Understanding the Learner - Trinity CertTESOL

7/29/2019 Understanding the Learner - Trinity CertTESOL

1/7

TTTTTTTTrrrrrrrriiiiiiiinnnnnnnniiiiiiiittttttttyyyyyyyy CCCCCCCCeeeeeeeerrrrrrrrttttttttiiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaatttttttteeeeeeee iiiiiiiinnnnnnnn TTTTTTTTEEEEEEEESSSSSSSSOOOOOOOOLLLLLLLL

TTTTTTTTrrrrrrrriiiiiiiinnnnnnnniiiiiiiittttttttyyyyyyyy TTTTTTTTEEEEEEEESSSSSSSSOOOOOOOOLLLLLLLL SSSSSSSSttttttttuuuuuuuuddddddddyyyyyyyy RRRRRRRReeeeeeeessssssssoooooooouuuuuuuurrrrrrrrcccccccceeeeeeee nnnnnnnnoooooooo 22222222:::::::: UUnnddeerrssttaannddiinngg tthhee LLeeaarrnneerrAAuugguusstt 22000099

The CertTESOLCertTESOLCertTESOLCertTESOL course is an intense and rewarding learning experienceleading to an international qualification.

You may still be thinking about whether to follow a Trinity course or you mayhave already registered for a particular course. In either case, it will beuseful to you to have some more information about the work involved. Werecommend that you also obtain a copy of the Trinity summary or coursecontent document (available as hard copy or on the Trinity website).

This Study Resource will focus on the learner and introduce you to theUnknown Language component of a course.

Introduction to the Unknown Language component and assignment

Some contrastive features

Reflecting on previous teaching, learning and approaches

Learning styles, affective factors and motivation

THE UNKNOWN LANGUAGE COMPONENTTHE UNKNOWN LANGUAGE COMPONENTTHE UNKNOWN LANGUAGE COMPONENTTHE UNKNOWN LANGUAGE COMPONENT

As part of the Certificate course, you will have four hours total

tuition as a beginner learner of an unfamiliar foreign language andcomplete an assessed Unknown Language Journal.

This will place you in the position of a beginner learner, for you to evaluateyour experiences and to compare and contrast learning with teaching.

You will also look at the lessons from the perspective of a trainee teacherand see in practice some of the methodology and approaches to form andfunction that are introduced in other parts of the course.

You will also be able to apply what you have learnt to your own teaching.


2/7

In the Journal you willIn the Journal you willIn the Journal you willIn the Journal you will describedescribedescribedescribe::::

ObjectivesObjectivesObjectivesObjectives of each lesson: what the teacher wants you to learn in terms of

Grammar - e.g. How to form a question Function e.g. How to exchange telephone numbers Lexis e.g. Vocabulary for describing family membersThe main differences and similaritiesdifferences and similaritiesdifferences and similaritiesdifferences and similarities that you have noticed betweenEnglish and the new language in terms of grammar, pronunciation and lexis.

Did you know thatDid you know thatDid you know thatDid you know that

In grammar Maori has three numbers for pronouns: singular, dual and plural: ia

(he/she), rua(they two), rtou(they 3 or more).

A Swedish question is formed without the use of an auxiliary verb: Var bordu?(Where live you?)

Japanese has subjectobjectverb word order: Watashi wa hako oakemasu(I box open).

In pronunciation English is described as a stress timed language : there is a tendency in

English for stressed syllables to occur at roughly equal intervals of time,regardless of the number of unstressed syllables in between. French,

however, is described as a syllable-timed language and there is moreequal stress on each syllable. This is sometimes called a machine-gunrhythm.

Spanish speakers distinguish between /r/ and /rr/ ("rolled r"): pero(but),perro(dog)

Polish has 8 vowel sounds while English has 20.In lexis The German verb bekommenmeans to get -not to

become. Hence, a German English learner may well sayto a London waiter, I want to become a beefsteak.

The English word gift(= present) may mean eitherpoisonor marriedin the Scandinavian languages,depending on context.

The belief that the Inuit have hundreds of words todescribe snow may just be a hoax!

http://en.wikipedia.org/

What grammar, vocabulary and functions to you think willbe taught in your UL classes?


3/7

Think about your most and least favourite teacher ever.

Were they enthusiastic, encouraging, lively, approachable,positive, flexible, friendly, firm, well prepared, knowledgeable?

Did their eye contact include everyone for questioning, holdingattention, retrieving attention, encouraging contribution,checking understanding?

Did their voices include a good range, variety, projection, and clarity?Were they well matched to their learners?

Did they talk too much, or not enough? Did they tell you the informationor elicit it from you? Did you have a chance to discover meanings,patterns and rules? Were there plenty of opportunities for the learners touse the language in real communication?

Did they use gestures and facial expressions to convey meaning?

Were their instructions simple, clear and checked?

Was their error correction encouraging, helping students tocorrect themselves and each other?

How were the learners seated in a horseshoe, in groups, in pairs or inrows? Did you get to work with different partners? How did this affect theinteraction between teacher and learners and between learners andlearners?

Was the teachers board work organized logically organized for differentpurposes and varied?

Did they use a variety of aids: OHP, pictures, video, recordings, realia?

In the Journal you will descrIn the Journal you will descrIn the Journal you will descrIn the Journal you will describe and reflect on:ibe and reflect on:ibe and reflect on:ibe and reflect on:

Methods and techniquesMethods and techniquesMethods and techniquesMethods and techniques used by the teacher to achieve the objectives Use of materials e.g. worksheets, recordings, pictures, realia Interactive patterns e.g. pair / group work Class management e.g. instructions, correction, encouragement


4/7

How would you describe your previous language classes?

The GrammarThe GrammarThe GrammarThe Grammar----Translation ApproachTranslation ApproachTranslation ApproachTranslation Approach

Classes are taught using the learners' mother tongue forexplanations and translation of meaning. There is a focus onlearning forms, inflections and grammar rules. These arepracticed in exercises but without much use of the language foractive communication.

The Direct ApproachThe Direct ApproachThe Direct ApproachThe Direct Approach

This approach tried to involve more use of the language. Lessons were basedaround a dialogue, and actions and pictures were used to clarify meaning.Exercises consist of questions and answers based on the dialogue. Grammaris taught inductively, so that learners are encouraged to discover it forthemselves through understanding of meaning.

The AudioThe AudioThe AudioThe Audio----Lingual MethodLingual MethodLingual MethodLingual Method

The learners are expected to use target languageautomatically by forming new habits. Vocabulary and

structures are presented in dialogues based on structures,and these are learned through repetition andmemorization. Accurate language is emphasized.Language labs and visual aids are used extensively.

Communicative Language TeachingCommunicative Language TeachingCommunicative Language TeachingCommunicative Language Teaching

In CLT, the aim is for students to become communicatively competent. Innon-scripted, real-life situations, speakers choose what to say and how to sayit, usually interacting in small groups. The belief is that the target languagewill be learned best through the process of struggling to communicate. Errorsare natural and seen as essential for the learning process.

In the UL Journal you will describe and reflect onIn the UL Journal you will describe and reflect onIn the UL Journal you will describe and reflect onIn the UL Journal you will describe and reflect on::::

The nature of the learning experiencelearning experiencelearning experiencelearning experience and specific methods and attitudesthat were more or less helpful to you and others in the group. Here you willinclude comments on your and others' feelings and motivation, and contrastthis with any previous language learning.


5/7

LEARNING STYLESLEARNING STYLESLEARNING STYLESLEARNING STYLES

We all have various approaches or ways of learning (and teaching). This

means we learn better from certain activities or materials, and also enjoythem more or less.

What kind of learner are you?

VisualVisualVisualVisual learners learn best through seeing. They may think inpictures and learn best from visual materials. They prefer to learnfrom reading and often take detailed notes.

AuditoryAuditoryAuditoryAuditory learners tend to listen and talk. They benefit fromlistening to the teacher, taking part in discussions, talking thingsthrough and listening to what others have to say.

KinestheticKinestheticKinestheticKinesthetic learners learn best through movement and action.They prefer to learn by writing, acting out and moving about.

There are numerous tests available on the Internet for working out yourlearning style. It is important to be aware of different learning styles to helpyourself and your students become better learners.

AFFECTIVE FACTORSAFFECTIVE FACTORSAFFECTIVE FACTORSAFFECTIVE FACTORS

Affective factors are emotional factors which influence learning in either apositive or in a negative way. A learner's attitude to the unknown language,to the teacher, to other learners in the group and to him or herself all haveimpact on how well he / she learns.

Negative affective factors are called affective filters. If a learnerhas a high filter they are less likely to engage in language

learning because of shyness, anxiety, boredom etc. Learnersfeel anxious in the classroom for many reasons. They may worryabout the embarrassment of not knowing the answer to theteachers question, or they might be anxious about being askedto perform an action or an oral task in front of the class.

By imaging the worst, based on past learning experiences, I was creatingobstacles to learning even before the first lesson. Activating the targetlanguage through drilling in pair and group work was, for me, a comfortableway to work through errors and overcome a fear of failure.

CertTESOL trainee, February 2009


6/7

Some positive factors may be:

Positive attitude to having a go and making mistakes A sense of success and achievement A genuine interest in the language and the country An outgoing personality and willingness to interact A positive atmosphere and encouragement

Some say that affective factors are as important for successful languagelearning, if not more so, than the ability to learn. Teachers can reducenegative factors and develop positive ones by creating a positive learningenvironment and by choosing activities that are interesting and engaging forthe learners.

I left each lesson with an elated sense of accomplishment and a keen desireto continue.


MOTIVATIONMOTIVATIONMOTIVATIONMOTIVATION

Motivation is essential when it comes to learning anew language. Motivation can be either intrinsic, which

means the learner wants to learn the language forsome internal reward: because they want to becomepart of the L2-speaking community or are genuinelyinterested in the language. Extrinsic motivation refersto a desire to learn the language for an external reward, such as high grades,job opportunities or praise.

The teachers ability to motivate learners is central to good teaching. Partof this involves developing a good teacher-student rapport, and behaving inan engaging and enthusiastic manner. It also means creating a relaxed andsupportive classroom atmosphere in which students can take chances and

feel that they do not risk being ridiculed.

How do you feel about the prospect of doing the UL classes andassignment? Are you interested / worried, excited?

I think it brought us all closer together, so that we are keen to help eachother succeed on the course.



7/7

Your ULYour ULYour ULYour UL Journal willJournal willJournal willJournal will alsoalsoalsoalso includeincludeincludeinclude::::

A summarysummarysummarysummary of the overall experience and what you have learnt about

language teaching and learning from the experience. How will you be able toapply this to your own teaching?

What do you hope to learn from the unknown language classesabout language teaching and learning?

While we all enjoyed the foreign language lessons on a personal level, theexperience was clearly invaluable in terms of raising our awareness asteachers. What can be achieved in just four hours was amazing. But how andwhy that is achieved this experience has given me a very differentperspective on the role of the teacher.


We hope you haveenjoyed this

introduction to the Unknown Language component of the Trinity CertTESOL course.Thank you to Fusion Teaching ([email protected]) for their work on thisTrinity TESOL Study Resource no 2 (August 2009.)

Understanding the Learner - Trinity CertTESOL

Documents

Transcript of Understanding the Learner - Trinity CertTESOL