse transcription. Reverse transcription was per-

formed in a buffer suitable for the subsequent PCR (23).

Primer 1 was hybridized with the RNA for 45 min prior toreverse transcription as follows: 6 ,ul of the ligation productwas mixed with 1 ,ul of primer 1 (10 ng/,lI), 1 ,ul of 60 mMMgC92, and 1 ,ul of 10 x Taq buffer (650 mM Tris HCl, pH8.8/100mM 2-mercaptoethanol/165 mM ammonium sulfate).The sample was incubated for 5 min at 95°C and then for 45min at 42°C. One microliter of a mixture of the four dNTPs(5 mM each) and 3 units of avian myeloblastosis virus reversetranscriptase (Stratagene) were subsequently added and theincubation was continued at 42°C for 45 min. The reactionwas stopped by a 5-min incubation at 95°C.PCR amplification. The DNA was then amplified by using

theDNA linker and primer 2 under conditions similar to thosedescribed by Rigaud et al. (24). To the reverse transcriptionreaction mixture were added 1 ,l of 10 x Taq buffer, 1 ,l ofa mixture of the four dNTPs (5 mM each), 2 ,l of DNase-freebovine serum albumin (2 mg/ml; Pharmacia), 2 ,ul of 4 mMMnCl2, 2 ,ul of the DNA linker (500 ng/,ul), 2 ,4 of primer 2(50 ng/,ul), and 1 unit of Taq DNA polymerase (Cetus). After5 min at 95°C, the reaction was cycled 25 times (30 sec at94°C, 3 min at 59°C, 3 min at 74°C).Labeling ofprimer 3 and PCR products. Primer 3 (100 ng,

12 pmol) was labeled at the 5' end by incubation with 50 ,uCi(1.85 MBq) of [y32P]ATP (7 pmol) and 10 units of T4polynucleotide kinase in 20 ,l of PNK buffer for 30 min at37°C. The reaction was stopped by a 5-min incubation at950C.The PCR products were labeled as follows: 5/l of the PCR

mixture was mixed with 0.5 /ul of the primer 3-labelingreaction mixture, 5 ng of unlabeled primer 3, and 0.5 unit ofTaq DNA polymerase in 5 ,ul of 65 mM Tris HCl, pH 8.8/10mM 2-mercaptoethanol/16.5 mM ammonium sulfate/500 ,uMeach dNTP/3 mM MgCl2/400 ,M MnCl2 containing DNase-free bovine serum albumin at 200 ug/ml. After a 5-mindenaturation step at 95°C the reaction was cycled five times(30 sec at 94°C, 3 min at 69°C, 3 min at 740C). Either 2 IL wasloaded directly onto a sequencing gel or the material wasphenol-extracted and then precipitated with ethanol to allowloading of larger quantities.

Direct labeling of PCR products during PCR amplifica-tion. Sometimes the use of 5'-end-labeled primer 2 gavesatisfactory results. In this case the oligonucleotide waslabeled as described above and the PCR amplification wasperformed as described except that 2 ,ul of the labelingreaction mixture and 1 ,l of unlabeled primer 2 (10 ng/4l)were added.

RESULTS AND DISCUSSIONPrinciple of the RLPCR Procedure. The conventional PCR

requires that the sequences at both ends of the region to beamplified are known. The LMPCR procedure (16) allows theexponential amplification of a DNA fragment for which thesequence of only one end is known. Its basic principle is theligation of a linker of known sequence to the unknown end,creating a substrate suitable for PCR. Since the linker has adiscrete length, a complex population of DNA can be am-plified with preservation of single-base resolution. We havekept the basic principle of the LMPCR procedure but mod-ified the order of the steps and the enzymes used in order toadapt the method to RNA molecules (Fig. 1). There are foursteps to the RLPCR procedure: step 1, nonspecific ligation ofan RNA linker to all available 5' phosphorylated ends by T4RNA ligase; step 2, specific synthesis of a cDNA copy of theRNA analyzed by primer extension; step 3, PCR amplifica-tion of the cDNA; and step 4, labeling of the PCR products.Fig. 2 shows that this procedure is specific and sensitiveenough to read the sequence of a minor mRNA (such as onecoding for a transcription factor) after a 1-day exposure(without an intensifying screen) of a sequencing gel when as

Biochemistry: Bertrand et al.

3498 Biochemistry: Bertrand et al.

Total cellular RNA cleaved in vivo or in vitro:5' P 3'

LU C>U G A>G..... 1

5' P,5'P_3.A#,#,.4.%%4A$4A\3

5' P3 3'

STEP 1 RNA linker:5'PPP.*..'"Addition of an RNA linker +to all available 5' P RNA T4 RNA ligaseends

5' PPP.3AV4%%3 'S' PPP. ;;; . _ 3 '

5' PPP.. ;;;.. 3'5' PPP .. ......_3'

STEP 2 DNA primer 1: 3'4-Z5'Synthesis of a cDNA +copy of the RNA analyzed AMV Reverse Transcriptase

5' PPP .3..#. #v _ 3

3'4 55'

5' PPP..\.5' P;..._

:"..:= -1.

-10

20

30

40

10GGUUUUGCAA

20CCGAAGGCAC-

30AGAGAAAAAC

40GGGUGAAAAC

-50 50GAGUCUCAAU

60

60CAAAGUCUGU

70UCUCUAUUJUC

STEP 3 DNA linker primer: 5' 3'PCR amplification +of the cDNA copy DNA primer 2: 3'4 5'

+

Taq DNA polymerase5' ,30

5' 3'

5'

STEP 4Labeling of thePCR products

5'Al........0 .

5' s

3+

Labeled 3 5'DNA primer 3

Taq DNA polymerase.

no

'

3'5'

Sequencing gel

FIG. 1. The RLPCR procedure. RNA molecules are representedas wavy lines and DNA molecules as straight lines. The RNA linker,the homologous DNA linker primer, and its complementary strandare represented by dotted lines. DNA primers 1-3 are represented bythick lines.

little as 25 ng of total RNA is used. We will briefly outlinesome of the points relevant for each step of the procedure.

In contrast to the LMPCR procedure, linker ligation willoccur on all available 5' ends resulting from either in vivo or

in vitro cleavage of the RNA population. Linker ligation isperformed with T4 RNA ligase, which catalyzes ATP-dependent formation of a phosphodiester bond between a

5'-terminal phosphate (donor) and a 3'-terminal hydroxyl(acceptor) (for reviews, see refs. 28 and 29). Therefore, if theinitial RNA population has been cleaved by a treatment thatgenerates 5'-hydroxyl ends, these ends must first be phos-phorylated. In contrast, the RNA linker must bear a 3'-hydroxyl end to serve as acceptor but must bear a 5' end thatrenders it unusable as a donor in order to avoid self-ligationof the linker. This 5' end can either be a 5'-hydroxyl (if theRNA linker is synthesized on an automated synthesizer from

1- 70

FIG. 2. Direct analysis of the nucleotide sequence of the mRNAfor the pituitary-specific transcription factor Pit-1 (25), using totalRNA from a pituitary cell line (GH3; ref. 26). Total RNA was

chemically cleaved (27) specifically at the level of uracils (lane U),pyrimidines (lane C>U), guanines (lane G), or purines (lane A>G).The RLPCR procedure was performed using primer 2 as the labeledprimer. The amount loaded onto each lane corresponded to 25 ng ofRNA. The numbers to the right of the autoradiogram are arbitraryand correspond to the location of the bases on the sequence dis-played. Position + 1 corresponds to position +782 of the cDNAsequence of rat Pit-1 (25). Note that, as for the LMPCR procedure,the bands are indirectly related to the initial cleavage sites: theycorrelate via a constant number of nucleotides, the length of thelinker.

ribonucleoside phosphoramidites; ref. 30) or a 5'-triphos-phate (if it is synthesized by in vitro transcription of a

synthetic oligonucleotide template with T7 RNA polymerase;ref. 22), as neither of the resulting 5' ends can be used as a

donor (ref. 28 and data not shown). The sequence ofthe RNAlinker we have used is 5'-GGGCAUAGGCUGAC-CCUCGCUGAAA-3'. The last three bases are adeninesbecause this is the most efficient acceptor site in the reactioncatalyzed by T4 RNA ligase (31). Since the RNA linker wassynthesized enzymatically, the first three bases are guaninesbecause this appears to be optimal for a high yield of thetranscription product (22). The remaining sequence has beenselected such that the linker has a Tm similar to the one usedin the LMPCR procedure (16). The ligation reaction isperformed using roughly equimolar amounts of RNA linkerand donor sites. Higher amounts of linker appeared to lowerthe efficiency of the subsequent steps (data not shown).The reverse transcription step is the first one that provides

specificity to the RLPCR, and nonspecific priming at thatstep will be deleterious to the quality ofthe final results. Sincethe reverse transcription reaction is performed at 42°C, weselect a primer whose Tm is low enough (%48°C; see Mate-rials and Methods) to render most mismatched hybridsunstable at the reaction temperature. Despite this precaution,nonspecific products are generated if the concentration of

CL

CL

I--U)

C.(I)

z0z

U)

0.

LU

U1)I

J6

Proc. Natl. Acad Sci. USA 90 (1993)

s3'T

*^3'

Proc. Natl. Acad. Sci. USA 90 (1993) 3499

AHEMI DES

-~171 1RNAscTI RNAse

( A>(;

- -:. i

'-mm ~~~~~~~~~~IRE-

16- 4jjRE.i15..__ _... w

i*

.- 3583

BIRE-A IRE-B

mlUR + aCUs_kG14G A C C

A C-5 12- _C-C o A-0A-IJ A-U

3- c-C 1i- c-cU-A 10- c-c

2- C-C C U-AA-U A_U

Cv D-AA_1U-A

U-A AcU

FIG.3.I iofopinigo w Rsofte3 T fT

I U-A 8 9 :-A It

3 445-OUC CC.VUCUUUUAU AUC-

C4UU WUAAU

,5 A-D 20- C-CC-C-17 C-C -22A-'J A-U

16- C-C 21- G-CU A C U

'J U AA

FIG. 3. In vivo footprinting of two IRES of the 3' UTR of TfRmRNA. (A) Human hepatoma cells were treated for 20 hr with eitherhemin (lanes HEM) or desferrioxamine (lanes DES) and subse-quently permeabilized in the presence of various amounts of RNaseTi (from left to right, 50, 100, and 150 units). Lanes G and A>G,base-specific chemical cleavage reactions. The RLPCR procedurewas performed using primer 3 as the labeled primer. The amountloaded onto each lane corresponded to 20 ng of RNA. The numbersto the left of the autoradiogram indicate the location of the guanosineresidues arbitrarily numbered from 1 to 22 (see sequence in B). To theright, numbering is from the 5' end of the human TfR mRNA (32, 33),the bars indicate the extent of the stem-loop structure of the IREspresented in B, the arrows indicate the bands corresponding to thephosphodiester bonds whose reactivity is altered upon change in theiron level, and the stars indicate bands of undetermined origin. Thesebands are dependent upon the presence of human TfR mRNA but donot originate from RNase Ti cleavage in vivo, since they aredetectable in the absence ofenzyme (data not shown). (B) Nucleotide

primer 1 is too high (data not shown): a concentration of 1ng/,ul is optimal for specificity. With this oligonucleotideconcentration, a hybridization step must precede the reversetranscription reaction for optimal efficiency.PCR amplification is performed using an oligodeoxyribo-

nucleotide whose sequence corresponds to that of the RNAlinker (DNA linker primer) and a second oligonucleotide(primer 2) specific for the sequence analyzed. The amplifiedproducts are then visualized by a primer extension with anend-labeled oligonucleotide (primer 3). The relative arrange-ment of primers 1, 2, and 3 as well as their relative Tm valuesis similar to those described for the LMPCR procedure (16,24). The use of a third oligonucleotide (primer 3) for labelingof the PCR products does not appear to be always necessary.In some cases, satisfactory results have been obtained byusing directly labeled primer 2 during the amplification step.The results presented in Fig. 2 were obtained with twospecific primers, whereas those presented in Fig. 3 requireda third primer. We do not know whether these differentrequirements were due to critical differences in the abun-dance of the RNAs analyzed or to undetermined differencesin the properties of the oligonucleotides used or of theirhybridization sites.

Finally, RLPCR, like all PCR strategies, may lead toartifactual homogenization of signal intensities between dif-ferent reactions run in parallel due to the "plateau effect"(34). Thus, conclusions on quantiflcation require adequatecontrols and experimental conditions.

In Vivo Footprinting of RNA-Protein Interactions. Since theRLPCR technique is sensitive and specific enough to localizecleavage points in a minor RNA by using total RNA, it canbe applied to the in vivo footprinting ofRNA. To validate thein vivo footprinting approach, we have analyzed the interac-tion of the IRE-BP with two IREs of the 3' UTR of the TfRmRNA, using RNase Ti as the footprinting agent. Thisenzyme cleaves GpN phosphodiester bonds in single-stranded RNA, leaving the phosphates on the guanosines(ref. 35 and references therein). Thus, RNase Ti footprintingshould provide information not only on RNA-protein inter-actions but also on RNA secondary structure.The analysis was performed on human hepatoma cells

(Hep G2; ref. 18) previously treated with either hemin as aniron source or the iron chelator desferrioxamine. Cells werepermeabilized by using a low amount of the nonionic deter-gent Nonidet P-40 (24) in the presence of various amounts ofRNase Ti. The cytosolic RNAs were extracted 3 min laterand the region corresponding to the two most-5' IREs of the3' UTR of human TfR mRNA was analyzed by the RLPCRprocedure (Fig. 3A). For convenience, the guanosine resi-dues contained in the sequence analyzed have been arbi-trarily numbered from Gi to G22 (see also Fig. 3B). The majordifferences in reactivity that are related to the intracellulariron level involve the phosphodiester bonds 3' to G4 and G13(boxed and indicated by arrows in Fig. 3A), as well as G14.These bonds are much less susceptible to RNase Ti cleavageat a low iron level (lanes DES) than at a high iron level (lanesHEM). G4 and G13 occupy a similar position in each IRE, inthe middle of the loop of the proposed stem-loop structure(Fig. 3B). The corresponding guanosine is conserved in allIREs so far analyzed (6, 36), and its identity is required forhigh-affinity binding of IRE-BP (37). These results stronglysupport the view that these phosphodiester bonds are pro-tected from RNase Ti cleavage at low iron levels by the directinteraction of IRE-BP with the IREs. Furthermore, thisanalysis also indicates that the proposed stem-loop of theIREs exists in vivo, since the bonds participating in the stems

sequence of the region analyzed, showing the secondary structureproposed by Koeller et al. (6).

Biochemistry: Bertrand et al.

3500 Biochemistry: Bertrand et al.

(G2, G3, G10, Gll, G12) are not cleaved by RNase Ti evenat high iron levels.

Careful examination of the autoradiogram shows that thereactivity of the bonds corresponding to G4 and G13 in-creases with increasing RNase concentration. This indicatesthat either the RNase-induced cleavages of the RNA mole-cule destabilize to some extent the interaction ofIRE-BP withthe IRE or that at high concentrations some RNase moleculescan pick up the dissociated state if dynamic association-dissociation occurs during the time of RNase treatment. Atlow amounts of RNase, the bond 3' of G13 in IRE-B is lessreactive than the corresponding bond (3' of G4) in IRE-A,either at low or high iron levels. Interestingly, the affinity ofIRE-BP for IRE-B is higher than for IRE-A (6), suggestingthat IRE-BP is responsible for the observed differences ofsusceptibility toward RNase Ti cleavage. This, in turn,suggests that in vivo there could be some low-affinity inter-actions of IRE-BP at high iron levels with a substantialproportion of the high-affinity IRE-B. Indeed, such a se-quence-specific low-affinity form of IRE-BP exists in vitro athigh iron levels (12).The iron-depletion-dependent interaction of IRE-BP with

the IREs of the TfR mRNA is believed to protect the mRNAagainst a specific nuclease, thereby leading to an increase inthis mRNA (14, 38). However, Fig. 3A shows that the overallintensity of the ladders is not affected by changes in the ironlevel. Indeed, in Hep G2 cells the TfR mRNA level is notmodulated as a function of the iron concentration eventhough an activity with the properties of IRE-BP is present(data not shown). It is likely that the specific degradationpathway of the TfR mRNA is not operating in this cell line.

Conclusion. The RLPCR procedure is a very sensitivemethod that allows the detection of cleavage points of a rareRNA species diluted among unrelated RNAs. It can be usedfor in -vivo footprinting of RNA-protein and RNA-RNAinteractions. In combination with the in vitro methods al-ready available, it should prove very useful in increasing ourunderstanding of the various steps involved in the regulationof gene expression that takes place at the RNA level.

The first two authors contributed equally to this work. We thankL. C. Kuhn, T. A. Rouault, and R. D. Klausner for the generous giftof plasmids; C. Dubucs for oligonucleotide synthesis; J. Deschler,A. L. Haenni, M. Mechali, and M. Tovey for critical reading of themanuscript; and R. Schwartzmann for the photographs. This workwas supported in part by the Centre National de la RechercheScientifique and grants from the Association de Recherche sur leCancer. E.B. was supported by a fellowship from the UniversityParis 6.

1. Frankel, A., Mattaj, I. & Rio, D. (1991) Cell 67, 1041-1046.2. Sharp, P. A. & Marciniak, R. A. (1989) Cell 59, 229-230.3. Hedley, M. L. & Maniatis, T. (1991) Cell 65, 579-586.4. Malim, M. H., Tiley, L. S., McCarn, D. F., Rusche, J. R.,

Hauber, J. & Cullen, B. R. (1990) Cell 60, 675-683.5. Mowry, K. L. & Melton, D. A. (1992) Science 255, 991-994.6. Koeller, D., Casey, J., Hentze, M., Gerhardt, E., Chan, L.,

Klausner, R. & Harford, J. (1989) Proc. Natl. Acad. Sci. USA86, 3574-3578.

7. Mulnner, E. W. & Kuhn, L. C. (1988) Cell 53, 815-825.8. Leibold, E. & Munro, H. (1988) Proc. Natl. Acad. Sci. USA 85,

2171-2175.9. Rouault, T. A., Hentze, M. W., Caughman, S. W., Harford,

J. B. & Klausner, R. D. (1988) Science 241, 1207-1210.10. Rouault, T., Tang, C., Kaptain, S., Burgess, W., Haile, D.,

Samaniego, F., McBride, O., Harford, J. & Klausner, R. (1990)Proc. Natl. Acad. Sci. USA 87, 7958-7%2.

11. Theil, E. (1990) J. Biol. Chem. 265, 4771-4774.12. Haile, D. J., Hentze, M. W., Rouault, T. A., Harford, J. B. &

Klausner, R. D. (1989) Mol. Cell. Biol. 9, 5055-5061.13. Rouault, T., Stout, D., Kaptain, S., Harford, J. & Klausner, R.

(1991) Cell 64, 881-883.14. Muilnner, E. W., Neupert, B. & Kuhn, L. C. (1989) Cell 58,

373-382.15. Cartwright, I. L. & Kelly, S. E. (1991) BioTechniques 11,

188-203.16. Mueller, P. R. & Wold, B. (1989) Science 246, 780-786.17. Brandhorst, B. P. & McConkey, E. H. (1974) J. Mol. Biol. 85,

451-463.18. Knowles, B. B., Howe, C. C. & Aden, D. P. (1980) Science

209, 497-499.19. Jackson, D. A., Yuan, J. & Cook, P. R. (1988) J. Cell Sci. 90,

365-378.20. Mueller, P. R. & Wold, B. (1991) Methods 2, 20-31.21. Meinkoth, J. & Wahl, G. (1984) Anal. Biochem. 138, 267-284.22. Milligan, J. F., Groebe, D. R., Witherell, G. W. & Uhlenbeck,

0. C. (1987) Nucleic Acids Res. 15, 8783-8798.23. Goblet, C., Prost, E. & Wahlen, R. G. (1989) Nucleic Acids

Res. 17, 2144.24. Rigaud, G., Roux, J., Pictet, R. & Grange, T. (1991) Cell 67,

977-986.25. Ingraham, H. A., Chen, R., Mangalam, H. J., Elshltz, H. P.,

Flynn, S. E., Lin, C. R., Simmons, D. M., Swanson, L. &Rosenfeld, M. G. (1988) Cell 55, 519-529.

26. Tashjian, A. H., Yasumura, Y., Levi, L., Sato, G. H. &Parker, M. L. (1968) Endocrinology 82, 342-352.

27. Peattie, D. A. (1979) Proc. Natl. Acad. Sci. USA 76, 1760-1764.

28. Uhlenbeck, 0. C. & Gumport, R. I. (1982) in The Enzymes, ed.Boyer, P. D. (Academic, New York), Vol. 15, pp. 31-58.

29. Romaniuk, P. J. & Uhlenbeck, 0. C. (1983) Methods Enzymol.100, 52-59.

30. Scaringe, S. A., Francklyn, C. & Usman, N. (1990) NucleicAcids Res. 18, 5433-5441.

31. England, T. E. & Uhlenbeck, 0. C. (1978) Biochemistry 17,2069-2076.

32. Schneider, C., Owen, M., Banville, D. & Williams, J. (1984)Nature (London) 311, 675-678.

33. Owen, D. & Kuhn, L. C. (1987) EMBO J. 6, 1287-1293.34. Innis, M. A. & Gelfand, D. H. (1990) in PCR Protocols: A

Guide to Methods and Applications, eds. Innis, M. A., Gel-fand, D. H., Sninsky, J. J. & White, T. W. (Academic, SanDiego), pp. 3-12.

35. Donis-Keller, H., Maxam, A. M. & Gilbert, W. (1977) NucleicAcids Res. 4, 2527-2538.

36. Dandekar, T., Stripecke, R., Gray, N., Goossen, B., Consta-ble, A., Johansson, H. & Hentze, M. (1991) EMBO J. 10,1903-1909.

37. Leibold, A. E., Laudano, A. & Yu, Y. (1990) Nucleic AcidsRes. 18, 1819-1824.

38. Casey, J., Koeller, D., Ramin, V., Klausner, R. & Harford, J.(1989) EMBO J. 8, 3693-3699.

Proc. Natl. Acad. Sci. USA 90 (1993)