Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary...

32
Tutorial 11 RNA Structure Prediction

  • date post

    18-Dec-2015

  • Category

    Documents

  • view

    222

  • download

    1

TAGS:

Transcript of Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary...

Page 1: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Tutorial 11

RNA Structure Prediction

Page 2: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNA Structure Prediction

• Rfam – RNA structures database

• RNAfold – RNA secondary structure prediction

• tRNAscan – tRNA prediction

• TargetScan – microRNA prediction

Page 3: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNA secondary structure types

Page 4: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Rfam

• The Rfam database is a collection of RNA families, each represented by multiple sequence alignments and consensus secondary structures.

http://rfam.sanger.ac.uk/

Page 5: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Rfam

Different search modes

http://rfam.sanger.ac.uk/

Page 6: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Search Rfam

Page 7: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

The secondary structure

Page 8: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

:::::: free extremes((())) Stem<<<>>> Internal Stem______ Loop,,,,,, Internal loop

Structure representations

Page 9: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNA secondary structure prediction

GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA

Page 10: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNA structure prediction by Vienna RNA package

RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences.

RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment.

RNAinverse server design RNA sequences for any desired target secondary structure.

Page 11: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.
Page 12: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAfold

• Gives best stabilized structure (structure with minimal free energy (MFE))

• uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule (partition function algorithm).

Page 13: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAfold - input

RNA sequence

Page 14: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Minimal free energy structure

Frequency of the structure

RNAfold - output

Sequence-Structure alignment

Best “average” structure

Page 15: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Graphic representation

Coloring options

Page 16: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Minimal free energy

Folding Probabiliy

Mountain Plot

• A mountain plot represents a secondary structure in a plot of height versus position.

• The height m(k) is given by the number of base pairs enclosing the base at position k.

• Loops correspond to plateaus and stems correspond to slopes.

• The closer the two curves, the better defined the structure.

centroid

Entropy

Page 17: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAfold structure representations

Page 18: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAalifold - input

Alignment

Page 19: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAalifold - output

Page 20: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAinverse - input

Page 21: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

RNAinverse - output

Page 22: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

tRNAscan

• Detection of tRNA genes in raw genomic sequence orother types of sequence inputs.

http://lowelab.ucsc.edu/tRNAscan-SE/

Page 23: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Sequence

tRNAscan - input

Page 24: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

tRNAscan - results

Page 25: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

http://trna.nagahama-i-bio.ac.jp/

Page 26: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

MicroRNA - reminder

Page 27: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

• Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs.• Find conserved 8mer and 7mer sites that match the seed region of each miRNA. • Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites

Page 28: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.
Page 29: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.
Page 30: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.
Page 31: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Mir 31 - broadly conserved* microRNA

* conserved across most vertebrates, usually to zebrafish

Page 32: Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Mir 136 - conserved* microRNA

* conserved across most mammals, but usually not beyond placental mammals


RNA 3D Structure Prediction: (1) Assessing RNA 3D ... · Keywords: RNA 3D structure, RNA 2D structure, structure prediction 1 Introduction In recent years the authors have been involved

RNA 3D Structure Prediction: (1) Assessing RNA 3D ... · Keywords: RNA 3D structure, RNA 2D structure, structure prediction 1 Introduction In recent years the authors have been involved

RNA and Protein Structure Prediction Bioinformatics ...lopresti/Courses/2007-08/CSE308... · RNA and Protein Structure Prediction. CSE 308-408 · Bioinformatics: Issues and Algorithms

RNA and Protein Structure Prediction Bioinformatics ...lopresti/Courses/2007-08/CSE308... · RNA and Protein Structure Prediction. CSE 308-408 · Bioinformatics: Issues and Algorithms

RNA Secondary Structure Prediction - Undergraduate Courses

RNA Secondary Structure Prediction - Undergraduate Courses

Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.

Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.

RNA-RNA interaction A biological crash course and introduction to prediction methods.

RNA-RNA interaction A biological crash course and introduction to prediction methods.

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction.

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction.

RNA structure prediction. RNA functions RNA functions as –mRNA –rRNA –tRNA –Nuclear export –Spliceosome –Regulatory molecules (RNAi) –Enzymes –Virus –Retrotransposons.

RNA structure prediction. RNA functions RNA functions as –mRNA –rRNA –tRNA –Nuclear export –Spliceosome –Regulatory molecules (RNAi) –Enzymes –Virus –Retrotransposons.

RNA Structure Prediction and Comparison Session 14 Exkurs: The

RNA Structure Prediction and Comparison Session 14 Exkurs: The

Research Article Characteristics and Prediction of RNA …Research Article Characteristics and Prediction of RNA Structure HengwuLi, 1,2 DamingZhu, 3 CaimingZhang, 3 HuijianHan, 1

Research Article Characteristics and Prediction of RNA …Research Article Characteristics and Prediction of RNA Structure HengwuLi, 1,2 DamingZhu, 3 CaimingZhang, 3 HuijianHan, 1

RNA: Secondary Structure Prediction and Analysis

RNA: Secondary Structure Prediction and Analysis

A Method for RNA Structure Prediction Shows Evidence for ...s.tartaglialab.com/static_files/shared/DelliPonti_2018.pdfTartaglia GG (2018) A Method for RNA Structure Prediction Shows

A Method for RNA Structure Prediction Shows Evidence for ...s.tartaglialab.com/static_files/shared/DelliPonti_2018.pdfTartaglia GG (2018) A Method for RNA Structure Prediction Shows

Characterisation of RNA in milk and prediction of microRNA …dro.deakin.edu.au/.../kumar-characterisation-2014A.pdf · Characterisation of RNA in milk and prediction of microRNA

Characterisation of RNA in milk and prediction of microRNA …dro.deakin.edu.au/.../kumar-characterisation-2014A.pdf · Characterisation of RNA in milk and prediction of microRNA

DNA, RNA, Protein Structure Prediction - Aalto · on from generation to ... dependent letter-probability matrices which describe the probability ... DNA, RNA, Protein Structure Prediction.

DNA, RNA, Protein Structure Prediction - Aalto · on from generation to ... dependent letter-probability matrices which describe the probability ... DNA, RNA, Protein Structure Prediction.

RNA structure prediction using positive and negative ...

RNA structure prediction using positive and negative ...

RNA secondary structure prediction from multi-aligned ... · (a) Secondary structure prediction (b) Common secondary structure prediction common RNA secondary structures. These will

RNA secondary structure prediction from multi-aligned ... · (a) Secondary structure prediction (b) Common secondary structure prediction common RNA secondary structures. These will

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction

Improving Free Energy Functions for RNA Folding RNA Secondary Structure Prediction.

Improving Free Energy Functions for RNA Folding RNA Secondary Structure Prediction.

Rna Structure Prediction Algorithms

Rna Structure Prediction Algorithms

RNA Structure Prediction & Dabase Searchturcotte/teaching/bnf-5106/2013-10-21_MTurcotte.pdfMarcel Turcotte RNA Structure Prediction & Dabase Search. Preamble Introduction Inference

RNA Structure Prediction & Dabase Searchturcotte/teaching/bnf-5106/2013-10-21_MTurcotte.pdfMarcel Turcotte RNA Structure Prediction & Dabase Search. Preamble Introduction Inference

Structure Prediction Structure Probabilities RNA Structure ... · Structure Prediction Structure Probabilities Prediction of RNA (Secondary) Structure De nition (Problem of RNAnon-crossingSecondary

Structure Prediction Structure Probabilities RNA Structure ... · Structure Prediction Structure Probabilities Prediction of RNA (Secondary) Structure De nition (Problem of RNAnon-crossingSecondary