UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the...
-
Upload
cecil-ball -
Category
Documents
-
view
217 -
download
0
Transcript of UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the...
![Page 1: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/1.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Jemboss – a Graphical User Interface for the EMBOSS
suite of programs
![Page 2: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/2.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
EMBOSSCommand line based
Options not obvious – must be remembered
JembossPoint and Click interface
Portable interface – use with PCs, Mac OSX, UNIX
Options listed in program form
![Page 3: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/3.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
embl:m93650
seqret -sequence em:m93650 -sbegin1 0 -send1 0 -nofirstonly -auto
>HSPAX6AN M93650 Human paired box gene (PAX6) homologue, complete cds
cagaggtcaggcttcgctaatgggccagtgaggagcggtggaggcgaggccggcgccgca
cacacacattaacacacttgagccatcaccaatcagcataggaatctgagaattgctctc
Remote server
Local computer
Databases
EMBL
accession =m93650
![Page 4: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/4.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
EMBOSS applications
Job managerMode
Local file manager
Tool bar
![Page 5: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/5.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Local file manager
![Page 6: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/6.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
home directorypreferred directory
![Page 7: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/7.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 8: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/8.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
confirm directory path
![Page 9: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/9.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
new default directory
![Page 10: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/10.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
EMBOSS applications
![Page 11: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/11.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Select appropriate program from the category menus
![Page 12: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/12.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Selection from alphabetical list, using the “Go To” field
programs are highlighted based unambiguous letters
![Page 13: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/13.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
input possibilities
calculates nature of sequence and default settings
![Page 14: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/14.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Database entry in format database:entry
![Page 15: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/15.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
drag and drop the file into the sequence field
![Page 16: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/16.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
File (path) now specified
![Page 17: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/17.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
cut and paste a sequence from elsewhere
![Page 18: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/18.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Mode
![Page 19: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/19.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Interactive mode – Jemboss is suspended until program has been completed
![Page 20: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/20.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
results tab
![Page 21: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/21.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
input files tab
![Page 22: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/22.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
command line tab
![Page 23: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/23.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 24: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/24.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Saved file. All graphics files MUST be saved with a .png extension
![Page 25: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/25.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Job managerMode
![Page 26: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/26.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 27: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/27.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
job status job is processed in the background
![Page 28: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/28.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
job status
![Page 29: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/29.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 30: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/30.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Results can be saved in exactly the same manner as before.
Note: no command line tab
![Page 31: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/31.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Tool bar
![Page 32: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/32.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 33: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/33.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
select an application
input file and command line information is displayed
Notes on the experiment or analysis may be saved to the server along with the results
![Page 34: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/34.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 35: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/35.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 36: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/36.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 37: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/37.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Disable parameters by shading (selected) or removing them (deselected)
Auto-refresh. More often for slower connection, less often for a faster connection.
Alteration of default home directory path setting
![Page 38: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/38.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 39: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/39.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
The server settings and environment information should be the same
![Page 40: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/40.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 41: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/41.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
Default output for Jemboss is fasta format, so this may have to be altered
This third party software has also been incorporated into Jemboss
![Page 42: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/42.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 43: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/43.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
This is the beginnings of a project management system.
![Page 44: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/44.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
![Page 45: UK MRC Human Genome Mapping Project Resource Centre Jemboss – a Graphical User Interface for the EMBOSS suite of programs.](https://reader033.fdocuments.us/reader033/viewer/2022051316/5697bf831a28abf838c8638b/html5/thumbnails/45.jpg)
UK MRC Human Genome Mapping Project Resource Centre
http://www.hgmp.mrc.ac.uk
The version should always be reported if there are any problems with the program
brief user guide