Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA...

35
Tutorial 11 RNA Structure Prediction

TAGS:

Transcript of Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA...

Page 1: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Tutorial 11

RNA Structure Prediction

Page 2: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNA Structure Prediction

• Introduction – RNA secondary structure• RNAfold – RNA secondary structure

prediction• TargetScan – microRNA prediction

Cool story of the day:How viruses use miRNAs to attack humans

Page 3: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

About RNA…

Page 4: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNA secondary structure

Page 5: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

3D perspective

Page 6: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNA secondary structure types

stem

Page 7: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

:::::: free extremes((())) Stem<<<>>> Internal Stem______ Loop,,,,,, Internal loop

Structure representations

Directionality

Page 8: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNA secondary structure prediction

GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA

Base pair probability

Page 9: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNA structure prediction by Vienna RNA package

RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences.

RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment.

RNAinverse server design RNA sequences for any desired target secondary structure.

Page 10: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

http://rna.tbi.univie.ac.at/

Page 11: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAfold

• Gives best stabilized structure (structure with minimal free energy (MFE))

• Uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule.

Page 12: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAfold - input

RNA sequence

Page 13: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Minimal free energy structure

Frequency of the structure

RNAfold - output

Structure prediction

Best “average” structure

Page 14: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Graphic representation

MFE structure

An average, may not exist in the ensemble

Page 15: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAalifoldStructure prediction based on alignments

Alignment

Page 16: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAalifold - output

Page 17: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Understanding the color scheme

http://www.almob.org/content/pdf/1748-7188-6-26.pdf

C-GU-A

C-GG-CU-AA-U

Lighter color

Page 18: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAinverse

• Find sequences that match a structure.

• Binding in RNA is based a lot on the structure,

and not only the sequence.

• Helps identify a function.

Page 19: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAinverse - input

Page 20: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

RNAinverse - output

Page 21: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

MicroRNA

• May reside in host genes or in intragenic region.

• The RNA structure of the hairpins in a pri-miRNA is recognized by the proteins.

Page 22: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

• Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs.

• Find conserved 8mer and 7mer sites that match the seed region of each miRNA.

• Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites.

http://www.targetscan.org/

Page 23: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.
Page 24: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.
Page 25: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

More negative scores represent a more favorable site

The stability of of a miRNA-target duplex

A score reflecting the probability that a site is conserved due to selective maintenance of miRNA targeting rather than by chance or any other reason.

Sum of phylogenetic branch lengths between species that contain a site

Page 26: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.
Page 27: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Mir 31 - broadly conserved* microRNA

* conserved across most vertebrates, usually to zebrafish

Page 28: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Mir 136 - conserved* microRNA

* conserved across most mammals, but usually not beyond placental mammals

Page 29: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Cool Story of the day

How viruses use miRNAs to attack humans?

Page 30: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

“…We developed an algorithm for the prediction of miRNA targets and applied it to human cytomegalovirus miRNAs…”

Page 31: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Viruses

Page 32: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

• Human cytomegalovirus (HCMV) is known to have evolved effective immune evasion strategies.

• RepTar has its basis in the observation that miRNA binding sites can repeat several times in the target’s 3 UTR (1). It therefore searches for repetitive ′elements in each 3 UTR sequence and evaluates ′these elements as potential miRNA binding sites.

• This algorithm is independent of evolutionary conservation of the binding sites.

Page 33: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

MICB, an immunorelated gene, was among the highest ranking predicted targets and the top prediction for hcmv-miR-UL112.

Page 34: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

Natural Killer (NK) cells• NK cells are cytotoxic lymphocyte that kill virus-infected cells

and tumor cells.• In order to function they should be activated through

receptors. One of these is NKG2D.• MICB is a stress-induced ligand of NK cells through the NKG2D

receptor).

Cerwenka et al. Nature Reviews Immunology 2001

Page 35: Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction.

“…We show that hcmv-miR-UL112 specifically down-regulates MICB expression during viral infection, leading to decreased binding of NKG2D and reduced killing by NK cells…”

“Our results demonstrate a novel miRNA-based evasion strategy used by HCMV, in which a viral miRNA directly down-regulates a host immune defense gene.


RNA and Protein Structure Prediction Bioinformatics ...lopresti/Courses/2007-08/CSE308... · RNA and Protein Structure Prediction. CSE 308-408 · Bioinformatics: Issues and Algorithms

RNA and Protein Structure Prediction Bioinformatics ...lopresti/Courses/2007-08/CSE308... · RNA and Protein Structure Prediction. CSE 308-408 · Bioinformatics: Issues and Algorithms

RNA secondary structure prediction€¦ · Main approaches to RNA secondary structure prediction • Energy minimization –dynamic programming approach –does not require prior

RNA secondary structure prediction€¦ · Main approaches to RNA secondary structure prediction • Energy minimization –dynamic programming approach –does not require prior

DNA/Protein structure-function analysis and prediction Lecture 12: DNA/RNA structure.

DNA/Protein structure-function analysis and prediction Lecture 12: DNA/RNA structure.

Rna Structure Prediction Algorithms

Rna Structure Prediction Algorithms

Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.

Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.

Class 5: RNA Structure Prediction

Class 5: RNA Structure Prediction

RNA Secondary Structure Prediction Using Neural Machine ...

RNA Secondary Structure Prediction Using Neural Machine ...

RNA Secondary Structure Prediction - Undergraduate Courses

RNA Secondary Structure Prediction - Undergraduate Courses

C omputational ncRNA gene finding (& nc RNA structure prediction)

C omputational ncRNA gene finding (& nc RNA structure prediction)

RNA Secondary Structure Prediction Dynamic Programming Approaches Sarah Aerni

RNA Secondary Structure Prediction Dynamic Programming Approaches Sarah Aerni

RNA secondary structure prediction from multi-aligned ... · (a) Secondary structure prediction (b) Common secondary structure prediction common RNA secondary structures. These will

RNA secondary structure prediction from multi-aligned ... · (a) Secondary structure prediction (b) Common secondary structure prediction common RNA secondary structures. These will

Chapter 7 RNA and Protein Structure: Structure Prediction.

Chapter 7 RNA and Protein Structure: Structure Prediction.

RNA Structure Prediction & Dabase Searchturcotte/teaching/bnf-5106/2013-10-21_MTurcotte.pdfMarcel Turcotte RNA Structure Prediction & Dabase Search. Preamble Introduction Inference

RNA Structure Prediction & Dabase Searchturcotte/teaching/bnf-5106/2013-10-21_MTurcotte.pdfMarcel Turcotte RNA Structure Prediction & Dabase Search. Preamble Introduction Inference

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction.

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction.

Turbo-Decoding of RNA Secondary Structure€¦ · RNA Structure Analysis: Motivation and Background RNA, noncoding RNA, RNA structure and its significance RNA structure prediction

Turbo-Decoding of RNA Secondary Structure€¦ · RNA Structure Analysis: Motivation and Background RNA, noncoding RNA, RNA structure and its significance RNA structure prediction

RNA SECONDARY STRUCTURE PREDICTION TOOL

RNA SECONDARY STRUCTURE PREDICTION TOOL

Improving Free Energy Functions for RNA Folding RNA Secondary Structure Prediction.

Improving Free Energy Functions for RNA Folding RNA Secondary Structure Prediction.

CS5263 Bioinformatics RNA Secondary Structure Prediction.

CS5263 Bioinformatics RNA Secondary Structure Prediction.

C omputational ncRNA gene finding (& nc RNA structure prediction) Liming Cai (BINF8210@UGA, Fall 2010) nc RNA structure prediction (& computational ncRNA.

C omputational ncRNA gene finding (& nc RNA structure prediction) Liming Cai (BINF8210@UGA, Fall 2010) nc RNA structure prediction (& computational ncRNA.

RNA-Puzzles Round II: assessment of RNA structure prediction programs applied to · PDF file · 2017-05-18RNA-Puzzles Round II: assessment of RNA structure prediction programs applied

RNA-Puzzles Round II: assessment of RNA structure prediction programs applied to · PDF file · 2017-05-18RNA-Puzzles Round II: assessment of RNA structure prediction programs applied