University of Groningen

Molecular genetic regulation of developmental leaf longevityShirzadian, Reza

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2008

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Shirzadian, R. (2008). Molecular genetic regulation of developmental leaf longevity. Groningen: s.n.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 04-02-2019

Chapter 4

1) Molecular Biology of Plants, Groningen Biomolecular Sciences and Biotechnology

Institute, University of Groningen, Kerklaan 30, 9751 NN, Haren, The Netherlands

2) Institute of Molecular BioSciences (IMBS), Massey University, Private Bag 11222,

Palmerston North, New Zealand

To be submitted

A mutation in an Arabidopsis inositol polyphosphate 1-

phosphatase delays senescence and deregulates stomatal

aperture

Reza Shirzadian-Khorramabad1, Hai-Chun Jing1, Jacques Hille1 and Paul P.

Dijkwel1,2

Chapter 4 92

Abstract

Leaf senescence is a genetically programmed process that

limits the longevity of a leaf. In an attempt to better understand the

mechanism of leaf senescence, we identified and analysed the

recessive Arabidopsis stay-green mutation onset of leaf death 101

(old101). old101 mutants stays longer green than the wild type after

treatment with ethylene, or when grown in air. A delay in all

senescence parameters examined, including chlorophyll content,

photochemical efficiency of photosystem II, ion leakage, nutrient

remobilization and expression of senescence-associated genes

(SAGs) was found demonstrating that old101 mutants stay

functionally green. The old101 mutation causes a G to A

substitution in the second exon of AT3G63980, which has

previously been annotated as FRY1. OLD101/FRY1 encodes an

inositol polyphosphate 1-phosphatase, which removes the 1-

phophate group from the second messenger inositol 1, 4, 5-

trisphosphate (IP3). IP3 is involved in regulating stomatal aperture

and old101 mutants have in comparison with the wild type a

reduced stomatal aperture when grown in air, but the stomata are

more open after ethylene treatment. The results suggest that

phosphoinositide signalling is involved in the regulation of leaf

longevity and induction of senescence.

old101 delays leaf senescence

93

Introduction

Senescence is a most remarkable developmental phenomenon in nature in that it

limits the life span of seemingly any organism and thus prohibits man’s desire for

eternal youth. Plants senesce in a particularly notable way during autumn when at the

same time masses of leaves undergo dramatic changes, resulting in spectacular colour

changes. Leaf senescence is associated with changes in expression of thousands of

genes (Guo et al., 2004; Gepstein et al., 2003; Lin and Wu, 2004). Not surprisingly,

expression of genes encoding proteases, nucleases, stress responsive proteins,

transcriptional regulators and lipid-, carbohydrate-, and nitrogen-metabolizing enzymes

are induced, confirming that leaf senescence is an active detrimental process that aims

to recover nutrients from the dying leaves (Fischer, 2007; Schippers et al., 2007).

The leaf senescence process is developmentally controlled by age-related changes

(ARCs) that occur throughout plant development (Lim et al., 2007; Jing et al., 2005).

Thus, the onset of leaf senescence as an active process might be controlled by a cellular

mechanism that measures the age and sets the developmental senescence program

accordingly (Lim et al., 2003) but the nature of the ARCs and genes involved in

regulation of the onset of senescence are poorly understood. The plant hormone

ethylene has long been considered as a key hormone involved in regulating the onset of

leaf senescence (Zacarias and Reid, 1990). However, analysis of mutants that are

disturbed in ethylene signalling has shown that ethylene is neither sufficient nor

necessary for the induction of senescence. Arabidopsis mutants that lack a functional

ethylene signalling pathway such as ein2 and etr1 still senesce, albeit slightly later

(Grbić and Bleecker, 1995; Oh et al., 1997; Jing et al., 2002). Moreover, early leaf

senescence is not induced in the ctr1 mutant in which ethylene signalling is

continuously switched on, or in wild-type plants that are grown in the continuous

presence of exogenously applied ethylene (Jing et al., 2005; Kieber et al., 1993). Thus,

the induction of leaf senescence by ethylene strictly depends on age (Hensel et al., 1993;

Grbić and Bleecker, 1995; Jing et al., 2002; Jing et al., 2005) and suggests that ARCs

are the master regulators of senescence, while the function of ethylene is to induce

senescence within a certain time-window (Jing et al., 2003).

Opposite to the effect of ethylene, many studies have recognized cytokinins as an

effective senescence-retarding growth regulator (Gan and Amasino, 1995; McCabe et

Chapter 4 94

al., 2001; McKenzie et al., 1998; Ori et al., 1999). This was recently confirmed by the

characterization of mutations in one of the cytokinin receptors. The gain-of-function

mutant ore12 exhibited increased life span (Kim et al., 2006), while loss-of-function

mutants showed accelerated dark-induced senescence (Riefler et al., 2006; Kim et al.,

2006). It is unclear how cytokinin signalling influences ARCs but the observation that

ectopic cytokinin biosynthesis during late developmental stages of leaf development can

delay senescence (Gan and Amasino, 1995), suggests that cytokinin may simply

overrule the effect of ARCs. Nevertheless, hormonal signalling pathways strongly

influence senescence and are important internal factors involved in regulating the timing

of leaf senescence (Schippers et al., 2007).

The identification and characterization of Arabidopsis mutants that show

premature or delayed leaf senescence has shown that basic metabolic processes are

involved in the regulation of ARCs and/or timing of senescence. Interestingly, a

potential regulator involved in integrating ethylene signalling into age dependent

pathways has been reported (Jing et al., 2002; Jing et al., 2005). The onset of leaf death

1 (old1) mutation resulted in alteration of both age- and ethylene dependent leaf

senescence suggesting that OLD1 negatively regulates integration of ethylene signalling

into leaf senescence. The OLD1 gene was found to be allelic to CPR5 and may be a

senescence-regulatory gene with pleiotropic functions as predicted by the evolutionary

theory of senescence (Jing et al., 2007; Jing et al., 2008). The old1 mutation causes an

altered redox balance confirming a link between oxidative stress and the regulation of

senescence (Navabpour et al., 2003; Woo et al., 2004; Guo and Crawford, 2005; Jing et

al., 2008). Similarly, reduced chloroplast activity as a result of mutation in the PRPS17

gene may lead to less oxidative stress and increased leaf longevity in ore4 mutants

(Woo et al., 2002). Glucose-insensitive Arabidopsis mutants carrying a lesion in the

hexokinase-1 (HXK1/GIN2) gene show delayed leaf senescence, probably as a result of

decreased sugar sensitivity (Pourtau et al., 2006; Moore et al., 2003) consistent with the

suggestion that metabolic rate is involved in the regulation of ageing (Ewbank et al.,

1997; Jing et al., 2003; Kimura et al., 1997). A mutation in the F-box protein ORE9

provides evidence that leaf senescence is associated with the ubiquitin-mediated

degradation of specific proteins (Woo et al., 2001). In addition, the delayed-leaf-

senescence1 (dls1) mutant harbors a mutation in the AtATE1 gene resulting in a

old101 delays leaf senescence

95

deficiency in R-transferase activity which is a component of the N-end-rule proteolytic

pathway for ubiquitin-dependent proteolysis (Yoshida et al., 2002). Thus, DLS1, like

ORE9, might play a role in the degradation of proteins that negatively regulate leaf

senescence. Taken together, the regulation of leaf senescence is associated with various

signalling and regulatory pathways. How these signalling pathways may regulate

senescence and/or influence ARCs is still far from clear.

In an effort to find genes that alter the timing of ARCs, mutants were selected

that showed early or delayed senescence symptoms upon ethylene treatment (Jing et al.,

2002). Young wild type leaves do not senesce in response to ethylene treatment and

same aged mutant leaves that senesce under identical conditions may have already gone

through ARCs that allow the leaves to respond to the treatment with senescence. In the

same way, chapter 2 describes the isolation of stay green mutants that have leaves that

do not respond to ethylene with leaf senescence at an age that will induce senescence in

wild type plants. Such mutants may go through ARCs slower than the wild type or

alternatively may have a lesion in the ethylene-signalling pathway. In this study, we

describe a stay green mutant designated as onset of leaf death101 (old101). old101

mutants show an extension in leaf longevity when grown in air and after ethylene

treatment, but still possess a functional ethylene signalling pathway. The OLD101 gene

encodes an enzyme involved in the degradation of the second messenger inositol 1, 4, 5-

trisphosphate (IP3), suggesting that phosphoinositide signalling may affect ARCs. Thus,

the old101 mutant defines a novel regulatory system for the regulation of senescence.

Results

The old101 mutation extends leaf longevity after ethylene treatment

The onset of leaf death101 (old101) mutant was isolated in a screen for mutants

that stay green after ethylene treatment (Chapter 2) and segregates as a monogenic

recessive trait when backcrossed to its wild type accession Landsberg erecta (Ler-0)

(Chapter 3). Figure 1a, shows that wild type plants that were grown for 26 days in air

and subsequently for 3 days in air supplemented with ethylene and one additional day in

air show up to 6 yellow rosette leaves. In contrast, no yellow rosette leaves were

observed in identically treated old101 mutants. The effect of age on ethylene-induced

leaf yellowing was measured in the mutant and the wild type. Figure 1b shows that

number of yellow leaves in ethylene-treated wild type plants rises as they age. The same

Chapter 4 96

trend was observed in mutant plants, but leaf yellowing was significantly reduced as

compared to the wild type. These results therefore show that old101 plants stay green

longer than wild type plants after ethylene treatment.

Figure 1. Phenotypes and visible leaf yellowing in air-grown and ethylene- treated plants Representative 30-day-old Ler-0 or old101 plants are shown in (a). Plants were grown in air for 30 days (Air) or were grown in air for 26 days, followed by 3 days of growth in air supplemented with ethylene and one additional day of growth in air (Ethylene). The average number of yellow leaves per plant in ethylene-treated Ler-0 and old101 plants of different developmental stages ranging from 18 to 42 days of growth was scored (b). Bars represent means ± sd of at least three replicates of 30 plants.

The stay green phenotype was further assessed by studying typical senescence-

associated physiological markers in the 3rd and 4th rosette leaves of ethylene-treated

plants. Figure 2a shows that chlorophyll content in ethylene-treated wild type leaves

reduce considerably in 30-day and older plants. A similar drop was found in 42-day-old

old101 plants. Interestingly, chlorophyll content in 42-day-old ethylene-treated mutant

leaves reached the same value as that of wild type plants, suggesting that ethylene-

induced leaf yellowing is delayed but once senescence is initiated it progresses in the

same way as the wild type. Disruption of membrane integrity is a major event during

leaf senescence and, as shown in figure 2b, 30 days or older mutant leaves exhibited a

lower percentage of ion membrane conductivity than the wild type.

old101 delays leaf senescence

97

Figure 2. Chlorophyll content and ion leakage in ethylene-treated Ler-0 and old101 plants Wild type and mutant plants were grown in air up to 4 days before the indicated times, and subsequently were treated with ethylene for 3 days and grown for one additional day in air before leaf harvesting. The collected samples were used for determination of maximum quantum yield of PSII electron transport by measuring (maximum variable fluorescence/maximum yield of fluorescence) (a) and ion leakage (b) in wild type and old101 leaves. Results are shown as mean ± sd of at least three replicates.

Leaf senescence coincides with changes in expression of many genes and the

expression of three established senescence marker genes and a photosynthesis marker

gene was followed by quantitative real-time PCR. Expression of the SAG12 was found

to strictly correlate with developmental senescence (Lohman et al., 1994; Noh and

Amasino, 1999; He et al., 2001). SAG13 is a well-known molecular marker induced by

ozone, UV-B, abscisic acid as well as senescence (A.-H.-Mackerness et al., 1999, 2001;

Miller et al., 1999; Brodersen et al., 2002), while SAG21 abundance peaks at or shortly

before visible senescence begins, and declines thereafter (Weaver et al., 1998). As

shown in figure 3, expression levels of the SAGs increased considerably in ethylene-

treated wild-type leaves as compared with similarly treated old101 plants. Air-treated

plants had no detectable SAG12 or SAG13 expression, but SAG21 expression was only

detected in 30-day-old air-treated wild-type plants (Data not shown). Furthermore,

transcription levels of the photosynthesis associated gene CAB (Chlorophyll a/b-binding

protein) (Leutwiler et al., 1986) was measured in 30-day-old air- or ethylene-treated

plants as a marker for photosynthesis associated gene expression. As shown in figure 3,

a noticeably lower expression of CAB gene in response to exogenous ethylene was

detected in ethylene-treated wild-type leaves when compared with old101 leaves. No

Chapter 4 98

difference in expression levels for this gene in air-treated examined plants was detected

(Data not shown).

Thus, all the measured visual, physiological and molecular markers for senescence

were reduced in the old101 mutant plants as compared to the wild type and this shows

that the old101 mutation delays ethylene-induced leaf senescence.

Figure 3. Relative transcription levels of senescence and photosynthesis associated marker genes The relative transcript levels of SAG21, SAG12, and SAG13 as representative SAG markers and CAB as a photosynthesis-associated marker were examined in leaves of 30-day-old ethylene-treated wild type and old101 plants by quantitative RT-PCR analysis. UBQ5 was used as the internal control. The values shown are the means of three repeats ± sd.

The old101 mutation causes a functional stay green phenotype

The delayed senescence phenotype may not be functional. Therefore we

measured the photochemical efficiency of photosystem II (PSII), by measuring Fv/Fm

ratio of the 3rd and 4th leaves of wild type and mutant plants. Figure 4a shows that the

photochemical efficiency of photosystem II began to decrease noticeably in 30-day-old

wild type plants, decreasing further in 35- and 42-day-old plants. The same trend was

not observed in the old101 leaves, and a considerable reduction in the Fv/Fm ratio was

only found in 42-day-old ethylene-treated mutant plants.

Leaf senescence is marked by a nutrient remobilisation process (Fischer, 2007).

Since the old101 mutation results in functional delayed senescence, we expect that

nutrient remobilisation is delayed in the mutant as well. In Arabidopsis leaves nitrogen

is remobilised efficiently (Himelblau and Amasino, 2001) and therefore the nitrogen

levels were determined in the 3rd and 4th leaves of wild type and old101 plants. We

analysed 30-day-old ethylene- and air-treated plants for total nitrogen content.

old101 delays leaf senescence

99

Figure 4. PSII efficiency and nitrogen remobilisation Photochemical efficiency of PSII of ethylene treated wild type and mutant plants of a final age of 18 to 42 days was measured. PSII efficiency of the 3rd and 4th leaves was measured and expressed as maximum variable fluorescence/maximum yield of fluorescence) (a). Nitrogen levels of dried air and ethylene treated 3rd and 4th leaves was measured as described in material and methods and expressed as percentage of total weight (b). Results are mean ± sd of at least three replicates.

Air-treated wild type or mutant plants accumulated approximately the same amount of

nitrogen. However, ethylene treatment caused a significantly bigger drop in total

nitrogen content in the wild type than the mutant (Figure 4b). These results demonstrate

that old101 plants stay functionally green longer than wild type after ethylene treatment

and that this is associated with a reduced nitrogen remobilisation.

The old101 mutation delays developmentally-induced senescence

The delayed senescence phenotype can be specific for ethylene-induced

senescence and may not delay developmentally-induced senescence. We counted the

number of yellow leaves in 42-day-old air grown mutant and wild type plants. As figure

5a shows up to 5 leaves including cotyledons were senescing in wild type plants, while

just signs of yellowing were detected in some old101 cotyledons. In addition, membrane

ion conductivity and photochemical efficiency of photosystem II was measured in the

3rd and 4th leaves of wild type and mutant plants, grown in air for up to 42 days. The

results show that after 42 days the membrane ion conductivity of wild type leaves

increases and that PSII efficiency decreases (Figure 5b and 5c). This was not the case

for mutant leaves and this shows that the old101 mutation causes a functional stay green

phenotype after developmentally induced leaf senescence.

Chapter 4 100

Figure 5. Leaf senescence symptoms in air-grown wild type and old101 plants Wild type and old101 plants were grown for 42-days in air and the number of yellow leaves was counted (a). Wild type and mutant plants were grown for 18 to 42 days in air and the membrane ion leakage (b) and maximum quantum yield of PSII electron transport (c) of the 3rd and 4th leaves was determined. Results are shown as mean ± sd of at least three replicates.

The old101 seedlings and plants are responsive to ethylene

Ethylene is a strong inducer of senescence and the old101 phenotype may be a

result of reduced ethylene signalling. Therefore the responsiveness of old101 mutants to

ethylene was determined in early and late stages of plant growth. First the response of

etiolated wild type and old101 seedlings to ACC, the precursor of ethylene, was

monitored. ACC treatment induces the triple response and we used the length of the

hypocotyl as a marker for the strength of the ethylene effect. Thus, seedlings were

grown on MS medium containing 0, 1, 5 or 10 µM ACC. After 5 days of growth in

darkness, the hypocotyl length was measured in wild type and old101 seedlings. Figure

6a shows that wild type and old101 seedlings growing in the medium lacking ACC

show no difference in hypocotyl length. In media containing various amounts of ACC,

the hypocotyl of the mutant was not longer than the wild type demonstrating that the

ethylene signalling pathway in old101 seedlings is fully functional.

old101 delays leaf senescence

101

Figure 6. Ethylene responses in wild type and old101 mutants Hypocotyl length of wild type (Ler-0) and old101 seedlings grown on MS medium containing 0, 1, 5 or 10µM ACC in darkness were measured after 5 days. Samples were measured in 3 replicates (20 seedlings for each) (a). Relative transcript levels of ethylene biosynthesis gene ACS2 was determined in leaves of Ler-0 and old101 plants with a final age of 18, 30 and 35 days that were exposed to ethylene for 3 days by quantitative RT-PCR analysis, using UBQ5 as the internal control. The values shown are the means of three repeats ± sd.

Next, the expression of a gene involved in ethylene biosynthesis, 1-

aminocyclopropane-1-carboxylic acid synthase 2 (ACS2) gene (Liang et al., 1992), was

measured. ACS2 is induced by hypoxia and wounding (Tsuchisaka and Theologis, 2004;

Peng et al., 2005) and we found that it is induced by ethylene treatment (results not

shown). ACS2 gene expression was measured in 18, 30 and 35-day-old wild type and

mutant plants treated by ethylene for 3 days, using quantitative RT-PCR. In air treated

plants ACS2 expression was not detectable (results not shown), but ethylene treatment

of 18-day-old wild type and mutant plants resulted in a similar increase in expression in

both plants, suggesting that the ethylene treatment causes the same response in the

mutant as in the wild type. However, ethylene treatment of 30- and 35-day-old wild-

type plants resulted in a significant up-regulation of the ACS2 gene as compared to

mutant plants. The higher expression in wild type coincided with stronger leaf

senescence symptoms, suggesting that ACS2 expression is induced during senescence.

Other ethylene responses were found to occur in the mutant in the same way as

the wild type: old101 leaves show a hyponastic response to ethylene (Millenaar et al.,

2005) and new appearing leaves appear dark green after ethylene exposure (Data not

shown). Indeed, ethylene did induce senescence in the mutant even though only in older

leaves (Compare figures 1 and 2 with figure 5). Taken together, the results suggest that

several ethylene responses are similar between the mutant and the wild type, while

specifically ethylene-induced senescence is delayed in the mutant.

Chapter 4 102

The OLD101 gene encodes a bifunctional enzyme involved in sulfur assimilation and phosphoinositide signalling

The old101 mutant was identified in the Landsberg erecta (Ler-0) accession and

was crossed to Columbia (Col-0) to facilitate the mapping. Genetic analysis of the

mapping population revealed that the old101 phenotype was linked to two genomic

locations (Data not shown). The old101 phenotype was found to be linked to the erecta

gene on chromosome 2 and to the bottom of chromosome 5. In order to clarify the true

location of the old101 gene, we took advantage of two Arabidopsis Ler-0/Cvi inbred

lines (Keurentjes et al., 2007). The LCN2-7 line carries a 6.5 Mb Cvi genome fragment

in the middle of chromosome 2 and line LCN5-19 line harbours a Cvi genome fragment

at the bottom of chromosome 5. The F2 population obtained from the cross between the

inbred lines and old101 plants was investigated for linkage of the old101 phenotype

using known markers in these regions. The data obtained demonstrated that the old101

gene is located at the bottom of chromosome 5. Using a massively parallel sequencing

strategy we found a mutation in a 150 kb region on chromosome 5 as described in

chapter 3. The mutation causes a G to A change in the second exon of the AT3G63980

gene and removes a Bc1I restriction site. AT3G63980 has previously been annotated as

FRY1 and encodes a bifunctional enzyme with 3(2), 5-bisphosphate nucleotidase and

inositol polyphosphate 1-phosphatase activities (Xiong et al., 2001). The mutation

results in an Asp38 to Asn38 substitution in the encoded protein and is located between

the first and second α-helix of the protein (York et al., 1995; Xiong et al., 2001; Xiong

et al., 2004; Quintero et al., 1996). To determine whether OLD101 is identical to FRY1,

a 5.6 kb Ler-0 genomic fragment containing the coding sequence and a 0.7-kb promoter

sequence, according to the AGRIS database (Davuluri et al., 2003), was cloned and

transformed to old101 plants (Clough and Bent, 1998). The old101 phenotype of the T2

population of three independent transformants segregated in a 3:1 ratio of wild type to

mutant (Figure 7). Moreover, it was found that the wild type phenotype strictly

correlated with the presence of the T-DNA, while no T-DNA was detected in T2 plants

that showed the old101 phenotype (Data not shown). These results demonstrate that

OLD101 is identical to FRY1.

old101 delays leaf senescence

103

Figure 7. Genetic complementation of the old101 mutation The OLD101 genomic region including the promoter area was cloned in pGreen vector and transformed to old101 plants. Representative 30-day-old Ler-0 (Left), old101 carrying the homozygous OLD101 gene (Middle), and old101 (Right) plants after ethylene treatment are shown.

The mutation in OLD101 gene delays seedling and plant growth development

We noticed that old101 seedlings developed slower than wild type seedlings.

Mutant and wild type seedlings were germinated on filter paper and after 5 days of

growth, 45% of the wild type seedlings had green cotyledons, while only 15% of

germinating old101 seeds showed green cotyledons (Figure 8a). This is similar to the

fry1-1 mutation which causes a delay in germination of about one day (Xiong et al.,

2001). The mutation may delay development through the plant life cycle and this could

be the result for the late senescence phenotype. Therefore plant growth progression was

determined in wild type and mutant plants in five soil-based growth stages for up to 30

days using the method reported by Boyes et al. (2001). The stages were 1.02 (Two

rosette leaves > 1mm), 1.04 (Four rosette leaves > 1mm), 1.07 (Seven rosette leaves >

1mm), 1.10 (Ten rosette leaves > 1mm) and 5.1 (First flower buds become visible). The

data revealed that average growth development was slightly delayed in old101 plants in

all tested stages in comparison with the wild type plants (Figure 8b). The average

difference was one to two days but this was not significant (Data not shown). In contrast

the old101 mutation causes a significant delay in ethylene-induced leaf senescence of at

least five days (Figure 2).

Thus, the slower development may be the result of the delayed germination but

cannot be the sole cause for the old101 senescence phenotype.

Chapter 4 104

Figure 8. Development of wild type and mutant plants Seeds were incubated on filter paper saturated with water at 4ºC for 3 days before transferring to a 21ºC growth chamber. After 5 days of growth at 21ºC, the number of seedlings having two green cotyledons was counted and expressed as percentage of total green seedlings (a). Soil based-analysis of growth progression of wild type and mutant plants was determined in 5 stages including 1.02 (Two rosette leaves > 1mm), 1.04 (Four rosette leaves > 1mm), 1.07 (Seven rosette leaves > 1mm), 1.10 (Ten rosette leaves > 1mm) and 5.1 (First flower buds visible). Arrows define the time (Days after transferring to 21ºC) at which Ler-0 or old101 plants reach the growth stages indicated (b). Values shown in (a) represent means ± sd of three replicates of at least 20 observations. The values shown in (b) are the means of at least 25 plants.

Figure 9. Stomatal aperture of air-grown and ethylene-treated wild type and mutant plants The leaves were harvested from either 30-day-old air-grown Ler-0 or old101 plants, or from plants with a final age of 30 days that were exposed to ethylene for 24 hours or 72 hours prior to harvesting the leaf material for stomatal aperture measurements. Stomatal aperture was measured as described in material and methods (a). Representative pictures of leaf stomata in non-treated leaves of wild type and old101 plants, and in identical age plants treated by ethylene for 24 hours (b). Values shown represent means ± sd of three replicates of at least 20 observations.

Stomata in old101 plants stay open during ethylene treatment

Non-senescing leaves have more open stomata than senescing ones (Wardle and

Short, 1983) and ethylene induces stomatal closure in Arabidopsis leaves (Desikan et

al., 2006). Moreover, the fry1-1 mutation changes IP3 levels (Xiong et al., 2001) and

old101 delays leaf senescence

105

IP3 microinjection can stimulate stomatal closure indicating that IP3 is sufficient for

stomatal closure (Gilroy et al., 1990). Thus, changes in IP3 levels may affect stomatal

aperture. Therefore, we measured the stomatal aperture of wild type and mutant leaves

after growth in air and in response to ethylene treatment. As shown in figure 9, stomatal

aperture of wild type plants is greater in air grown leaves than in leaves that were

ethylene-treated for 24 or 72 hours. Similarly, ethylene treatment reduced stomatal

aperture in old101 leaves. However, when stomata of old101 leaves were compared

with those of wild type leaves, old101 stomata were more closed in air, but more open

after ethylene treatment. Thus, the old101 mutation may result in changed IP3 levels

and this could subsequently influence stomatal aperture.

Discussion

The old101 mutation may affect age-related changes

Ethylene is a well-known promoter of leaf senescence. Endogenous ethylene

levels increase during leaf senescence in many plant species, including Arabidopsis (van

der Graaff et al., 2006), and exogenous application of ethylene accelerates leaf

senescence (Schippers et al., 2007). In this study we describe the old101 mutant, which

shows a functional stay green phenotype after ethylene exposure. All measured

physiological and molecular markers for leaf senescence are delayed in the mutant,

including nitrogen remobilisation, photosynthetic capacity and expression of SAGs. The

old101 mutant, furthermore, has a fully functional ethylene signalling pathway,

suggesting that the mutant has a reduced ethylene response, specifically for ethylene-

induced senescence.

The effect of exogenous ethylene application on leaf senescence has been found to

strictly depend on leaf age and only when the required age-related changes (ARCs) have

taken place, ethylene can induce leaf senescence (Hensel et al., 1993; Grbić and

Bleecker, 1995; Jing et al., 2002; Jing et al., 2005). The senescence window concept

was developed to explain the effect of ARCs on the ability of a leaf to respond to

ethylene with the induction of senescence (Jing et al., 2003). The model states that each

individual leaf goes through three developmentally controlled stages. The first stage is

the ‘never senescence’ phase where ethylene cannot induce senescence. During the

second phase the leaf is able to respond to ethylene with the induction of senescence.

During this phase, the leaf will remain fully green under environmentally favourable

Chapter 4 106

conditions, but senescence can be induced by ethylene, if required. The third phase is

the ‘always senescence’ phase and leaf senescence is induced, regardless of the

presence of ethylene. The progression from one phase to the other is controlled by

ARCs and the senescence window model predicts that mutants can be isolated in which

the timing of the switch from one phase to the other is altered. The phenotype of the

old101 mutant is consistent with a delay in the switch from the never senescence phase

to the inducible senescence phase. Moreover, old101 mutants senesce late in air and this

suggests that the switch to the always senescence phase may be delayed as well. The

switch from the never senescence phase to the inducible senescence phase was recently

studied by treating Arabidopsis wild type and old mutants for various amounts of time

with ethylene (Jing et al., 2005). It was found that the length of the ethylene treatment

could modify the ARCs and therefore the old101 mutation might be involved in

integrating ARCs and the ethylene signal.

Thus, the old101 phenotype can be explained by the senescence window concept

but more research is required to determine how OLD101 may influence plant

development and ARCs.

OLD101/FRY1 activity regulates IP3 levels

As a first step in understanding the effect of the old101 mutation on leaf

senescence, the mutation was identified. The old101 mutation causes an Asp38 to Asn38

substitution in OLD101 protein. OLD101 has been annotated as FRY1 and SAL1 in

Arabidopsis (Quintero et al., 1996; Xiong et al., 2001) and encodes a highly conserved

gene in yeast, plants and mammals (Gy et al., 2007). The OLD101/FRY1 gene is a

bifunctional enzyme with 3’(2’), 5’-biphosphate nucleotidase and inositol

polyphosphate 1-phosphatase activities (Quintero et al., 1996; Xiong et al., 2001),

involved in sulfur assimilation and phosphoinositide signalling. The 3’(2’), 5’-

biphosphate nucleotidase activity was not believed to be required for sulfur reduction in

Arabidopsis and the defect in phosphoinositol 1-phosphatase function is most likely

responsible for the fry1 mutant phenotypes (Xiong et al., 2001). Similarly, we

hypothesize that the OLD101/FRY1 inositol polyphosphate 1-phosphatase activity, is

more relevant for the old101 phenotypes in this study.

Activation of the phospholipid-cleaving enzyme Phospholipase C (PLC)

hydrolyses phosphotidylinositol 4,5-bisphosphate (PIP2) into inositol 1, 4, 5-

old101 delays leaf senescence

107

trisphosphate (IP3) and diacylglycerol (DAG) which are both important signalling

molecules in plants (Reviewed in Xiong et al., 2002). Plants employ a set of specific

enzymes with inositol phosphatase activity to metabolise and terminate IP3 signalling

activity. The first group includes enzymes that remove 1-phosphate while the second

group removes the 5-phosphate from IP3. Fifteen At5Ptase genes, encoding inositol 5-

phosphatases and 5 OLD101/FRY1-like inositol polyphosphate 1-phosphatases, were

reported (Xiong et al., 2001; Xiong et al., 2004; Berdy et al., 2001; Gunesekera et al.,

2007; Lin et al., 2005; Carland and Nelson, 2004). Biochemical assessment of several of

these enzymes revealed that they differ in substrate specificity (Xiong et al., 2001;

Berdy et al., 2001; Ercetin and Gillaspy, 2004; Zhong et al., 2004; Zhong and Ye,

2004). OLD101/FRY1 has been shown to be able to hydrolyze inositol 1, 4-

bisphosphate [Ins(1,4)P2], inositol 1, 3, 4-trisphosphate [Ins(1,3,4)P3] and inositol 1, 4,

5-trisphosphate (IP3) (Quintero et al., 1996; Xiong et al., 2001). Mutations in several of

the inositol phosphatases have been found or induced and this has helped in the

functional analysis of IP3 signalling pathways. Several 5-phosphatases have been

shown to be involved in plant development: FRA3 is involved in secondary cell-wall

biosynthesis, CVP2 controls vein development, while another 5-phophatase affects root-

hair morphogenesis (Zhong et al., 2004; Carland and Nelson, 2004; Jones et al., 2006).

IP3 signalling, furthermore, is activated upon stress and PLC inhibition resulted in

compromised IP3 accumulation in salt stressed Arabidopsis plants (DeWald et al.,

2001). The fry1-1 mutation causes reduced stress tolerance (Xiong et al., 2001) while

sac9 mutants accumulate increased PIP2 and IP3 levels and have characteristics of a

constitutive stress response (Williams et al., 2005). On the other hand, a decrease in IP3

levels resulted in reduced expression of ABA induced gene expression (Sanchez and

Chua, 2001; Zhu, 2002).

Thus, the OLD101/FRY1 protein is involved in stress tolerance. Several

old101/fry1 mutant alleles were isolated and comparison of the alleles may provide

clues on how the old101 mutation causes a late senescence phenotype. The fry1-1

mutation causes elevated IP3 levels in either ABA-treated or non-treated seedlings. The

altered IP3 levels are associated with increased expression levels of stress-responsive

genes, susceptibility to salt, drought and cold temperatures and a dwarf phenotype when

grown for 30 days in standard growth conditions (Xiong et al., 2001; data not shown).

Chapter 4 108

Similarly, the loss-of-function fry1-6 mutant shows a dwarf phenotype and in addition

crinkly leaves, rounded leaf margins and delayed flowering (Gy et al., 2007). The

conditional loss-of-function mutant hos2 harbours a point mutation in the third exon of

the OLD101/FRY1 gene. The mutation renders the FRY1 recombinant protein

completely inactive in the cold but did not substantially affect its activity at optimal

temperature for Arabidopsis and growth under cold conditions results in a dwarf

phenotype (Xiong et al., 2004). Thus, loss-of-function mutations in the OLD101/FRY1

gene are associated with elevated IP3 levels, constitutive stress responses and a dwarf

phenotype. The old101 phenotype is the result of a novel mutation in the second exon of

FRY1/OLD101 and causes resistance to ethylene-induced senescence. Moreover, the

mutation does not constitutively induce high transcription levels of the stress-responsive

genes RD29A, KIN1, COR15A, HSP70, ADH and COR47 (Data not shown) which show

increased expression in fry1-1 mutants (Xiong et al., 2001). This demonstrates that the

old101 gene does not encode a loss-of-function, but rather a leaky or gain of function

protein. Measurement of IP3 and degradation products after treatments that normally

increase IP3 levels should further define the effect of the old101 mutation on

OLD101/FRY1 enzyme activity.

The old101 mutation causes changes in stomatal aperture

Environmental stresses as well as endogenous plant hormones, including

ethylene, control stomatal aperture (Hetherington and Woodward, 2003; Schroeder et

al., 2001; Pallas and Kays, 1982). It has been demonstrated that phosphoinositide

signalling is involved in regulating stomatal aperture (Schroeder et al., 2001; Lee et al.,

2007). Inhibition of PLC activity reduces stomatal closure (Staxen et al., 1999) and

microinjection of IP3 into guard cells induces stomatal closure (Gilroy et al., 1990).

Moreover, high IP3 levels correlate with closed stomata in the sac9 mutant (Williams et

al., 2005). Since OLD101/FRY1 is involved in IP3 catabolism we measured the effect

of the old101 mutation on stomatal aperture. Air-grown old101 plants maintain partially

closed stomata as compared to the wild type, suggesting that IP3 levels are higher in the

mutant, consistent with the old101 mutation being a partial loss-of-function mutation.

However, ethylene-treated old101 plants show a greater stomatal opening. Here, the

delay in senescence may have an effect on stomatal aperture as well. Thus, the stomatal

phenotype of old101 mutants is consistent with the mutation affecting IP3 turnover.

old101 delays leaf senescence

109

Interestingly, ectopic expression of At5PTase1, which has inositol 5-phosphatase

activity and hydrolyses IP3, results in lower IP3 accumulation and reduced stomatal

aperture in air and greater aperture in response to ABA (Burnette et al., 2003),

demonstrating that lower IP3 levels per se do not necessarily increase stomatal aperture.

Thus, the reduced stomatal aperture in air-grown old101 plants may be a result of a

gain-of-function mutation, rather than a loss-of-function one. Nevertheless, the results

are consistent with the hypothesis that the old101 mutation causes altered IP3

metabolism and resulting changes in stomatal aperture.

The effect of phosphoinositide signalling on leaf senescence

Phospholipid degradation has previously been associated with senescence and cell

death. Acyl hydrolase (SAG101) is involved in lipid degradation and may initiate leaf

senescence in Arabidopsis by facilitating membrane breakdown by attacking the

membrane phospholipids. Subsequent enrichment of free fatty acids in the membrane

ultimately leads to the loss of membrane structural integrity and perturb the bilayer

structure of the membrane (He and Gan, 2002). Moreover, Phopholipase Dα (PLDα)-

antisense plants showed a delayed senescence in detached leaves after ethylene

treatment (Ryu and Wang, 1995; Fan et al., 1997; Zien et al., 2001). Suppression of

cadmium-induced cell death by PLC and ethylene inhibitors indicated that cadmium

might stimulate PLC and initiates the further signalling through increased levels of

ethylene, IP3 and PA (Yakimova et al., 2006; Iakimova et al., 2005). Here we describe a

mutation in an IP3 catabolic enzyme that results in delayed ethylene-induced and

development-induced senescence. Thus these results are consistent with the hypothesis

that phophoinositide signalling may regulate ARCs. How OLD101/FRY1 may regulate

ARCs is not clear at the moment. The old101 mutant has few pleiotropic phenotypes

and therefore it is tempting to speculate that the mutation is a subtle one that specifically

changes the effect of IP3 signalling on ARCs. The results shown here add another

potential function for phosphoinositide signalling in plant development.

Experimental procedures

Plant material and growth conditions

Arabidopsis thaliana ecotype Landsberg erecta (Ler-0) was used as the parental

line throughout this study. The old101 mutant was obtained from an EMS mutagenized

Chapter 4 110

collection (Jing et al., 2002; chapter 2). The Cvi lines LCN2-7 and LCN5-19 were

obtained from Wageningen University (Keurentjes et al., 2007). Plants were grown in a

growth chamber at 21°C, 60% relative humidity under ~60 µmolm-2sec-1 fluorescent

and incandescent light and a day length of 16h. An organic-rich soil (TULIP PROFI

No.4, BOGRO B.V., Hardenberg, The Netherlands) was used for plant growth after

sterilization and drying. Plants for ethylene treatment were transferred to an ethylene

flow-through chamber (AGA, The Netherlands) with a dosage of approximately 10-40

µl/l ethylene for 3 days at 21°C and ~ 50% relative humidity under ~60 µmolm-2sec-1

fluorescent continuous light. For experiments under sterile conditions, seeds were

surface-sterilized by soaking in 20% bleach for 5 min after which they were washed

twice with sterile water and plated on Murashige and Skoog medium solidified with

0.8% agar. For the triple response assay, seedlings were grown on MS media containing

various concentrations of ACC (1- aminocyclopropane-1-carboxylic acid) in the dark

for 5 days (Guzman and Ecker, 1990). The hypocotyl lengths of the seedlings were

subsequently measured as described by Dijkwel et al. (1997).

Leaf physiological measurements

The 3rd and 4th rosette leaves were taken from at least 10 seedlings for all

experiments. For air treated plants, the leaves were collected from plants grown for the

indicated number of days in air. For the ethylene treatment, the plants were treated with

ethylene 4 days before harvest and were subsequently grown for one additional day in

air. For measuring the chlorophyll content, samples were incubated overnight in 80%

(v/v) aceton at 4°C in darkness, and the chlorophyll content quantified

spectrophotometrically using the method of Inskeep and Bloom (1985). For measuring

ion leakage, leaf samples were immersed into deionised carbonate-free water, shaken in

a 25°C water bath for 30 min, and the conductivity was measured using a

Wissenschaftlich Technische Werkstatten conductivity meter (model KLE1/T,

Weilheim, Germany). Samples were subsequently boiled for 10 min and the

conductivity was measured again. The percentage of membrane conductivity was

calculated as the percentage of the first measurement over the second. Chlorophyll

fluorescence emission was measured from the upper surface of the first leaf, at room

temperature (23°C) with a pulse-amplitude modulation portable fluorometer (PAM-

2000; H. Walz, Effeltrich, Germany) according to Maxwell and Johnson (2000). Plants

old101 delays leaf senescence

111

were dark-adapted for 1 to 2 hr before experiments to ensure complete relaxation of the

thylakoid pH gradient. An attached, fully expanded rosette leaf was placed in the leaf

clip, allowing air to circulate freely on both sides of the leaf. At the start of each

experiment, the leaf was exposed to 2 min of far-red illumination (2 to 4 µmol photons

m-2sec-1) for determination of Fo (minimum fluorescence in the dark-adapted state).

Saturating pulses of white light (8000 µmol photons m-2 sec-1) were applied to

determine Fm or Fm' values. PSII efficiency was calculated as (Fm-Fo) /Fm.

For the nitrogen content three replicates of 20-30 leaves each were measured.

Leaves were dried at 80 ºC for 48 hours, and then grounded to a powder using a mortar

and pestle following determination of dry weight. An element analyzer (EuroEA3000-

CHNS0, Italy) was used to measure nitrogen levels.

RNA-isolation and RT-PCR

Plants were grown in air for the indicated amounts of time. For the ethylene

treatment, the plants were treated with ethylene for 3 days before harvest. Total RNA

was isolated using TRIZOL reagents (Sigma) according to the manufacturer's protocol.

Fifteen hundred ng of RNA were used as template for first-strand cDNA synthesis using

200U of RevertAid H-minus MMuLV reverse transcriptase (Fermentas, USA) and an

oligo dT21 primer. Primer pairs for real-time PCR were designed with open-source

PCR primer design program PerlPrimer v1.1.10 (Marshall, 2004). Real-time PCR

amplification was performed with 50 µl of reaction solution, containing 2 µl of 10-fold–

diluted cDNA, 0.5 µl of a 10 mM stock of each primer, 1 µl of 25mM stock MgCl2, 5 µl

PCR buffer +Mg (Roche), 1 µl of a 1000x diluted SYBR-green stock (Sigma), 0.5 µl

100xBSA (New England Biolabs), and 1U of Roche Taq Polymerase. The PCR

program was 2’ at 94, 40x (94-10”/58-10”/72-25”), meltcurve. Obtained data was

analyzed with Biorad software and Biorad excel sheet. The primers used for

amplification of genes SAG12, SAG13, SAG21, CAB, ACC2 and UBQ5 were

PrRuG1387/88, PrRuG1379/80, PrRuG1385/86, PrRuG1423/24, PrRuG1492/93 and

PrRuG1490/91 and will be available upon request.

Cloning of the OLD101 gene

The old101 mutation was identified as explained in chapter 2. For the

complementation of the old101 mutation, the coding region of the OLD101 gene

including 700 bp in front of the start codon was cloned in the pGreen vector (Hellens et

Chapter 4 112

al., 2000). old101 mutant plants were transformed by following the floral dip method

(Clough and Bent, 1998). The presence of the old101 mutation was confirmed by BclI

restriction analysis of a 137bp PCR product of the OLD101 gene. Primers used were

PrRuG2584 (AGCTCGTGTAAATCTTTGATCAAAATCT) and PrRuG2585

(ATCAGCAACGGTCACTGGACTTTGAT). Restriction digestion of the product

resulted in one 137 bp product for old101 DNA and 103 and 24 bp fragments in the case

of Ler-0 DNA. Primers PrRuG557 and PrRuG558 (sequence available upon request)

were used to amplify the Basta resistance gene that is present in the transformed plants.

Measurement of stomatal aperture The leaves were harvested from either 30-day-old air-grown plants, or from plants

with a final age of 30 days that were exposed to ethylene for 24 or 72 hours. The abaxial

side of the leaf was directly placed on mixed casting material, which contains the

identical amounts of light Base and Catalyst Provil novo paste (Heraeus Kulzer GmbH,

Hanau, Germany) (modified method of Weyers and Johansen (1985)). Following

polymerization (after 4-5 minutes), the leaf samples were gently removed and the

imprints in the cast were covered with a thin layer of transparent nail polish. Next, the

transparent, positive, nail polish casts were observed under a light microscope.

Representative photos of the casts were taken and used to determine stomatal apertures

on the basis of their pore widths that were observed by light microscopy (OLYMPUS-

CX41), using a fitted camera ( WATEC, WAT-221S), and measured with a digital ruler

in ImageJ version 10.2 (N.I.H., USA). Twenty random stomata from the 3rd and 4th

rosette leaves were measured in three replicates for each data point.

Acknowledgements

We would like to thank Theo Elzenga from the University of Groningen for his

help with the leaf stomata measurements, Joost Keurentjes from the Wageningen

University for kindly providing the Cvi seeds. Bert Venema and Margriet Ferwerda for

their excellent technical support and Anne de Jong from the University of Groningen for

the use of lab equipment. This work was funded in part by a grant from the Ministry of

Science, Research and Technology of Islamic Republic of Iran to Reza Shirzadian-

Khorramabad.

old101 delays leaf senescence

113

References

A.-H.-Mackerness S., John C.F., Jordan, B. and Thomas, B. (2001) Early signaling components in ultraviolet-B responses: distinct roles for different reactive oxygen species and nitric oxide. FEBS Lett., 489, 237-242.

A.-H.-Mackerness S., Surplus, S.L., Blake, P., John, C.F., Buchanan-Wollaston, V., Jordan, B.R. and Thomas, B. (1999) UV-B induced stress and changes in gene expression in Arabidopsis thaliana: role of signalling pathways controlled by jasmonic acid, ethylene and reactive oxygen species. Plant Cell and Environ., 22, 1413-1424.

Berdy, S., Kudla, J., Gruissem, W. and Gillaspy, G. (2001) Molecular characterization of At5PTase1, an inositol phosphatase capable of terminating IP3 signalling. Plant Physiol., 126, 801-810.

Boyes, D.C., Zayed, A.M., Ascenzi, R., McCaskill, A.J., Hoffman, N.E., Davis, K.R. and Görlach, J. (2001) Growth Stage–Based Phenotypic Analysis of Arabidopsis: A Model for High Throughput Functional Genomics in Plants. Plant

Cell, 13, 1499-1510. Brodersen, P., Petersen, M., Pike, H.C., Olszak, B., Skov, S., Odum, N., Jørgensen,

L.B., Brown, R.E. and Mundy, J. (2002) Knockout of Arabidopsis ACCELERATED-CELL-DEATH11 encoding a sphingosine transfer protein causes activation of programmed cell death and defense. Genes Dev., 16, 490-502.

Burnette, R.N., Gunesekera, B.M. and Gillaspy, G.E. (2003) An Arabidopsis inositol 5-phosphatase gain-of-function alters abscisic acid signaling. Plant Physiol., 132, 1011-1019.

Carland, F.M. and Nelson, T. (2004) Cotyledon vascular pattern 2-mediated inositol (1,4,5) triphosphate signal transduction is essential for closed venation patterns of Arabidopsis foliar organs. Plant Cell, 16, 1263-1275.

Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana, Plant J., 16, 735-743.

Davuluri, R.V., Sun, H., Palaniswamy, S.K., Matthews, N., Molina, C., Kurtz, M. and Grotewold, E. (2003) AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors. BMC Bioinformatics, 4, 25.

Desikan, R., Last, K., Harrett-Williams, R., Tagliavia, C., Harter, K., Hooley, R., Hancock, J.T. and Neill, S.J. (2006) Ethylene-induced stomatal closure in Arabidopsis occurs via AtrbohF-mediated hydrogen peroxide synthesis. Plant J., 47, 907-916.

DeWald, D.B., Torabinejad, J., Jones, C.A., Shope, J.C., Cangelosi, A.R., Thompson, J.E., Prestwich, G.D. and Hama, H. (2001) Rapid accumulation of phosphatidylinositol 4,5-bisphosphate and inositol 1,4,5-trisphosphate correlates with calcium mobilization in salt-stressed Arabidopsis. Plant Physiol., 126, 759-769.

Dijkwel, P.P., Huijser, C., Weisbeek, P.J., Chua, N.H. and Smeekens, S.C.M. (1997) Sucrose control of phytochrome A signalling in Arabidopsis. Plant Cell, 9, 583-595.

Ercetin, M.E. and Gillaspy, G.E. (2004) Molecular characterization of an Arabidopsis gene encoding a phospholipid-specific inositol polyphosphate 5-phosphatase. Plant Physiol., 135, 938-946.

Chapter 4 114

Ewbank, J.J., Barnes, T.M., Lakowski, B., Lussier, M., Bussey, H. and Hekimi, S. (1997) Structural and functional conservation of the Caenorhabditis elegans

timing gene clk-1. Science, 275, 980-983. Fan, L., Zheng, S. and Wang, X. (1997) Antisense Suppression of Phospholipase Da

Retards Abscisic Acid- and Ethylene-Promoted Senescence of Postharvest Arabidopsis Leaves. Plant Cell, 9, 2183-2196.

Fischer A.M. (2007) Nutrient remobilization during leaf senescence. In: Senescence processes In: Gan S., ed. Senescence processes in plants. Oxford: Blackwell Publishing, 87-107.

Gan, S. and Amasino, R.M. (1995) Inhibition of leaf senescence by autoregulated production of cytokinin. Science, 270, 1986-1988.

Gilroy, S., Read, N.D. and Trewavas, A.J. (1990) Elevation of cytoplasmic calcium by caged calcium or caged inositol triphosphate initiates stomatal closure. Nature, 346, 769-771.

Gepstein, S., Sabehi, G., Carp, M. J., Hajouj, T., Nesher, M.F., Yariv, I., Dor, C. and Bassani, M. (2003) Large-scale identification of leaf senescence-associated genes. Plant J., 36, 629-642.

Grbić, V. and Bleecker, A.B. (1995) Ethylene regulates the timing of leaf senescence in Arabidopsis. Plant J., 8, 595-602.

Guzman, P. and Ecker, J. R. (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell, 2, 513-523.

Guo, Y., Cai, Z. and Gan, S. (2004) Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ., 27, 521-549.

Guo, F.Q. and Crawford, N.M. (2005) Arabidopsis nitric oxide synthase 1 is targeted to mitochondria and protects against oxidative damage and dark-induced senescence. Plant Cell, 17, 3436–3450.

Gunesekera, B., Torabinejad, J., Robinson, J. and Gillaspy, G.E. (2007) Inositol polyphosphate 5-phosphatases 1 and 2 are required for regulating seedling growth. Plant Physiol., 143, 1408-1417.

Gy, I., Gasciolli, V., Lauressergues, D., Morel, J. B., Gombert, J., Proux, F., Proux, C., Vaucheret, H. and Mallory, A. C. (2007) Arabidopsis FIERY1, XRN2, and XRN3 are endogenous RNA silencing suppressors. Plant Cell, 19, 3451-3461.

He, Y. and Gan, S. (2002) A gene encoding an acyl hydrolase is involved in leaf senescence in Arabidopsis. Plant Cell, 14, 805-815.

He, Y., Tang, W., Swain, J., Green, A., Jack, T. and Gan, S. (2001) Networking senescence-regulating pathways by using Arabidopsis enhancer trap lines. Plant

Physiol., 126, 707-716. Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S. and Mullineaux, P. M.

(2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol., 42, 819-832.

Hensel, L., Grbić, V., Baumgarten, D.A. and Bleecker, A.B. (1993) Developmental and age related processes that influence the longevity and senescence of photosynthetic tissues in Arabidopsis. Plant Cell, 5, 553-564.

Himelblau, E. and Amasino, R.M. ( 2001) Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence. J. Plant Physiol., 158, 1317-1323.

Hetherington, A.M. and Woodward, F.I. (2003) The role of stomata in sensing and driving environmental change. Nature, 424, 901-908.

old101 delays leaf senescence

115

Iakimova, E., de Jong, A., Kapchina-Toteva, V., Atanassov, A. and Woltering, E. (2005) Involvement of ethylene, oxidative stress and lipid-derived signals in cadmium-induced programmed cell death in tomato suspension cells. BMC Plant

Biol., 5, S19. Inskeep, W.P. and Bloom, P.R. (1985) Extinction coefficients of chlorophyll a and b

in N, Ndimethylformamide and 80% acetone. Plant Physiol., 77, 483-485. Jing, H.C., Sturre, M.J., Hille, J. and Dijkwel, P.P. (2002) Arabidopsis onset of leaf

death mutants identify a regulatory pathway controlling leaf senescence. Plant J., 32, 51-63.

Jing, H.C., Hille, J. and Dijkwel, P.P. (2003) Ageing in plants: conserved strategies and novel pathways. Plant Biol., 5, 455-464.

Jing, H.C., Schippers, J.H.M., Hille, J. and Dijkwel, P.P. (2005) Ethylene-induced leaf senescence depends on age-related changes and OLD genes in Arabidopsis. J. Exp. Bot., 546, 2915-2923.

Jing, H.C., Anderson, L., Sturre, M.J., Hille, J. and Dijkwel, P.P. (2007) Arabidopsis CPR5 is a senescence-regulatory gene with pleiotropic functions as predicted by the evolutionary theory of senescence. J. Exp. Bot., 58, 3885-3894.

Jing, H.C., Hebeler, R., Oeljeklaus, S., Sitek, B., Stuhler, K., Meyer, H.E., Sturre, M.J.G., Hille, J., Warscheid, B. and Dijkwel, P.P. (2008) Early leaf senescence is associated with an altered cellular redox balance in Arabidopsis cpr5/old1 mutants. Plant Biol., In Press.

Jones, M.A., Raymond, M.J. and Smirnoff, N. (2006) Analysis of the root-hair morphogenesis transcriptome reveals the molecular identity of six genes with roles in root-hair development in Arabidopsis. Plant J., 45, 83-100.

Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell, 72, 427-441.

Keurentjes, J.J.B., Bentsink, L., Alonso-Blanco, C., Hanhart, C.J., Vries, H.B. D., Effgen, S., Vreugdenhil, D. and Koornneef, M. (2007) Development of a Near-Isogenic Line Population of Arabidopsis thaliana and Comparison of Mapping Power With a Recombinant Inbred Line Population. Genetics, 175, 891-905.

Kimura, K.D., Tissenbaum, H.A., Liu, Y. and Ruvkun, G. (1997) daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis

elegans. Science, 277, 942-946. Kim, H.J., Ryu, H., Hong, S.H., Woo, H.R., Lim, P. O., Lee, I.C., Sheen, J., Nam,

H.G. and Hwang, I. (2006) Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. Proc. Natl. Acad. Sci.

USA, 103, 814-819. Lee, Y., Kim, Y.W., Jeon, B.W., Park, K.Y., Suh, S.J., Seo, J., Kwak, J.M.,

Martinoia, E., Hwang, I. and Lee, Y. (2007) Phosphatidylinositol 4,5-bisphosphate is important for stomatal opening. Plant J., 52, 803-816.

Leutwiler, L.S., Meyerowitz, E.M. and Tobin, E.M. (1986) Structure and expression of three light-harvesting chlorophyll a/b-binding protein genes in Arabidopsis

thaliana. Nucleic Acids Res., 14, 4051-4064. Liang, X., Abel, S., Keller, J.A., Shen, N.F. and Theologis, A. (1992) The 1-

aminocyclopropane-1-carboxylate synthase gene family of Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA, 89, 11046-11050.

Chapter 4 116

Lim, P.O., Woo, H.R. and Nam, H.G. (2003) Molecular genetics of leaf senescence in Arabidopsis. Trends Plant Sci., 8, 272-278.

Lim, P.O., Kim, H.J. and Nam, H.G. (2007) Leaf senescence. Ann. Rev. Plant Biol., 58, 115-136.

Lin, J.F. and Wu, S.H. (2004) Molecular events in senescing Arabidopsis leaves. Plant

J., 39, 612-628. Lin, W.H., Wang, Y., Mueller-Roeber, B., Brearley, C.A., Xu, Z.H. and Xue, H.W.

(2005) At5PTase13 Modulates Cotyledon Vein Development through Regulating Auxin Homeostasis. Plant Physiol., 139, 1677-1691.

Lohman, K.N., Gan, S.S., John, M.C. and Amasino, R.M. (1994) Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiol. Plant., 92, 322-328.

Marshall, O.J. (2004) PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR. Bioinformatics, 20, 2471-2472.

Maxwell, K. and Johnson, G.N. (2000) Chlorophyll fluorescence – A practical guide.

J. Exp. Bot., 51, 659-668. McCabe, M.S., Garratt, L.C., Schepers, F., Jordi, W.J., Stoopen, G.M., Davelaar,

E., van Rhijn, J.H., Power, J.B. and Davey, M.R. (2001) Effects of p- SAG12:IPT gene expression on development and senescence in transgenic lettuce. Plant Physiol., 127, 505-516.

McKenzie, M.J., Mett, V., Reynolds, P.H.S. and Jameson, P.E. (1998) Controlled cytokinin production in transgenic tobacco using a copper-inducible promoter. Plant Physiol., 116, 969-977.

Miller, J.D., Arteca, R.N. and Pell, E.J. (1999) Senescence-associated gene expression during ozone-induced leaf senescence in Arabidopsis. Plant Physiol., 120, 1015-1023.

Millenaar, F.F., Cox, M.C.H., de Jong van Berkel, Y.E.M., Welschen, R.A.M., Pierik, P., Voesenek, L.A.J.C. and Peeters, A.J.M. (2005) Ethylene-Induced Differential Growth of Petioles in Arabidopsis. Analyzing Natural Variation, Response Kinetics, and Regulation. Plant Physiol., 137, 998-1008.

Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W.H., Liu, Y.X., Hwang, I., Jones, T. and Sheen, J. (2003) Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science, 300, 332-336.

Navabpour, S., Morris, K., Allen, R., Harrison, E., A.-H.-Mackerness, S. and Buchanan-Wollaston, V. (2003) Expression of senescence-enhanced genes in response to oxidative stress. J. Exp. Bot., 54, 2285-2292.

Noh,Y.S. and Amasino, R.M. (1999) Identification of a promoter region responsible for the senescence specific expression of SAG12. Plant Mol. Biol., 41, 181-194.

Oh, S.A., Park, J.H., Lee, G.I., Paek, K.H., Park, S.K. and Nam, H.G. (1997) Identification of three genetic loci controlling leaf senescence in Arabidopsis

thaliana. Plant J., 12, 527-535. Ori, N., Juarez, M.T., Jackson, D., Yamaguchi, J., Banowetz, G.M. and Hake, S.

(1999) Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence-activated promoter. Plant Cell, 11, 1073-1080.

Pallas, J.E. and Kays, S.J. (1982) Inhibition of Photosynthesis by Ethylene-A Stomatal Effect. Plant Physiol., 70, 598-601.

old101 delays leaf senescence

117

Peng, H.P., Lin, T.Y., Wang, N.N. and Shih, M.C. (2005) Differential expression of genes encoding 1-aminocyclopropane-1-carboxylate synthase in Arabidopsis during hypoxia. Plant Mol. Biol., 58, 15-25.

Pourtau, N., Jennings, R., Pelzer, E., Pallas, J. and Wingler, A. (2006) Effect of sugar-induced senescence on gene expression and implications for the regulation of senescence in Arabidopsis. Planta, 224, 556-568.

Quintero, F.J., Garciadeblas, B. and Rodriguez-Navarro, A. (1996) The SAL1 gene of Arabidopsis, encoding an enzyme with 3 (2), 5-bisphosphate nucleotide and inositol poly- phosphate 1-phosphatase activities, increases salt tolerance in yeast. Plant Cell, 8, 529–537.

Riefler, M., Novak, O., Strnad, M. and Schmülling, T. (2006) Arabidopsis cytokinin receptor mutants reveal functions in shoot growth, leaf senescence, seed size, germination, root development and cytokinin metabolism. Plant Cell, 18, 40-54.

Ryu, S.B. and Wang, X. (1995) Expression of Phospholipase D during Castor Bean Leaf Senescence. Plant Physiol., 108, 713-719.

Sanchez, J.P. and Chua, N.H. (2001) Arabidopsis plc1 is required for secondary responses to abscisic acid signals. Plant Cell, 13, 1143-1154.

Schippers, J.H.M., Jing, H.C., Hille, J. and Dijkwel, P.P. (2007) Developmental and hormonal control of leaf senescence. In: Gan S., ed. Senescence processes in plants. Oxford: Blackwell Publishing, 145-170.

Schroeder, J.I., Allen, G.J., Hugouvieux, V., Kwak, J.M. and Waner, D. (2001) Guard cell signal transduction. Annu. Rev. Plant Physiol. Plant Mol. Biol., 52, 627-658.

Staxén, I., Pical, C., Montgomery, L.T., Gray, J.E., Hetherington, A.M. and McAinsh, M.R. (1999) Abscisic acid induces oscillations in guard-cell cytosolic free calcium that involve phosphoinositide-specific phospholipase C. Proc. Natl.

Acad. Sci. USA, 96, 1779-1784. Tsuchisaka, A. and Theologis, A. (2004) Unique and overlapping expression patterns

among the Arabidopsis 1-amino-cyclopropane-1-carboxylate synthase gene family members. Plant Physiol., 136, 2982- 3000.

van der Graaff, E., Schwacke, R., Schneider, A., Desimone, M., Flugge, U.I. and Kunze, R. (2006) Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant

Physiol., 141, 776-792. Wardle, K. and Short, K.C. (1983) Stomatal Responses and the Senescence of Leaves.

Annals of Botany, 52, 411-412. Weaver, L.M., Gan, S.S., Quirino, B. and Amasino, R.M. (1998) A comparison of

the expression patterns of several senescence-associated genes in response to stress and hormone treatment. Plant Mol. Biol., 37, 455-469.

Weyers, J.D.B. and Johansen, L.G. (1985) Accurate estimation of stomatal aperture from silicone rubber impressions. New Phyt., 101, 109-115.

Williams, M.E., Torabinejad, J., Cohick, E., Parker, K., Drake, E.J., Thompson, J.E., Hortter, M. and Dewald, D.B. (2005) Mutations in the Arabidopsis phosphoinositide phosphatase gene SAC9 lead to overaccumulation of PtdIns(4,5)P2 and constitutive expression of the stress-response pathway. Plant

Physiol., 138, 686-700.

Chapter 4 118

Woo, H.R., Chung, K.M., Park, J.H., Oh, S.A., Ahn, T., Hong, S.H., Jang, S.K. and Nam, H.G. (2001) ORE9, an F-box protein that regulates leaf senescence in Arabidopsis, Plant Cell, 13, 1779-1790.

Woo, H.R., Goh, C.H., Park, J.H, Teyssendier de la Serve, B., Kim, J.H., Park, Y.I. and Nam, H.G. (2002) Extended leaf longevity in the ore4-1 mutant of Arabidopsis with a reduced expression of a plastid ribosomal protein gene. Plant

J., 31, 331-340. Woo, H.R., Kim, J.H., Nam, H.G. and Lim, P.O. (2004) The delayed leaf senescence

mutants of Arabidopsis, ore1, ore3, and ore9 are tolerant to oxidative stress. Plant Cell Physiol., 45, 923-932.

Xiong, L., Lee, B.H., Ishitani, M., Lee, H., Zhang, C. and Zhu, J.K. (2001) FIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in Arabidopsis. Genes Dev., 15, 1971-1984.

Xiong, L. and Zhu, J.K. (2002) Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ., 25, 131-139.

Xiong, L., Schumaker, K.S. and Zhu, J.K. (2002) Cell signaling for cold, drought, and salt stresses. Plant Cell, 14, S165-S183.

Xiong, L., Lee, H., Huang, R. and Zhu, J.K. (2004) A single amino acid substitution in the Arabidopsis FIERY1/HOS2 protein confers cold signaling specificity and lithium tolerance. Plant J., 40, 536-545.

Yakimova, E.T., Kapchina-Toteva, V.M., Laarhoven, L.J., Harren, F.M. and Woltering, E.J. (2006) Involvement of ethylene and lipid signalling in cadmium-induced programmed cell death in tomato suspension cells. Plant Physiol.

Biochem., 44, 581-589. York, J.D., Ponder, J.W. and Majerus, P.W. (1995) Definition of a metal-

dependent/Li+-inhibited phosphomonoesterase protein family based upon a conserved three-dimensional core structure. Proc. Natl. Acad. Sci. USA, 92, 5149-5153.

Yoshida, S., Ito, M., Callis, J., Nishida, I. and Watanabe, A. (2002) A delayed leaf senescence mutant is defective in arginyl-tRNA:protein arginyltransferase, a component of the N-end rule pathway in Arabidopsis. Plant J., 32, 129-137.

Zacarias, L. and Reid, M.S. (1990) Role of growth regulators in the senescence of Arabidopsis thaliana leaves. Physiol. Plant., 80, 549-554.

Zhong, R., Burk, D.H., Morrison, W.H. and Ye, Z.H. (2004) FRAGILE FIBER3, an Arabidopsis gene encoding a type II inositol polyphosphate 5-phosphatase, is required for secondary wall synthesis and actin organization in fiber cells. Plant

Cell, 16, 3242-3259. Zhong, R. and Ye, Z.H. (2004) Molecular and biochemical characterization of three

WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana. Plant Cell Physiol., 45, 1720-1728.

Zhu, J.K. (2002) Salt and drought stress signal transduction in plants. Annu. Rev. Plant

Biol., 53, 247-273. Zien, C.A., Wang, C., Wang, X. and Welti, R. (2001) In vivo substrates and the

contribution of the common phospholipase D, PLDalpha, to wound-induced metabolism of lipids in Arabidopsis. Biochim. Biophys. Acta, 1530, 236-248.