uS4 eS31,anduL14Ribosomal Protein Genes Are Dysregulated...

Research ArticleThe uS8 uS4 eS31 and uL14 Ribosomal Protein Genes AreDysregulated in Nasopharyngeal Carcinoma Cell Lines

Edmund Ui-Hang Sim1 Kher-Lee Ng1 Choon-Weng Lee2 and Kumaran Narayanan34

1Department of Molecular Biology Faculty of Resource Science and Technology Universiti Malaysia Sarawak94300 Kota Samarahan Sarawak Malaysia2Institute of Biological Sciences University of Malaya 50603 Kuala Lumpur Malaysia3School of Science Monash University Bandar Sunway 46150 Selangor Malaysia4Department of Genetics and Genomics Sciences Mount Sinai School of Medicine New York NY 10029 USA

Correspondence should be addressed to Edmund Ui-Hang Sim uhsimunimasmy

Received 4 May 2017 Accepted 14 June 2017 Published 16 July 2017

Academic Editor Clara Crescioli

Copyright copy 2017 Edmund Ui-Hang Sim et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The association of ribosomal proteins with carcinogenesis of nasopharyngeal carcinoma (NPC) has been established in a limitedsubset of ribosomal protein genes To date three ribosomal protein genes eL27 (L27) eL41 (L41) and eL43 (L37a) have been foundto be differentially expressed in cell lines derived from NPC tumors This raises the possibility of more ribosomal protein genesthat could be associated with NPC In this study we investigated the expression profiles of eight ribosomal protein genes uS8 (S8)uS4 (S9) eS31 (S27a) eL6 (L6) eL18 (L18) uL14 (L23) eL24 (L24) and eL30 (L30) in six NPC-derived cell lines (HONE-1 SUNE1HK1 TW01 TW04 and C666-1) Their expression levels were compared with that of a nonmalignant nasopharyngeal epithelialcell line (NP69) using quantitative real-time PCR (RT-qPCR) assay Of the eight genes studied the expressions of four ribosomalprotein genes uS8 (S8) uS4 (S9) eS31 (S27a) and uL14 (L23)were found to be significantly downregulated in NPC cell lines relativeto NP69 Our findings provide novel empirical evidence of these four ribosomal protein genes as NPC-associated genetic factorsand reinforce the relevance of ribosomal proteins in the carcinogenesis of nasopharyngeal cancer

1 Introduction

Nasopharyngeal carcinoma (NPC) is a distinct malignantform of head and neck cancer that originates from the lateralor posterosuperior mucosal epithelium of the pharynx TheWorld Health Organization (WHO) classifies NPC as threemajor histopathologic types Type I keratinizing squamouscell carcinoma Type IIa nonkeratinizing differentiated cellcarcinoma and Type IIb nonkeratinizing undifferentiatedcarcinoma Type IIb is the most common and contributes to60 and 95 of NPC cases in North America and SouthernChina respectively and is associated with Epstein-Barr virus(EBV) infection [1] Global incidence shows a pattern associ-atedwith geographical location where the highest prevalenceis among the Chinese population in Southeast Asia andSouthernChina [2] Although the involvement of genetic fac-tors in NPC carcinogenesis is widely known themechanisms

of their influence andor action in the disease are not fullyunderstood This could be largely due to the fact that the fullrange of NPC-associated genes is still unclear Among someof these are the ribosomal protein (RP) genes

The products of RP genes canonically function as majorcomponents of ribosomes during protein biosynthesis How-ever in 1996 Wool [3] listed more than 30 potential extrari-bosomal functions of RPs that include apoptosis DNA repairRNA processing and transcription regulation Sequencemutation and differential expression of several ribosomalprotein genes have been reported in many human congenitaldisorders and carcinomas For instance more than 200distinct mutations in nine RP genes namely eS19 (S19) eS24(S24) eS17 (S17) eS7 (S7) eS10 (S10) eS26 (S26) uL18 (L5)uL5 (L11) and eL33 (L35a) were identified in a majorityof Diamond-Blackfan Anemia (DBA) cases [4ndash10] Geneticlesions in eL22 (L22) that include heterozygous deletion and

HindawiBioMed Research InternationalVolume 2017 Article ID 4876954 8 pageshttpsdoiorg10115520174876954

2 BioMed Research International

nucleotide mutation have been found in T-cell acute lym-phoblastic leukemia and colorectal cancer respectively [1112] Besides structural aberrancies alteration in the expres-sion pattern of RP genes has been found inmany types of can-cer These include the dysregulated expressions of uS3 (S3)eS19 and eS31 in colorectal cancer [13ndash15] eL8 (L7a) eL19(L19) eS27 (S27) and eL37 (L37) in prostate cancer [16ndash19]eS27 in cells of breast tumor and gastric carcinoma and eL5and eL14 in ovarian cancer [20ndash22] Since 2014 a new namingsystem for RP genes has been introduced to unambiguouslyidentify each RP gene across broad taxonomic range [23]We adhere to this new system in this paper but have alsoincluded the old names (in parentheses) at firstmention of thegenes

Association of RP genes with NPC was initially reportedfor eS26 and eS27These twoRP genes were downregulated intumors of NPC relative to normal controls [24] Three othergenes (eL27 eL41 and eL43) were later proven to be NPC-associated RP factors in cell lines derived from NPC tissues[25 26] However the hypothesis of eS26 and eS27 as NPC-associated RP genes was subsequently refuted [27] AnotherRP gene eL32 (L32) was also found to be not involved withNPC tumorigenesis [27] This means that only a limitedsubset of RP genes are associated with NPCThe complete listof genes that belong to this subset is yet to be resolved Herewe provide evidence of four more RP genes that are relevantto the context of NPC tumorigenesis They are identified onthe basis of significant differential expression pattern betweenNPC and nonmalignant nasopharyngeal epithelial cell lines

2 Materials and Methods

21 Cell Lines and Cell Culture Six NPC-derived cell lines(HONE-1 [28] SUNE-1 [29] HK1 [30] TW01 [31] TW04[31] and C666-1 [32]) and an immortalized nonmalignantnasopharyngeal epithelial cell line (NP69 [33]) were used inthis study Many of these were originally sourced from theUniversity of Hong Kong (laboratory of Professor George SW Tsao) with permission for use granted by the providerThe NPC cell lines were cultured in RPMI-1640 (Gibco LifeTechnologies USA) containing 10 (vv) fetal bovine serum2mM L-glutamine and 100UmL penicillin-streptomycin(Gibco USA) The EBV-positive cell line C666-1 was cul-tured on fibronectin-coated (Sigma USA) cell culture flaskcontaining prewarmed (37∘C) RPMI-1640 medium TheNP69 cells were cultured in defined keratinocyte-serum-freemedium (Invitrogen USA) supplemented with 02 ngmLgrowth factors 5 heat-inactivated FBS and 100UmLpenicillin-streptomycin All cells were maintained at 37∘C ina humidified environment containing 5 CO2 Cells wereharvested at a growth confluency of 70ndash80

22 Total RNAExtraction andQuantitative Reverse Transcrip-tion-PCR (qRT-PCR) Total cellular RNAwas extracted fromthe cell cultures using TRizol Reagent (Invitrogen USA)according to the manufacturerrsquos protocol The extractedRNAs were DNase-treated with RQ1 RNase-Free DNase(Promega USA) First strand cDNA was prepared using

Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLVRT Promega USA) Real-time PCR (or qPCR)was per-formed using Rotor-Gene SYBR Green PCR Kit (QiagenUSA) and QuantiNova SYBR Green PCR Kit (Qiagen USA)on a Rotor-Gene 6000 Rotary Analyzer (Qiagen USA) andanalyzed using Rotor-Gene 6000 software Version 233 (Qia-gen USA) For each assay a total of 8 ng cDNA was added toa final reaction volume of 25 120583L containing 1x Rotor-GeneSYBR Green PCR master mix or QuantiNova SYBR GreenPCR master mix and 1 120583M of each forward and reverseprimer Table 1 lists the details of the PCR primers used forthis study Quantitative gene amplifications were performedusing the following thermocycling conditions initial denatu-ration for 5minutes at 95∘C 40 cycles of denaturation at 95∘Cfor 5 seconds and annealing and extension at 60∘C for 20 sec-onds Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)genes was used as endogenous control (or reference gene)Nontemplate reactionwas used as negative control Biologicaltriplicate tests were done for all analysis

The selection of the threshold intensity was set at a fixedintensity on the log-linear phase of the amplification curvefor all the samples tested Validation experiments whichincluded the generation of standard curves using a series ofdiluted cDNA samples were carried out to ensure primerefficiency as well as target and reference gene amplificationcompatibility Melt curve analysis and conventional agarosegel analysis were adopted alongside to verify the presenceof a single amplicon An interassay calibration scheme wasadopted to minimize loading variation and to detect possiblecontamination with the inclusion of duplicate reactions andldquono-templaterdquo control (NTC) respectively in each qPCRassay All samples were normalized toGAPDH as the endoge-nous control Relative fold differences were calculated by theΔΔCT method [34]

23 Validation of PCR Efficiency Primer efficiency was val-idated by generating a duplicate fivefold serial dilution overfive-log magnitude A calibration curve for each gene wasplotted with average quantification cycle (119862119902) values againstlog input amount (4 08 016 0032 and 00064 ng120583l) PCRamplification efficiency was determined from the slope of thelog-linear portion of the calibration curve as follows

Amplification efficiency = [10minus1slope] minus 1 (1)

Valid ΔΔCT calculation requires the PCR amplification effi-ciencies of the target and reference genes to be acceptablycomparable This was determined by evaluating the relativeefficiencies of the target and reference amplification fromthe individually generated standard curves using the sampleand log dilution The Δ119862119902 values (CT target minus CT reference)were plotted against log input amount of five-template DNAdilution (4 08 016 0032 and 00064 ng120583l) The slope ofthe resulting semi-log regression line (slope ofΔ119862119902 versus logof input amount) was used to determine the compatibility ofthe two PCR efficiencies with the slope value (119898) less than 01taken as ideal In this study primer efficiency of the respectivegenes in an NPC cell line (HK1) was validated against thereference gene GAPDH Quality assessment tests indicated

BioMed Research International 3

Table 1 Target genes and the corresponding primer sequences product size and correlation coefficient of efficiency curve F and R representthe forward and reverse primer respectively

Gene name GenBank accession number Primer sequence (51015840-31015840) Expected product size (bp)

GAPDH NM 0020465 F CTGGGCTACACTGAGCACC 101R AAGTGGTCGTTGAGGGCAATG

uS8 NM 0010121 F GCTCAGAGTGTTGTACTCG 106R AGCACGATGCAATTCTTCAC

uS9 NM 0010133 F CTGAAGTTGATCGGCGAGTATG 280R ACTTGGCCAAGCCCAGCTTG

eS31 NM 0029545 F GCAGCTGGAAGATGGACGTAC 85R ACCACCACGAAGTCTCAAC

eL6 NM 0010246621 F GCACGTGAGAACACTGCGAG 139R GAGGACCCGAGCTCCAGTCAC

eL18 NM 0009793 F CTCTGTCCCTTTCCCGGATG 320R GTAGGGTTTGGTGTGGCTG

uL14 NM 0009783 F TCCAGCAGTGGTCATTCGAC 117R GCAGAACCTTTCATCTCGCC

eL24 NM 0009863 F CGAGCTGTGCAGTATTAGCG 117R GAAAGGAAAGCCGACTCGC

eL30 NM 0009893 F ATCTTAGTGGCTGCTGTTGG 280R TGCCACTGTACTGATGGACAC

that the efficiency curve for each of the primer sets relativeto GAPDH was Correlation Coefficient (1198772) greater than orequal to 097 and PCR efficiency (or amplification compati-bility) of at least 90 (within the ideal amplification range of90ndash110) Correspondingly the validation plot ofΔCT versuslog input amount of RNA shows 119898 values within the rangeof minus36 and minus31 thus ascertaining the validity of our qPCRexperiments

24 Statistical Analysis Amean fold difference value of morethan 10 was considered to be an overexpression while a folddifference value of less than 10 was taken as an underex-pression The difference of means (target genes expressionin NP69 and NPC cell lines) was statistically evaluatedusing unpaired Studentrsquos 119905-test and statistical significancewas taken at 119901 lt 005

3 Results

31 Relative Expression Level of RP Genes in Each NPC CellLine versus Normal Control Fold difference of the 8 RP genesin each of the 6NPC cell lines (HONE-1 SUNE-1 HK1TW01 TW04 and C666-1) relative to the normal control(NP69) is shown in Table 2 Differential expression patterncan be as small as 003-fold (uS4 TW01 versus NP69) to aslarge as 13192-fold (eL18 SUNE-1 versus NP69) uS8 uS4and uL14 are observed to be consistently underexpressed inall six NPC cell lines when compared to NP69 with thelowest expression observed in the SUNE-1 (007-fold) TW01(003-fold) and SUNE-1 (017-fold) cell line respectivelyConsistent upregulation in expressions of eL18 and eL30 isobserved in all six NPC cell lines relative to that of NP69with the highest fold difference in SUNE-1 (13392-fold) for

eL18 and C666-1 (2757-fold) for eL30 An interesting trendis observed in the expression levels of eS31 and eL6 in whichtheir general expression trend inNPC cell lines is inconsistentin HONE-1 For instance expression of eS31 in NPC celllines maintains an upregulated pattern except in HONE-1 Areversed scenario is evident for eL6 where a downregulationtrend is observed for all NPC cell lines except in HONE-1Among the 8 RP genes tested underexpression is statisticallysignificant (119901 lt 005) in all NPC cell lines relative to normalcontrol for uS8 uS4 and uL14 In the case of eS31 significantdownregulation is observed in all NPC cell lines except forHONE-1 Its upregulated pattern in HONE-1 is not statisti-cally significant

32 Expression Level of Each RP Gene Collectively in NPC CellLines Compared to NP69 To examine the overall differentialexpression pattern of eachRP gene inNPC themean fold dif-ference of each gene in the sixNPCcell lineswas averaged andcompared to that of the normal (nonmalignant) nasopha-ryngeal epithelial cell line NP69 (Table 3 Figure 1) Under-expression pattern is observed for eS8 uS4 eS31 uL14 anduL24 with uS4 displaying the highest underexpression level(minus54506-fold) However only the downregulation pattern ofuL24 is not statistically significant (119901 = 0054) Overexpres-sion trend is observed for eL6 eL18 and eL30The expressionof eL18 recorded the highest upregulation of 2564-foldNonetheless these overexpression patterns are not statisti-cally significant All in all significant differential expressioncan only be concluded for eS8 (119901 = 0000166) uS4 (119901 =0023) eS31 (119901 = 000025) and uL14 (119901 = 247eminus05) Thesegenes show an underexpression pattern in NPC cell linescompared to normal cell line


Table 2 Fold difference of the studied RP genes in NPC cell lines relative to normal control Data in this table includes normalized meanfold difference (2minusΔΔ119862119902 ) of respective genes in six NPC cell lines relative to normal nasopharyngeal epithelial cell line NP69

Gene Cell line Fold difference (2minusΔΔ119862119902 ) Std deviation (SD) 119901 value

eS8

NP69 1012746 0011882HONE-1 0380311 0273122 0008019SUNE-1 0071494 0009687 234119890minus08

HK1 0251844 0163468 0000649TWO1 0402658 044444 0038129TWO4 0253709 0282225 0004816C666-1 0196327 0085366 404E-05

uS4

NP69 121591 0314452HONE-1 0164457 0137157 0003026SUNE-1 0203615 0345601 0009952HK1 0149012 0225628 0004405TWO1 0032517 0028321 0001452TWO4 0416219 029763 0016465C666-1 0216689 022373 0005476

eS31


HK1 0560767 0239252 0015339TWO1 0415694 0235145 0005853TWO4 0246348 0160656 0000588C666-1 0322675 0329258 0011062

eL6


eL18


uL14


eL24



Table 2 Continued


eL30


Table 3 Relative expression of each RP gene in NPC cell lines compared to NP69 lowastFold difference values lt 10were converted to linear-scalewith the formula linear FD = (minus1FD)

Gene Cell line Mean linear FDlowast 119901 value Expression pattern

eS8 NP69 1012746 0000166 Significant underexpressionNPC minus932115

uS4 NP69 121591 0023017 Significant underexpressionNPC minus545064


eL6 NP69 1080437 0691146 OverexpressionNPC 2133808


uL14 NP69 1123026 247119890minus05 Significant underexpressionNPC minus743259

eL24 NP69 1058277 0053756 UnderexpressionNPC minus374191


4 Discussion

In summary our studies reveal the significant downregula-tion of three 40S RP genes (eS8 uS4 and eS31) and a 60S RPgene (uL14) inNPC cell lines Our findings reinforce previousreports [25 26] on the occurrence of dysregulated expressionamong a subset of ribosomal protein genes in NPC Thedifferential expression pattern of eS8 uS4 eS31 and uL14 isrevealed for the first time in theNPC context and hence addsto the list of possible NPC-associated RP factors

To date differential expression of eS8 gene and its proteinhas been found in colorectal tumorspolyps [13] and colorec-tal carcinoma [35] respectively However its expression isconstitutive and ubiquitous among normal and neoplasticthyroid tissues and cell lines [36ndash38] This inconsistency ofeS8rsquos expression characteristics across different types of can-cer suggests its distinctive association with the type of malig-nant tissuecell More studies will be required to substantiatethis Molecularly eS8 protein interacts with Cyclin Depen-dent Kinase 11B (CDK11B) a key mediator of Fas ligand-induced apoptosis [39] It remains to be investigated whetherdownregulation of eS8 affects a disrupted eS8-CDK11B inter-action and thus is associated with dysregulated cellularapoptotic pathway in NPC cells

Differential expression of uS4 in colorectal cancer [40] isnot consistently observed for human lung squamous cell oralsquamous cell and liver cancer [41ndash43] Similar to eS8 theassociation of uS4 with cancers is likely to be type-specificSilencing of uS4 in glioma cells affects morphological differ-entiation without causing senescence [44] In human embry-onal carcinoma NTERA2 cells uS4 is consistently underex-pressed during retinoic acid induced neuronal differentiation[45] It seems that there is relationship between the downreg-ulation of uS4 and cellular differentiation Our findings herecorroborate with this notion The level (number of folddifferences) of uS4 underexpression in TW04 andC666-1 celllines is the lowest followed by HONE-1 and SUNE-1 and thehighest in HK1 and TWO1 (Table 2) TWO4 and C666-1 areundifferentiated cell lines while HONE-1 and SUNE-1 arefrom poorly differentiated squamous cell carcinoma andHK1 and TW01 are from differentiated squamous carcinomaThe connection between uS4 expression and the degree ofcellular differentiation warrants more research in order to befully understood At this stage it implies that this RP canbe a possible differentiation marker amenable for accuratehistopathological analysis of NPC cellstissues

The eS31 is an ubiquitin C-terminal extension protein thatis overexpressed in colorectal [15] breast [46] and renal [47]


lowast lowastlowastlowast lowastlowastlowastlowastlowastlowast

eS8 uS4 eS31 eL6 eL18 uL14 eL24 eL30

NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge

Figure 1 Relative fold difference of each RP gene in NPC celllines versus normal control The 119910- and 119909-axis represent averagefold difference and ribosomal protein gene types respectively Datafor each of the seven RP genes studied from in all the NPCcell lines studied were pooled and compared with data from thenonmalignant nasopharyngeal epithelial cell line NP69 The 119901values of lt005 were considered to be statistically significant andmarkedusing asterisk symbols (lowast119901 lt 005 lowastlowast119901 lt 001 lowastlowastlowast119901 lt 0001and lowastlowastlowastlowast119901 lt 000001) Error bars represent the upper and lowerlimits of the cumulative fold difference

cancers and leukemia [48] It is however ubiquitous ingastric and ovarian cancers [49] and downregulated in hepa-tocellular carcinoma (HCC) tissues [50] During ribosomalstress eS31 is overexpressed and the translated productmediates activation and stabilization of p53 by binding withMDM2 protein to inhibit MDM2-mediated p53 ubiquitina-tion [51 52] Correspondingly knockdown of eS31 mitigatesp53 activation in response to ribosomal stress [52] Thisimplies a positive correlation between expressions of eS31 andp53 However studies have shown that p53 is overexpressedand largely unmutated in NPC tissues and cells [53ndash55] Ourfindings of eS31rsquos underexpression in NPC cells also appearunrelated to the trend of p53rsquos expression pattern in this typeof cancer This confusion is difficult to understand withoutdeeper studies into the relationship between eS31 and p53during malignant condition of NPC cells Nevertheless itdoes suggest the notion that eS31 possibly fails to regulate p53in the cancer situation

The expression of uL14 is upregulated in squamous cellcarcinoma of the head and neck [56] On the other hand it isunderexpressed in ovarian cancer [22] andhumanpapilloma-virus-16 E6 D25E-expressing cell lines [57] Increase in uL14protein inhibits HDM2-induced p53 ubiquitination [58] andwould contribute to activation and increase of p53 The

knockdown of uL14 affects actinomycin D-induced p53 acti-vation [59] These facts imply a positive correlation betweenuL14 and p53 levels However in a study by Fumagalli et al[60] the perturbation of either 40S or 60S ribosomal bio-genesis which included the depletion of uL14 coincides withthe induction of p53 in A549 human lung carcinoma andU2OS human osteosarcoma cell lines This is consistent withour findings and reinforces the notion of negative correlationbetween uL14 expression and p53 levels in some cancer typesin our case NPC The molecular explanation to this wouldrequire further research

Besides the cancer-type specificity of expression level ofthe 4 newly identified NPC-associated RP genes this studyhas also revealed another 4 RP genes (eL6 eL18 eL24 andeL30) that are not relevant to the context of NPC tumorigen-esis This underpins our suspicion of the limited selection ofRP genes that are linked to the NPC disease The network oftheir activities in the carcinogenesis of the nasopharynx willbe a potent area for future studies

5 Conclusion

The ribosomal protein genes of eS8 uS4 eS31 and uL14 aresignificantly underexpressed inNPC cell lines relative to non-malignant nasopharyngeal epithelial cellsThese genes repre-sent the latest addition to the limited list of RP genes that haveassociation with cancer of the nasopharynx

Conflicts of Interest

The authors declare that there are no conflicts of interestregarding the publication of this paper

Authorsrsquo Contributions

Edmund Ui-Hang Sim designed and supervised the studyinterpreted the data and wrote the manuscript Kher-LeeNg performed the experiments analyzed the data and wrotethe manuscript Choon-Weng Lee and Kumaran Narayananaided in the interpretation of experimental data and thestatistical analysis and cowrote the manuscript

Acknowledgments

This work is supported by the Ministry of Higher EducationMalaysia via the Fundamental Research Grant Scheme[FRGSST03(02)12992015(16) and FRGSST03(01)9622013(03)] and the Universiti Malaysia Sarawak via the PhDStudent Fund [F07(DPP08)11602014(08)]

References

[1] M Al-Sarraf M LeBlanc P G S Giri et al ldquoChemoradiother-apy versus radiotherapy in patients with advanced nasopha-ryngeal cancer phase III randomized Intergroup study 0099rdquoJournal of Clinical Oncology vol 16 no 4 pp 1310ndash1317 1998

[2] S-M Cao M J Simons and C-N Qian ldquoThe prevalence andprevention of nasopharyngeal carcinoma in Chinardquo ChineseJournal of Cancer vol 30 no 2 pp 114ndash119 2011


[3] I G Wool ldquoExtraribosomal functions of ribosomal proteinsrdquoTrends in Biochemical Sciences vol 21 no 5 pp 164-165 1996

[4] N Draptchinskaia P Gustavsson B Andersson et al ldquoThegene encoding ribosomal protein S19 is mutated in Diamond-Blackfan anaemiardquo Nature Genetics vol 21 no 2 pp 169ndash1751999

[5] R Cmejla J Cmejlova H Handrkova J Petrak and D Pospis-ilova ldquoRibosomal protein S17 gene (RPS17) is mutated in Dia-mond-Blackfan anemiardquo Human Mutation vol 28 no 12 pp1178ndash1182 2007

[6] L Doherty M R Sheen A Vlachos et al ldquoRibosomal proteingenes RPS10 and RPS26 are commonly mutated in diamond-blackfan anemiardquoAmerican Journal of Human Genetics vol 86no 2 pp 222ndash228 2010

[7] J E Farrar M Nater E Caywood et al ldquoAbnormalities of thelarge ribosomal subunit protein rpl35a in diamond-blaekfananemiardquo Blood vol 112 no 5 pp 1582ndash1592 2008

[8] H T Gazda A Grabowska L B Merida-Long et al ldquoRiboso-mal protein S24 gene is mutated in Diamond-Blackfan anemiardquoAmerican Journal of Human Genetics vol 79 no 6 pp 1110ndash1118 2006

[9] R Cmejla J Cmejlova H Handrkova et al ldquoIdentification ofmutations in the ribosomal protein L5 (RPL5) and ribosomalprotein L11 (RPL11) genes in Czech patients with diamond-blackfan anemiardquo Human Mutation vol 30 no 3 pp 321ndash3272009

[10] I Boria E Garelli H T Gazda et al ldquoThe ribosomal basisof diamond-blackfan anemia Mutation and database updaterdquoHuman Mutation vol 31 no 12 pp 1269ndash1279 2010

[11] S Rao S-Y Lee A Gutierrez et al ldquoInactivation of ribosomalprotein L22 promotes transformation by induction of thestemness factor Lin28Brdquo Blood vol 120 no 18 pp 3764ndash37732012

[12] A M Ferreira I Tuominen K van Dijk-Bos et al ldquoHighfrequency of RPL22 mutations in microsatellite-unstable col-orectal and endometrial tumorsrdquoHuman Mutation vol 35 no12 pp 1442ndash1445 2014

[13] K Pogue-Geile J R Geiser M Shu et al ldquoRibosomal proteingenes are overexpressed in colorectal cancer isolation of acDNA clone encoding the human S3 ribosomal proteinrdquoMolec-ular and Cellular Biology vol 11 no 8 pp 3842ndash3849 1991

[14] N Kondoh C W Schweinfest K W Henderson and TS Papas ldquoDifferential expression of S19 ribosomal proteinlaminin-binding protein and human lymphocyte antigen class-Imessenger RNAs associated with colon carcinoma progressionand differentiationrdquoCancer Research vol 52 no 4 pp 791ndash7961992

[15] J M Wong K-I Mafune H Yow E N Rivers and L BoChen ldquoUbiquitin-ribosomal protein S27a gene overexpressedin human colorectal carcinoma is an early growth responsegenerdquo Cancer Research vol 15 no 8 pp 1916ndash1920 1993

[16] J A Fernandez-Pol D J Klos and P D Hamilton ldquoA growthfactor-inducible gene encodes a novel nuclear protein with zincfinger structurerdquo Journal of Biological Chemistry vol 268 no28 pp 21198ndash21204 1993

[17] J A Fernandez-Pol JW Fletcher PDHamilton andD J KlosldquoExpression of metallopanstimulin and oncogenesis in humanprostatic carcinomardquo Anticancer Research vol 17 no 3 A pp1519ndash1530 1997

[18] M H Vaarala K S Porvari A P Kyllonen M V J MustonenO Lukkarinen and P T Vihko ldquoSeveral genes encoding

ribosomal proteins are over-expressed in prostate-cancer celllines Confirmation of L7a and L37 over-expression in prostate-cancer tissue samplesrdquo International Journal of Cancer vol 78no 1 pp 27ndash32 1998

[19] A Bee Y Ke S Forootan et al ldquoRibosomal protein L19 is aprognostic marker for human prostate cancerrdquo Clinical CancerResearch vol 12 no 7 pp 2061ndash2065 2006

[20] Y Atsuta N Aoki K Sato et al ldquoIdentification of metallopan-stimulin-1 as amember of a tumor associated antigen in patientswith breast cancerrdquo Cancer Letters vol 182 no 1 pp 101ndash1072002

[21] Y-WWang Y Qu J-F Li et al ldquoIn vitro and in vivo evidence ofmetallopanstimulin-1 in gastric cancer progression and tumor-igenicityrdquo Clinical Cancer Research vol 12 no 16 pp 4965ndash4973 2006

[22] J Kim J H PakWH Choi et al ldquoDetection of ovarian cancer-specific gene by differentially expressed gene polymerase chainreaction prescreening and direct DNA sequencingrdquo Journal ofClinical Oncology vol 25 supplement 18 p 21106 2007

[23] N Ban R Beckmann J H D Cate et al ldquoA new systemfor naming ribosomal proteinsrdquo Current Opinion in StructuralBiology vol 24 no 1 pp 165ndash169 2014

[24] E U-H Sim K-L Toh and T-S Tiong ldquoPreliminary findingsof down-regulated genes in nasopharyngeal carcinomardquo AsiaPacific Journal of Molecular Biology and Biotechnology vol 16no 3 pp 79ndash84 2008

[25] E U H Sim C H Ang C C Ng CW Lee and K NarayananldquoDifferential expression of a subset of ribosomal protein genesin cell lines derived from human nasopharyngeal epitheliumrdquoJournal of Human Genetics vol 55 no 2 pp 118ndash120 2010

[26] E U-H Sim S L-L Chan K-L Ng C-W Lee and KNarayanan ldquoHuman ribosomal proteins RPeL27 RPeL43 andRPeL41 are upregulated in nasopharyngeal carcinoma celllinesrdquo Disease Markers vol 2016 Article ID 5179594 7 pages2016

[27] X R Ma E U Sim T Y Ling T S Tiong S K SubramaniamandA S Khoo ldquoExpression trend of selected ribosomal proteingenes in nasopharyngeal carcinomardquo Malaysian Journal ofMedical Sciences vol 19 no 4 pp 23ndash30 2012

[28] R Glaser H-Y Zhang K Yao et al ldquoTwo epithelial tumorcell lines (HNE-1 and HONE-1) latently infected with Epstein-Barr virus that were derived from nasopharyngeal carcinomasrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 86 no 23 pp 9524ndash9528 1989

[29] Z-P Teng T Ooka D P Huang and Y Zeng ldquoDetection ofEpstein-Barr Virus DNA in well and poorly differentiated naso-pharyngeal carcinoma cell linesrdquo Virus Genes vol 13 no 1 pp53ndash60 1996

[30] D P Huang J H C Ho Y F Poon et al ldquoEstablishment of acell line (NPCHK1) from a differentiated squamous carcinomaof the nasopharynxrdquo International Journal of Cancer vol 26 no2 pp 127ndash132 1980

[31] C T Lin W Y Chan W Chen et al ldquoCharacterization ofseven newly established nasopharyngeal carcinoma cell linesrdquoLaboratory Investigation vol 68 no 6 pp 716-27 1993

[32] S T Cheung D P Huang A B Y Hui et al ldquoNasopharyngealcarcinoma cell line (C666-1) consistently harbouring Epstein-Barr virusrdquo International Journal of Cancer vol 83 no 1 pp121ndash126 1999

[33] S W Tsao X H Wang Y Liu et al ldquoEstablishment of twoimmortalized nasopharyngeal epithelial cell lines using SV40


large T and HPV16E6E7 viral oncogenesrdquo Biochimica et Bio-physica Acta (BBA)mdashMolecular Cell Research vol 1590 no 1ndash3pp 150ndash158 2002

[34] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCRand the 2minusΔΔ119862TmethodrdquoMethods vol 25 no 4 pp 402ndash408 2001

[35] H Kasai D Nadano E Hidaka et al ldquoDifferential expressionof ribosomal proteins in human normal and neoplastic colorec-tumrdquo Journal of Histochemistry and Cytochemistry vol 51 no 5pp 567ndash573 2003

[36] G Oler C P Camacho F C Hojaij P Michaluart Jr G JRiggins and J M Cerutti ldquoGene expression profiling of pap-illary thyroid carcinoma identifies transcripts correlated withBRAF mutational status and lymph node metastasisrdquo ClinicalCancer Research vol 14 no 15 pp 4735ndash4742 2008

[37] J M Cerutti R Delcelo M J Amadei et al ldquoA preoperativediagnostic test that distinguishes benign from malignant thy-roid carcinoma based on gene expressionrdquo Journal of ClinicalInvestigation vol 113 no 8 pp 1234ndash1242 2004

[38] C P Camacho S C LindseyMCCMelo et al ldquoMeasurementof calcitonin and calcitonin gene-related peptide mrna refinesthe management of patients with medullary thyroid cancer andmay replace calcitonin-stimulation testsrdquoThyroid vol 23 no 3pp 308ndash316 2013

[39] Y Hao X Kong Y Ruan et al ldquoCDK11p46 and RPS8 associatewith each other and suppress translation in a synergistic man-nerrdquo Biochemical and Biophysical Research Communicationsvol 407 no 1 pp 169ndash174 2011

[40] J-M Frigerio J-C Dagorn and J L Iovanna ldquoCloningsequencing and expression of the L5 L21 L27a L28 S5 S9S10 and S29 human ribosomal protein mRNAsrdquo BBAmdashGeneStructure and Expression vol 1262 no 1 pp 64ndash68 1995

[41] C Zhan Y Zhang J Ma et al ldquoIdentification of reference genesfor qRT-PCR in human lung squamous-cell carcinoma byRNA-SeqrdquoActa Biochimica et Biophysica Sinica vol 46 no 4 pp 330ndash337 2014

[42] O Brinkmann D A Kastratovic M V Dimitrijevic et al ldquoOralsquamous cell carcinoma detection by salivary biomarkers in aSerbian populationrdquoOralOncology vol 47 no 1 pp 51ndash55 2011

[43] S Kim and T Kim ldquoSelection of optimal internal controls forgene expression profiling of liver diseaserdquo BioTechniques vol35 no 3 pp 456ndash460 2003

[44] M S Lindstrom andM Nister ldquoSilencing of ribosomal proteinS9 elicits a multitude of cellular responses inhibiting the growthof cancer cells subsequent to p53 activationrdquo PLoS ONE vol 5no 3 Article ID e9578 2010

[45] M Bevort and H Leffers ldquoDown regulation of ribosomalprotein mRNAs during neuronal differentiation of humanNTERA2 cellsrdquoDifferentiation vol 66 no 2-3 pp 81ndash92 2000

[46] S M Adams M G F Sharp R A Walker W J Brammar andJ M Varley ldquoDifferential expression of translation-associatedgenes in benign and malignant human breast tumoursrdquo BritishJournal of Cancer vol 65 no 1 pp 65ndash71 1992

[47] H-O Kanayama K Tanaka M Aki et al ldquoChanges in expres-sions of proteasome and ubiquitin genes in human renal cancercellsrdquo Cancer Research vol 51 no 24 pp 6677ndash6685 1991

[48] H Wang J Yu L Zhang et al ldquoRPS27a promotes prolifera-tion regulates cell cycle progression and inhibits apoptosis ofleukemia cellsrdquo Biochemical and Biophysical Research Commu-nications vol 446 no 4 pp 1204ndash1210 2014

[49] P D Lee R Sladek C M T Greenwood and T J HudsonldquoControl genes and variability absence of ubiquitous referencetranscripts in diverse mammalian expression studiesrdquo GenomeResearch vol 12 no 2 pp 292ndash297 2002

[50] V P R Gunasekaran and M Ganeshan ldquoInverse correlation ofribosomal protein S27A and multifunctional protein YB-1 inhepatocellular carcinomardquo Clinical Biochemistry vol 47 no 13-14 pp 1262ndash1264 2014

[51] K L Redman and M Rechsteiner ldquoIdentification of the longubiquitin extension as ribosomal protein S27ardquoNature vol 338no 6214 pp 438ndash440 1989

[52] X-X Sun T DeVine K B Challagundla andM-S Dai ldquoInter-play between ribosomal protein S27a andMDM2 protein in p53activation in response to ribosomal stressrdquo Journal of BiologicalChemistry vol 286 no 26 pp 22730ndash22741 2011

[53] L-F Sheu A Chen H-H Tseng et al ldquoAssessment of p53expression in nasopharyngeal carcinomardquo Human Pathologyvol 26 no 4 pp 380ndash386 1995

[54] S L L Hoe E S Lee A S B Khoo and S C Peh ldquoP53 andnasopharyngeal carcinoma A Malaysian studyrdquo Pathology vol41 no 6 pp 561ndash565 2009

[55] KW Lo C HMok D P Huang et al ldquop53mutation in humannasopharyngeal carcinomardquo Anticancer Research vol 12 no 6pp 1957ndash1963 1992

[56] N Russo XWangM Liu et al ldquoAnovel approach to biomarkerdiscovery in head and neck cancer using an autoantibodysignaturerdquo Oncogene vol 32 no 42 pp 5026ndash5037 2013

[57] M Jang J E Rhee D-H Jang and S S Kim ldquoGene ExpressionProfiles are Altered in Human Papillomavirus-16 E6 D25E-Expressing Cell Linesrdquo Virology Journal vol 8 article no 4532011

[58] A Jin K Itahana K OrsquoKeefe and Y Zhang ldquoInhibition ofHDM2 and activation of p53 by ribosomal protein L23rdquoMolec-ular and Cellular Biology vol 24 no 17 pp 7669ndash7680 2004

[59] M-S Dai S X Zeng Y Jin X-X Sun L David and HLu ldquoRibosomal protein L23 activates p53 by inhibiting MDM2function in response to ribosomal perturbation but not totranslation inhibitionrdquo Molecular and Cellular Biology vol 24no 17 pp 7654ndash7668 2004

[60] S Fumagalli VV Ivanenkov T Teng andGThomas ldquoSuprain-duction of p53 by disruption of 40S and 60S ribosome biogen-esis leads to the activation of a novel G2M checkpointrdquo Genesand Development vol 26 no 10 pp 1028ndash1040 2012

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 201


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


nucleotide mutation have been found in T-cell acute lym-phoblastic leukemia and colorectal cancer respectively [1112] Besides structural aberrancies alteration in the expres-sion pattern of RP genes has been found inmany types of can-cer These include the dysregulated expressions of uS3 (S3)eS19 and eS31 in colorectal cancer [13ndash15] eL8 (L7a) eL19(L19) eS27 (S27) and eL37 (L37) in prostate cancer [16ndash19]eS27 in cells of breast tumor and gastric carcinoma and eL5and eL14 in ovarian cancer [20ndash22] Since 2014 a new namingsystem for RP genes has been introduced to unambiguouslyidentify each RP gene across broad taxonomic range [23]We adhere to this new system in this paper but have alsoincluded the old names (in parentheses) at firstmention of thegenes

Association of RP genes with NPC was initially reportedfor eS26 and eS27These twoRP genes were downregulated intumors of NPC relative to normal controls [24] Three othergenes (eL27 eL41 and eL43) were later proven to be NPC-associated RP factors in cell lines derived from NPC tissues[25 26] However the hypothesis of eS26 and eS27 as NPC-associated RP genes was subsequently refuted [27] AnotherRP gene eL32 (L32) was also found to be not involved withNPC tumorigenesis [27] This means that only a limitedsubset of RP genes are associated with NPCThe complete listof genes that belong to this subset is yet to be resolved Herewe provide evidence of four more RP genes that are relevantto the context of NPC tumorigenesis They are identified onthe basis of significant differential expression pattern betweenNPC and nonmalignant nasopharyngeal epithelial cell lines

2 Materials and Methods

21 Cell Lines and Cell Culture Six NPC-derived cell lines(HONE-1 [28] SUNE-1 [29] HK1 [30] TW01 [31] TW04[31] and C666-1 [32]) and an immortalized nonmalignantnasopharyngeal epithelial cell line (NP69 [33]) were used inthis study Many of these were originally sourced from theUniversity of Hong Kong (laboratory of Professor George SW Tsao) with permission for use granted by the providerThe NPC cell lines were cultured in RPMI-1640 (Gibco LifeTechnologies USA) containing 10 (vv) fetal bovine serum2mM L-glutamine and 100UmL penicillin-streptomycin(Gibco USA) The EBV-positive cell line C666-1 was cul-tured on fibronectin-coated (Sigma USA) cell culture flaskcontaining prewarmed (37∘C) RPMI-1640 medium TheNP69 cells were cultured in defined keratinocyte-serum-freemedium (Invitrogen USA) supplemented with 02 ngmLgrowth factors 5 heat-inactivated FBS and 100UmLpenicillin-streptomycin All cells were maintained at 37∘C ina humidified environment containing 5 CO2 Cells wereharvested at a growth confluency of 70ndash80

22 Total RNAExtraction andQuantitative Reverse Transcrip-tion-PCR (qRT-PCR) Total cellular RNAwas extracted fromthe cell cultures using TRizol Reagent (Invitrogen USA)according to the manufacturerrsquos protocol The extractedRNAs were DNase-treated with RQ1 RNase-Free DNase(Promega USA) First strand cDNA was prepared using

Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLVRT Promega USA) Real-time PCR (or qPCR)was per-formed using Rotor-Gene SYBR Green PCR Kit (QiagenUSA) and QuantiNova SYBR Green PCR Kit (Qiagen USA)on a Rotor-Gene 6000 Rotary Analyzer (Qiagen USA) andanalyzed using Rotor-Gene 6000 software Version 233 (Qia-gen USA) For each assay a total of 8 ng cDNA was added toa final reaction volume of 25 120583L containing 1x Rotor-GeneSYBR Green PCR master mix or QuantiNova SYBR GreenPCR master mix and 1 120583M of each forward and reverseprimer Table 1 lists the details of the PCR primers used forthis study Quantitative gene amplifications were performedusing the following thermocycling conditions initial denatu-ration for 5minutes at 95∘C 40 cycles of denaturation at 95∘Cfor 5 seconds and annealing and extension at 60∘C for 20 sec-onds Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)genes was used as endogenous control (or reference gene)Nontemplate reactionwas used as negative control Biologicaltriplicate tests were done for all analysis

The selection of the threshold intensity was set at a fixedintensity on the log-linear phase of the amplification curvefor all the samples tested Validation experiments whichincluded the generation of standard curves using a series ofdiluted cDNA samples were carried out to ensure primerefficiency as well as target and reference gene amplificationcompatibility Melt curve analysis and conventional agarosegel analysis were adopted alongside to verify the presenceof a single amplicon An interassay calibration scheme wasadopted to minimize loading variation and to detect possiblecontamination with the inclusion of duplicate reactions andldquono-templaterdquo control (NTC) respectively in each qPCRassay All samples were normalized toGAPDH as the endoge-nous control Relative fold differences were calculated by theΔΔCT method [34]

23 Validation of PCR Efficiency Primer efficiency was val-idated by generating a duplicate fivefold serial dilution overfive-log magnitude A calibration curve for each gene wasplotted with average quantification cycle (119862119902) values againstlog input amount (4 08 016 0032 and 00064 ng120583l) PCRamplification efficiency was determined from the slope of thelog-linear portion of the calibration curve as follows

Amplification efficiency = [10minus1slope] minus 1 (1)

Valid ΔΔCT calculation requires the PCR amplification effi-ciencies of the target and reference genes to be acceptablycomparable This was determined by evaluating the relativeefficiencies of the target and reference amplification fromthe individually generated standard curves using the sampleand log dilution The Δ119862119902 values (CT target minus CT reference)were plotted against log input amount of five-template DNAdilution (4 08 016 0032 and 00064 ng120583l) The slope ofthe resulting semi-log regression line (slope ofΔ119862119902 versus logof input amount) was used to determine the compatibility ofthe two PCR efficiencies with the slope value (119898) less than 01taken as ideal In this study primer efficiency of the respectivegenes in an NPC cell line (HK1) was validated against thereference gene GAPDH Quality assessment tests indicated















3 Results







eS8


HK1 0251844 0163468 0000649TWO1 0402658 044444 0038129TWO4 0253709 0282225 0004816C666-1 0196327 0085366 404E-05

uS4


eS31


HK1 0560767 0239252 0015339TWO1 0415694 0235145 0005853TWO4 0246348 0160656 0000588C666-1 0322675 0329258 0011062

eL6


eL18


uL14


eL24



Table 2 Continued


eL30












4 Discussion








NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge






5 Conclusion






Acknowledgments


References








































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology















3 Results







eS8


HK1 0251844 0163468 0000649TWO1 0402658 044444 0038129TWO4 0253709 0282225 0004816C666-1 0196327 0085366 404E-05

uS4


eS31


HK1 0560767 0239252 0015339TWO1 0415694 0235145 0005853TWO4 0246348 0160656 0000588C666-1 0322675 0329258 0011062

eL6


eL18


uL14


eL24



Table 2 Continued


eL30












4 Discussion








NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge






5 Conclusion






Acknowledgments


References








































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




eS8


HK1 0251844 0163468 0000649TWO1 0402658 044444 0038129TWO4 0253709 0282225 0004816C666-1 0196327 0085366 404E-05

uS4


eS31


HK1 0560767 0239252 0015339TWO1 0415694 0235145 0005853TWO4 0246348 0160656 0000588C666-1 0322675 0329258 0011062

eL6


eL18


uL14


eL24



Table 2 Continued


eL30












4 Discussion








NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge






5 Conclusion






Acknowledgments


References








































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Table 2 Continued


eL30












4 Discussion








NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge






5 Conclusion






Acknowledgments


References








































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




NP69NPC

minus2500

minus2000

minus1500

minus1000

minus500

minus200

minus100

0

100

200

300

400

Aver

age f

old

chan

ge






5 Conclusion






Acknowledgments


References








































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






































































Volume 201






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

uS4 eS31,anduL14Ribosomal Protein Genes Are Dysregulated...

Documents

Transcript of uS4 eS31,anduL14Ribosomal Protein Genes Are Dysregulated...