Using mouse genetics to understand human disease
description
Transcript of Using mouse genetics to understand human disease
![Page 1: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/1.jpg)
Using mouse genetics to understand human disease
Mark Daly
Whitehead/PfizerComputational BiologyFellow
![Page 2: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/2.jpg)
What we do
• Genetics: the study of the inheritance of biological phenotype– Mendel recognized discrete units of inheritance– Theories rediscovered and disputed ca. 1900– Experiments on mouse coat color proved
Mendel correct and generalizable to mammals– We now recognize this inheritance as being
carried by variation in DNA
![Page 3: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/3.jpg)
Why mice?
• Mammals, much better biological model
• Easy to breed, feed, and house
• Can acclimatize to human touch
• Most important: we can experiment in many ways not possible in humans
What do theywant with me?
![Page 4: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/4.jpg)
Mice are close to humans
![Page 5: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/5.jpg)
Kerstin Lindblad-TohWhitehead/MIT Center for Genome Research
![Page 6: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/6.jpg)
Mouse sequence reveals great similarity with the human genome
Extremely high conservation: 560,000 “anchors”
Mouse-Human Comparisonboth genomes 2.5-3 billion bp long> 99% of genes have homologs> 95% of genome “syntenic”
![Page 7: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/7.jpg)
Genomes are rearranged copiesof each other
Roughly 50% of bases change in the evolutionary time from mouse to human
![Page 8: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/8.jpg)
Mouse sequence reveals great similarity with the human genome
Extremely high conservation: 560,000 “anchors”
Anchors (hundreds of bases with >90% identity)represent areas of evolutionary selection…
…but only 30-40% of the highly conservedsegments correspond to exons of genes!!!
![Page 9: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/9.jpg)
What we can do• Directed matings• Inbred lines and crosses
• Knockouts• Transgenics• Mutagenesis• Nuclear transfer
• Control exposure to pathogens, drugs, diet, etc.
YIKES!!!
![Page 10: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/10.jpg)
Example: diabetes related miceavailable from The Jackson Labs
• Type I diabetes (3)• Type II diabetes (3)• Hyperglycemic (27)• Hyperinsulinemic (25)• Hypoglycemic (1)• Hypoinsulinemic (5)• Insulin resistant (30)
• Impaired insulin processing (7)
• Impaired wound healing (13)
![Page 11: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/11.jpg)
Inbreeding
• Repeated brother-sister mating leads to completely homozygous genome – no variation!
![Page 12: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/12.jpg)
Experimental Crosses
• Breed two distinct inbred lines• Offspring (F1) are all identical – they each
have one copy of each chromosome from each parent
• Further crosses involving F1 lead to mice with unique combinations of the two original strains
![Page 13: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/13.jpg)
Experimental Cross
![Page 14: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/14.jpg)
Experimental Cross: backcross
• F1 bred back to one of the parents
• Backcross offspring:50% red-red50% red-blue
![Page 15: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/15.jpg)
Experimental Cross: F2 intercross
• One F1 bred to another F1
• F2 intercross offspring:25% red-red50% red-blue25% blue-blue
F2
![Page 16: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/16.jpg)
Trait mapping
100 200 300
F2
![Page 17: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/17.jpg)
Trait mapping
Blue trees = tall, Red trees = short
In the F2 generation, short trees tend to carry “red” chromosomes where theheight genes are located, taller trees tend to carry “blue” chromosomes
QTL mapping use statistical methods to find these regions
![Page 18: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/18.jpg)
How do we distinguish chromosomes from different strains?
• Polymorphic DNA markers such as Single Nucleotide Polymorphisms (SNPs) can be used to distinguish the parental origin of offspring chromosomes
ATTCGACGTATTGGCACTTACAGGATTCGATGTATTGGCACTTACAGG
SNP
![Page 19: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/19.jpg)
Example: susceptibility to Tb
• C3H mice extremely susceptible to Tb
• B6 mice resistant
• F1, F2 show intermediate levels of susceptibility
B6
C3H
0 100 200 3000
50
100
Days post infection
% su
rviv
al
![Page 20: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/20.jpg)
One gene location already known
• Previous work identified chromosome 1 as carrying a major susceptibility factor
• Congenic C3H animals carrying a B6 chromosome 1 segment were bred
0 50 100 150 2000
50
100
Survival Time
% s
urvi
val
C3H
B6
C3H.B6-sst1
![Page 21: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/21.jpg)
Congenic and consomic mice
• Derived strains of mice in which the homozygous genome of one mouse strain has a chromosome or part of a chromosome substituted from another strain
Chr 1
Chr 2
Chr 3
Chr 4
Etc.
C3H B6 C3H.B6_chr1
![Page 22: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/22.jpg)
Tb mapping crossF2 intercross:
C3H.B6-sst1 - MTB-susceptible, carrying B6 chr 1 resistance
B6 - MTB-resistant
Trait – survival following MTB infection
B6
F1
x
x
n = 368F2…
C3H.B6-sst1
![Page 23: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/23.jpg)
Results: 3 new gene locations identified!
![Page 24: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/24.jpg)
Gene identified on chromosome 12
0 100 200 300
0
50
100
bb
bh
hh
Chi square
df
P value
18.99
2
P<0.0001
days post infection
% s
urvi
val
0 25 50 75 100 125 150
0
50
100
C57Bl/6J
B6-Igh6
B6-IL12-/-
Chi square
df
P value
30.02
2
P<0.0001
Days after infection
% s
urvi
val
0 25 50 75 100 125 150
0
50
100
BALB/cBJ
BALB/c-mMT-/-
Days after infection
% s
urvi
val
Chi square
df
P value
20.17
1
P<0.0001 A. B. C.
At the end of chr 12 – miceinheriting two C3H copies survive significantly longerthan those with one or twoB6 copies
Mice engineered to bemissing a critical component of the immune system located in this region arelikewise more susceptible,validating that particulargene as involved in Tbsusceptibility
![Page 25: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/25.jpg)
![Page 26: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/26.jpg)
![Page 27: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/27.jpg)
Mouse History
• Modern “house mice” emerged from Asia into the fertile crescent as agriculture was born
![Page 28: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/28.jpg)
Mouse history
![Page 29: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/29.jpg)
Recent mouse history
W.E. Castle C.C. Little
Fancy mouse breeding - Asia, Europe(last few centuries)
Retired schoolteacher Abbie Lathropcollects and breeds these mice
Granby, MA – 1900
Castle, Little and others form most commonly usedinbred strains
from Lathrop stock(1908 on)
![Page 30: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/30.jpg)
Mouse history
![Page 31: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/31.jpg)
Mouse history
• Asian musculus and European domesticus mice dominate the world but have evolved separately over ~ 1 Million years
• Mixing in Abbie Lathrop’s schoolhouse created all our commonly used mice from these two distinct founder groups
![Page 32: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/32.jpg)
![Page 33: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/33.jpg)
Genetic Background of the inbred lab mice
musc musc
musc
musc
domest
domestdomest
domestdomest
C57BL/6
C3H
DBA
Avg segment size ~ 2 Mb{cast
![Page 34: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/34.jpg)
Comparing two inbred strains – frequency of differences in 50 kb segments
{
<1 SNP/10 kb
{~40 SNP/10 kb
![Page 35: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/35.jpg)
Finding the genes responsible for biomedical phenotypes
C3H (susceptible)
B6 (resistant)
20 Mb
Traditionally: positional cloning is painful(e.g., generating thousands of mice for fine mapping, breeding congenics) –
As a result, countless significant QTLs have been identified in mappingcrosses but only a small handful have thusfar resulted in identificationof which gene is responsible – the critical information that will advanceresearch into prevention and treatment!
![Page 36: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/36.jpg)
Using DNA patterns to find genes
C3H (susc.)
B6 (res.)
Critical Region
20 Mb
![Page 37: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/37.jpg)
Using DNA patterns to find genes
C3H (susc.)
B6 (res.)
DBA (susc.)
Critical Region
20 Mb
![Page 38: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/38.jpg)
Example: mapping of albinism
Critical region
![Page 39: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/39.jpg)
First genomic region mapped129S1 T A * C C C * C G G T A C G A G G GAKR A G T T T A A T G G T A C G A G G GA_J A G T T T A A T G G T A C G A G G GBALB_c T A * C C C G C G G T A C G A G G GC3H A G T T T A A T G G T A C G A G G GC57B6 A G T T T A A T C T A G T A C C C ACBA A G T T T A A T C T A G T A C C C ADBA2 A G T T T A A T C T A G T A C C C AFVB A G T T T A A T C T A G T A C C C AI A G T T T A A T G G T A C G A G G GNOD A G T T T A A T G G T A C G A G G GNZB * A C C C C * C C T * G T A C C C ASJL A G T T T A A T C T A G T A C C C ASWR A G T T T A A T C T A G T A C C C A
Chr 4 35.7 37.6 37.9 39.4 (Mb)
![Page 40: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/40.jpg)
Future Genetic Studies
Pathways Expression
Mapping
Model Systems
![Page 41: Using mouse genetics to understand human disease](https://reader036.fdocuments.us/reader036/viewer/2022070502/56814d70550346895dbac1aa/html5/thumbnails/41.jpg)
Thanks to(Whitehead Institute)Claire WadeAndrew Kirby
(MIT Genome Center)EJ KulbokasMike ZodyEric LanderKerstin Lindblad-Toh
Funding:Whitehead InstitutePfizer, Inc.National Human Genome Research Institute