UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the...

45
UK MRC Human Genome Mapping Project Resource Centre http:// www.hgmp.mrc.ac.uk Jemboss – a Graphical User Interface for the EMBOSS suite of programs

Transcript of UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the...

Page 1: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Jemboss – a Graphical User Interface for the EMBOSS

suite of programs

Page 2: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

EMBOSSCommand line based

Options not obvious – must be remembered

JembossPoint and Click interface

Portable interface – use with PCs, Mac OSX, UNIX

Options listed in program form

Page 3: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

embl:m93650

seqret -sequence em:m93650 -sbegin1 0 -send1 0 -nofirstonly -auto

>HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds

cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca

cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc

Remote server

Local computer

Databases

EMBL

accession =m93650

Page 4: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

EMBOSS applications

Job managerMode

Local file manager

Tool bar

Page 5: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Local file manager

Page 6: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

home directorypreferred directory

Page 7: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 8: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

confirm directory path

Page 9: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

new default directory

Page 10: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

EMBOSS applications

Page 11: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Select appropriate program from the category menus

Page 12: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Selection from alphabetical list, using the “Go To” field

programs are highlighted based unambiguous letters

Page 13: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

input possibilities

calculates nature of sequence and default settings

Page 14: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Database entry in format database:entry

Page 15: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

drag and drop the file into the sequence field

Page 16: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

File (path) now specified

Page 17: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

cut and paste a sequence from elsewhere

Page 18: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Mode

Page 19: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Interactive mode – Jemboss is suspended until program has been completed

Page 20: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

results tab

Page 21: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

input files tab

Page 22: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

command line tab

Page 23: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 24: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Saved file. All graphics files MUST be saved with a .png extension

Page 25: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Job managerMode

Page 26: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 27: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

job status job is processed in the background

Page 28: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

job status

Page 29: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 30: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Results can be saved in exactly the same manner as before.

Note: no command line tab

Page 31: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Tool bar

Page 32: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 33: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

select an application

input file and command line information is displayed

Notes on the experiment or analysis may be saved to the server along with the results

Page 34: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 35: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 36: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 37: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Disable parameters by shading (selected) or removing them (deselected)

Auto-refresh. More often for slower connection, less often for a faster connection.

Alteration of default home directory path setting

Page 38: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 39: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

The server settings and environment information should be the same

Page 40: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 41: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Default output for Jemboss is fasta format, so this may have to be altered

This third party software has also been incorporated into Jemboss

Page 42: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 43: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

This is the beginnings of a project management system.

Page 44: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

Page 45: UK MRC Human Genome Mapping Project Resource Centre  Jemboss – a Graphical User Interface for the EMBOSS suite of programs.

UK MRC Human Genome Mapping Project Resource Centre

http://www.hgmp.mrc.ac.uk

The version should always be reported if there are any problems with the program

brief user guide