Tuesday, August 16 Biology – the study of life Warm-Up: For each of the groups of words below,...

Tuesday, August 16 Biology – the study of life Warm-Up: For each of the groups of words below,

determine the meaning of the prefix/suffix Ex: tripod, triangle, trimester, tri = 3 Biology, Biosphere, Biome Biology, Geology, Sociology, Criminology Cardiology, Cardiac, Cardiovascular

Objective: Today we will use a worksheet to relate previous knowledge to Latin roots.

Wednesday, August 17

Biosphere – living things and everywhere on earth where they live

Warm-Up: Determine what the following words are in English

Objective: Today we will use our knowledge of word meanings to determine the Latin root meaning.

Language Word 1 Word 2 Word 3

Japanese Inu Neko Saiensu

German Hund Katze Wissenschaft

Latin Canis Feles Scientiae

Thursday, August 18

Antigen – a marker on a foreign body that causes an immune response

Warm-Up: For each Latin root, draw a picture to represent the meaning Bi- Glyc- hyper- Audi- -emia ex-/exo-

Objective: Today we will use a worksheet to apply the meanings of Latin roots.

Friday, August 19Trophic – feeding level of an organismWarm-Up: Determine a meaning for each word

below based on the Latin root meanings Neuropathology Hydrolysis Glycolysis Phototropism

Objective: Today we will become familiar with the resources in our book using a book tour WS.

Monday, August 22Homeostasis – maintenance of constant

internal conditionsWarm-Up:

How does the word today relate to the Latin root meaning?

For each meaning, give the Latin root To eat double Cell come together Single around

Objective: Today we will play Pictionary to review Latin root meanings.


Scientific method: a method of investigation involving observation and theory to test scientific hypotheses

Warm-Up: What does it mean to be independent? Dependent?

Objective: Today we will use examples and a worksheet to distinguish between independent and dependent variables in a lab.

Thursday, August 25

1) Obtain sample of unknown liquid. Note physical properties such as odor, viscosity and/or color.

2) Record the mass of clean, dry 10.00mL volumetric flask and stopper.

3) Carefully transfer unknown liquid to volumetric flask. Fill to mark exactly in stopper flask.

4) Measure mass of filled flask.

5) Empty and dry flask.6) Repeat step 2-5 for

additional liquid sample.

• Hypothesis: proposed answer to a scientific question

• Warm-Up: Come up with 2 to 3 sources of error in this experiment

Objective: Today we will distinguish between different graphs using an M&M graphing activity and PPT.

Friday, August 26 Independent Variable: the condition that is manipulated or

changed by the researcher Read the example and determine the independent variable,

dependent variable, and control (if any). A researcher wanted to know whether the number of

people present (10, 25, or 50) would influence subjects' judgments on a simple perceptual task. In each case the other members of the group gave an incorrect answer. The researcher then noted whether the subject conformed to the group decision.

Objective: Today we will use the information we have learned about labs and our books to design a lab.

Monday, August 29Theory: a proposed explanation for a wide

range of observation and experimental results that is supported by evidence

Warm-Up: On a separate sheet of paper, write an introduction for the soap bubbles lab. The introduction should include: What are we showing in the lab/the purpose? How are we going to do the lab? What do you already know about dish soap/bubbles that might

help you in the lab?Objective: Today we will apply the scientific

method through our lab report

Tuesday, August 30

Dependent Variable: the condition that is measured or observed in an experiment

Warm-Up: Bart is testing to see what type of noise scares Lisa the most. He chooses noises and then at times she is least suspecting blares one really loud and looks at how high she jumps. What would be the independent variable? Dependent? What would be something that could be a constant/control?

Objective: Today we will distinguish between independent and dependent variables using our quiz.


Biotechnology: the use and application of living things and biological processes

Warm-Up: How might Biology today be different

than in 1811? 1911? 1991?Objective: Today we will discuss themes

in Biology and living organisms using discussion and PPT notes.

Thursday, September 1

Element: any material made up of only one type of atom

Warm-Up: Give an example of how structure is related to

the function of things. What characteristics are shared by all living

things?Objective: Through your notes, differentiate

between theories and hypothesis and explain how technology has changed biology.

Tuesday, September 6

Compound: atoms of different elements bonded togetherWarm-Up:

If plants can make their own food using the sun, why might this plant eat a frog?

Objective: Today we will discuss properties of molecules, focusing on water, using our notes.

Wednesday, September 7

Polar: compounds with slightly charged regionsWarm-Up:

Explain the difference between acids and bases List and describe the 3 properties of water created

by hydrogen bondingObjective: Today we will do a lab to investigate the

properties of water and difference between acids and bases.


Organic: characteristic of, pertaining to, or derived from living organisms

Warm-Up: Cells have a higher H+ concentration than

blood. Which has a higher pH? Why? Why are hydrogen bonds so important for

water?Objective: Today we will create a poem based on

the properties of water and pH.

Friday, September 9Catalyst: substance that speeds up

chemical reactionsObjective: Today we will create a poem

based on the properties of water and pH

Monday, September 12

Substrate: specific reactants an enzyme acts onWarm-Up:

What do you think is the pH of your blood? Why?

Why is water so important for living things?Objective: Today we will compare and contrast

the 4 carbon based molecules using a Venn Diagram and notes.


Enzyme – protein that speeds up reactions in living organisms

Warm-Up: What is one similarity between the 4

carbon based molecules? What is unique about each of the four?

Objective: Today we will simulate enzymes working using our toothpick lab.


Endothermic: chemical reaction that absorbs more energy than it releases

Warm-Up: Why is temperature important for

proteins? What happened to your rate of reaction

during the 3 minutes of breaking toothpicks? Why do you think that happened?

Objective: Today we will explain how enzymes function using a lab report and notes.


Exothermic – reaction that releases more energy than it absorbs

Warm-Up: Explain how monomers and polymers are related Give 2 examples of monomers and polymers

Objective: Today we will use a WS and study guide to review information on biochemistry and the basics of biology.


Prokaryotic: cells without a nucleus or membrane bound organelles

Warm-Up: How does the size of a cell in a tadpole compare to

the size of a cell in a blue whale? What makes a whale so much larger than a tadpole?

Objective: Today we will compare and contrast prokaryotic and eukaryotic cells using our notes and Venn Diagram


Eukaryotic: cells with a nucleus and membrane bound organelles

Warm-Up: Give an example of a prokaryotic and eukaryotic

cell. What do all cells have in common?

Objective: Today we will explain the function of organelles using our notes and an analogy.


Organelle: structures specialized to perform distinct processes within a cell

Warm-Up: Give the function for each organelle below Mitochondria Lysosome Chloroplast Ribosome Nucleus

Objective: Today we will create analogies that represent the organelles in a cell using our knowledge from the notes and books.


Golgi apparatus: processes and packages proteins

Warm-Up: My cell is like a country, which organelles would each of the following be… Government/Constitution Sanitation Department Highways Power Plants Solar Power Plants Customs Officials/Border Patrol

Objective: Today we will study how organelles work and what they looks like using a Cell WebQuest.


Mitochondria: supply energy to the cellWarm-Up: Starting in the nucleus, place the

structures in order to get a finished protein. Golgi Apparatus Endoplasmic Reticulum Nuclear Pores Vesicle Ribosome Cell Membrane

Objective: Today we will use a lab mystery to distinguish between plant and animal cells under the microscope.


Selective permeability: only certain things are allowed to pass through

Warm-Up: What property do water molecules have? What are some things you can use to distinguish

between plant and animal cells?Objective: Today we will describe the

structure of a cell membrane and how things move across it using our notes.


Diffusion: movement of molecules in a fluid or gas from a region of higher concentration to a region of lower concentration

Warm-Up: Draw the structure of the cell membrane. Why does the fluid mosaic model apply to the cell

membrane?Objective: Today we will explain the

difference between active and passive transport using our notes and review questions.


ATP: molecule that transfers energy from the breakdown of food molecules to cell processes

Warm-Up: What are 3 differences between active and passive

transport? Give an example of each.

Objective: Today we will observe and analyze the functioning of organelles through our lab.

Monday, October 3Concentration gradient – difference in

concentration of a substance from one location to another

Warm-Up:Explain how the following terms are related Eukaryotic and prokaryotic Diffusion, facilitated diffusion Phospholipid, cell membrane

Objective: Today we will review key concepts about Cells using our Review WS.

Monday, October 10Objective: Today

we will explain how we get energy from foods using our notes and white boards.

Warm-Up: What cellular

activities require energy?

Do energy drinks and power bars do something different from any other food that you eat?

Monday, October 8Chemosynthesis: use of

chemical energy instead of light energy to make energy-storing molecules

Warm-Up: What does a producer do

in film, radio, tv, etc? How does that relate to

plants being considered producers?

Objective: Today we will explain photosynthesis using a diagram and lecture notes.

Friday, October 12 Place the numbered items in the

order they would occur during photosynthesis:

1. Water molecules are broken down

2. Energy from NADPH and ATP is transferred to the Calvin cycle

3. Sunlight is absorbed by chlorophyll

4. Carbon dioxide is converted into glucose

5. Oxygen is given off as a waste product

ATP synthase: enzyme that adds a phosphate group to ADP

Objective: Today we will analyze photosynthesis using our pictorial and summary questions.

Friday, October 14Producer: organism that creates its own

chemical energyWarm-Up:

Why did only the chloroplasts in light change color in yesterday’s lab?

If there are other pigments of different colors, why are plants typically green?

Objective: Today we will explain how cellular respiration works using notes and a diagram.

Tuesday, October 16

Fermentation: process that allows glycolysis to continue without oxygen

Warm-Up: What goes into and comes out of the light

dependent reactions? Where do they take place?

What goes into and comes out of the light independent reactions? Where do they take place?

Objective: Today we will explain cellular respiration using our notes and drawings.

Wednesday, October 17

Aerobic: requiring oxygenFill in the table:

Objective: Today we will contrast what happens with and without oxygen using our notes..

Process Goes In Comes Out

Glycolysis

Krebs Cycle

Electron Transport Chain

Thursday, October 18

Cellular respiration: process that releases chemical energy from sugars to make ATP

Warm-Up: What type of cells use cellular respiration? What is the oxygen used for in cellular

respiration?

Objective: Today we will evaluate photosynthesis and respiration using our writing prompts.

Thursday, October 20 Warm-Up:

Cancer cells are considered immortal, what do you think that means?

What can you infer about how cell division in a normal cells, then, compares to cell division in a cancer cell?

Objective: Today we will demonstrate what stem cells are and how they can be used using our Stem Cell Activity online.

Tuesday, October 23Cell Cycle: regular pattern of growth, DNA

duplication, and cell division that occurs in eukaryotic cells

Warm-Up: What do you think is the life span for the following cells? Skin cells, red blood cells, liver cells, intestine lining,

intestine muscleObjective: Today we will describe the

stages of the cell cycle using notes and questions.

Wednesday, October 24

Mitosis: division of the cell nucleusWarm-Up:

Briefly explain what happens in each step of interphase.

Objective: Today we will trace the steps of the cell cycle using notes and a foldable cell.

Thursday, October 25

Cytokinesis: division of the cytoplasmWarm-Up:

What makes you who you are?Why are your kidney cells and heart cells different?

Objective: Today we will create skits to demonstrate the process of mitosis.

Monday, October 29Chromosome: long continuous thread of

DNA that has numerous genes and regulatory information

Warm-Up: What is a stem cell? Why might they be important for scientific research?

Objective: Today we will explain what stem cells are and how they are used by summarizing our activities.

Tuesday, October 30Tissue – groups of cells that work together

to perform a specific functionWarm-Up: Grab your device for the Mitosis

QuizObjective: Today we will discuss asexual

reproduction using our notes and discussion.

Friday, October 28Organ – group of tissues that work

together to perform related functionsWarm-Up:

Describe 3 types of asexual reproduction. When is it beneficial to use asexual reproduction?

Objective: Today we will review key concepts about cells using a practice test.

Monday, October 31

Somatic Cells – body cellsWarm-Up: Halloween Trivia

Best selling candy?How much $ is spent on candy each year in the US?

What percent of kids go trick or treating or do some Halloween activity?

Objective: Today we will review cells using a study guide and word connections.

Friday, November 2Gamete – sex cells; sperm and eggWarm-Up:

How are sex cells (sperm and egg) different than other cells?

What role do sex cells play in humans?

Objective: Today we will compare mitosis and meiosis and explain the steps of meiosis through our notes and video.

Tuesday, November 6Diploid: a cell that contains two copies of each

chromosomeWarm-Up: Fill in the Venn Diagram comparing

gametes and somatic cellsObjective: Today we will compare mitosis and

meiosis and simulate meiosis using our activity.

Gametes

Somatic Cells

Wednesday, November 7

Haploid: cell containing only one copy of each chromosome

Warm-Up: Going into meiosis I, how many

chromosomes are there in a human sex cell? How many are at the end of meiosis I? Meiosis II?

Why is crossing over important?Objective: Today we will explain

meiosis by creating skits.

Thursday, November 8

Meiosis has the same number of divisions as mitosis

Meiosis occurs in all types of cells

Mitosis and Meiosis both start with sister chromatids

Sister chromatids have identical DNA

Homologous pairs have identical DNA

Both mitosis and meiosis allow for genetic variation

Genotype: the actual alleles present for a particular trait

Objective: Today we will use the lecture to analyze Mendel’s contribution to genetics and review the process of meiosis.

Warm-Up: Determine if the following statements are true or false.

Friday, November 9Phenotype: the physical appearance of an

organismWarm-Up: Make two columns on your paper, one

labeled gene the other allele. The place the following terms in the column you think they go in. Hair color, low cholesterol, plant height, brown

hair, long tail, tail length, purple flowers, cholesterol level, flower color, tall plant

Objective: Today we will distinguish dominant and recessive using notes and an activity.

Tuesday, November 13Carrier: does not show disease symptoms

but can pass the disease causing allele on to offspring

Warm-Up: What did Gregor Mendel discover about

genetics? Blood type can be AB, A, B, or o. What

would be the gene and what would be the alleles for this trait?

Objective: Today we will use our inheritance activity to predict patterns and determine genotype.`


Crossing over: homologous chromosomes pair up during prophase I and exchange pieces of genetic information

Warm-Up: Black Fur is dominant to gray fur Write the genotype for gray fur Write the genotype for black fur Try to set up a Punnett Square to show a

cross between a homozygous black mouse and a gray mouse.

Objective: Today we will use a Punnett Square group activity and notes to explain how traits are inherited.

Thursday, November 15 Sex-linked genes: genes located on the sex chromosomes

Warm-Up: Cystic Fibrosis (CF) is a disorder caused by a recessive

allele. If 2 parents are carriers for the disorder, what are the odds they will have a child with CF?

In pea plants, yellow peas (G) are dominant over green peas(g) and smooth (H) over wrinkled (h). A pea plant heterozygous for both traits is crossed with a pea plant homozygous dominant yellow and wrinkled. What are the possible combinations for the gametes for each? (We haven’t covered this yet, just take a guess!)

Objective: Today we will show how we can use Punnett Squares to selectively breed using our activity.

Tuesday, November 15Incomplete dominance: neither allele is

completely dominant or recessive and heterozygous phenotype is in the middle

Warm-Up Duchenne Muscular Dystrophy is a sex-linked recessive

disorder. If a mother unknowingly carries the gene and marries a man who does not have the disorder, what is the probability they will have a child with MD?

Why are the odds above higher in boys than girls?Objective: Today we will apply inheritance

patterns for incomplete, codominance, and multiple alleles using Punnett Squares.


Independent assortment – different traits are inherited separately

Warm-Up: A woman is heterozygous for Type A blood and her

husband is homozygous for Type B blood. Set up the Punnett Square.

What are the possible blood types for the children? What percent of the children would have the same

phenotype as the mother? What percent would have the same genotype as the

father?Objective: Today we will review Mendel and

Punnett Squares using collaboration and by designing a species with various traits.

Monday, November 26Incomplete dominance – the heterozygous

phenotype is somewhere between the homozygous phenotypes

Warm-Up: What does it mean that Mendel looked at either-or

traits? What are some traits that do not work in the either-or

idea? Having a widow’s peak is a recessive trait. If a man

heterozygous for a widow’s peak marries a woman homozygous recessive with a widow’s peak, what are the genotypic and phenotypic ratios?

Objective: Today we will predict outcomes of crosses for sex-linked and polygenic traits using our notes and practice problems.


Codominance – both traits in an organism are fully and separately expressed

In the pedigree to the right, which female is least likely to be a carrier for the disorder (individuals with the disorder are shaded in). III-1, III-3, or III-5. Why?

Objective: We will use notes and a listen and sketch to create pedigrees and study inheritance.

Thursday, November 29

Polygenic: trait controlled by two or more genes

A test was done to determine the biological father of a child. The child’s blood is Type A and the mother’s is B. Dude #1 has blood type O and due #2 has blood type AB. Which is the biological father? How do you know?

Objective: Today we will create pedigrees using a listen and sketch and review the main ideas of genetics using our study guide.

Wednesday, January 5Pedigree – chart that shows family genotype

and phenotype Warm-Up:

Review – what is the phenotypic ratio of a heterozygous-heterozygous dihybrid cross? (From Ch. 6)

There are 3 genes on a chromosome, A, B, and C. A and B cross over 6.0% of the time, B and C, 12.5% of the time A and C, 18.5% of the time

From this information, see if you can determine what order the genes are located on the chromosome.

Objective: Today we will create a pedigree using information from a family story.

Thursday, January 6Genes 1,2,3,&4 are linked, what does

that mean?Place the genes in order using the

following: Genes 1 & 2 cross over 20% of the time Genes 1 & 3 cross over 13% 2 & 3 7% 2 & 4 25% 1 & 4 45%

Objective: Today we will research a genetic disorder using credible internet sites.

Tuesday, January 11Nucleotide: monomer; smaller unit that makes

up DNA and RNAHemophilia is a sex-linked recessive disorder.

If a woman is a carrier and a man has hemophilia, show the cross between the two. What percent would have hemophilia? What percent would be carriers?

Objective: Today we will use Punnett Squares to predict how traits are inherited through incomplete and codominance.

Wednesday, January 12Bacteriophage – virus that injects its DNA into

bacteria and take over the cellWarm-Up: Two Clown fish, one Yellow and one

Red, have baby clown fish that are an intermediate phenotype. What are the genotypes of the parents? Show the Punnett Square What would be the outcome if this were

incomplete dominance? Codominance?Objective: Explain how different alleles can

predict inheritance using Punnett Squares and worksheets.

Monday, December 3 Word of the Day:

Transcription: process of copying a strand of DNA to produce a complementary strand of RNA

Warm-Up:+-*@@*--+@**++- (Template 1)-+@**@++-*@@--+ (Template 2)

Template 1 and 2 pair up, based on that information, what would template 2 look like for the following strand?+++-@*@@*+@--** (Template 1)

Objective: Today we will analyze the discovery and structure of DNA using lecture notes.

Tuesday, November 29

Nucleotide – monomer that makes up DNA

Warm-Up: Who was the first to discover that DNA is

the transforming principle? Who discovered the transforming principle? What did Hershey and Chase use to confirm

that DNA was the transforming principle?Objective: Today we will trace the

steps for DNA replication using notes, manipulatives, and questions.


Double helix: two strands of DNA wind around each other (like a twisted ladder)

Warm-Up: Why is DNA replication important? What are the 3 parts of a nucleotide? Which part

allows for the differences in everyone’s DNA?Objective: Today we will investigate transcription

and translation through a video and coloring WS.

Wednesday, December 5

*If weren’t finished with your warm-up sheet and it is turned in, just do this on a separate paper and you can transfer it later!

Base pairing rules – adenine pairs with thymine and guanine pairs with cytosine

Warm-Up: Write what strand 2 would be for the following DNA sequence. AATCGCTACAGTGAC What would happen to DNA replication if there

were no enzymes?Objective: Today we will analyze transcription and

translation using a video and worksheets.

Friday, December 2DNA Polymerases – group of enzymes that

bond new nucleotides togetherObjective: Today we will use base pairing

rules and lecture information to transcribe and translate a DNA sequence.

Thursday, December 6

In your notes!!!Write the list below in your notes, then put

next to each one what structure it relates to in the cell. Chefs Castle Recipe Book Recipes Ingredients Monk Cop

Thursday, December 13Objective: Today we will apply the information on

DNA using our quiz.Transcription – process of copying a sequence of DNA

to produce a complementary strand of RNAWarm-UpTranscribe and Translate the following DNA sequence:AATTACGCGAGTGAGCGCTACACT

mRNA = UUAAUGCGCUCACUCGCGAUGUGA Amino acids= MET-ARG-SER-LEU-ALA-MET-STOP

Tuesday, December 6

Objective: Today we will distinguish between types of mutations using our devices and review questions.

mRNA: brings information from the DNA to the cell to be turned into proteins

Warm-Up: Transcribe and Translate the following sequence DNA: AATCGGATAGCCCAT mRNA:UUAGCCUAUCGGGUA AA: Leu-Ala-Tyr-Arg-Val

What should be at the beginning and end of the amino acid sequence?

Monday, February 7Restriction Enzymes – cut DNA at

specific nucleotide sequencesWarm-Up: What were your thoughts

on the video from Friday?Objective: Using information from

the video and your own knowledge, discuss the pros and cons of genetic engineering.

Tuesday, January 8Transgenic – containing genes from more

than one organismWarm-Up:

You are a watermelon grower and want to stop a pest from consuming your watermelon. What are some possibilities for accomplishing this?

Objective: Today we will explain what genetic engineering is and how it is used with our notes and discussion.

Thursday, December 8

Recombinant DNA – contains genes from more than one type of organism

Warm-Up: How can biotechnology reunite families? How does a child’s DNA compare with the DNA

of his or her parents?Objective: Today we will use information from the

book or lecture PPT to explain how genetic engineering works and how it can be applied.

Thursday, January 10Plasmid – closed loops of DNA found in bacteria

that replicate on their own

Warm-Up: Explain why a liger would be considered a

transgenic organism Give 3 examples of how we use biotechnology

in everyday applications

Objective: Today we will trace the steps of genetic engineering using a video and by creating posters.

GE PostersProcess of genetic engineeringUses for genetic engineeringPros/Cons (at least 2 of each)

Display using picturesNo more than 10 words on the poster!Neat/Creative/Colorful/Easy to follow

Monday, January 14Recombinant DNA – contains genes from

more than one type of organismWarm-Up: How are restriction enzymes

used to make both recombinant DNA and transgenic organisms?

Objective: Today we will use our review worksheet and posters to explain the concepts of genetics.

Wednesday, January 16

Species – group of organisms similar enough to reproduce and have fertile offspring

Group the following animals based on similarities. You must have at least 2 groups and at least 2 animals in each group. Cockatoo, hummingbird, ant, sparrow, bee, marlin,

toucan, crab, lobster

Objective: Today we will explain the relationship between different scientific articles using our jigsaw activity.

Thursday, January 17Evolution – process of change where descendents

come to differ from their ancestorsWarm-Up:

Choose 1 of the articles from yesterday and explain how it relates to evolution.

Objective: Today we will explain the difference between variation and adaptation and define natural selection using our notes and scenarios.

Friday, January 18Adaptation- a variation or trait that allows

an animal to better survive in its environment.

Using the animal card you have, explain a variation and adaptation for that animal.

Objective: Today we will analyze how adaptations work using our beak lab.

Tuesday, January 22Homologous structure: features with similar

structure but different functionWarm-Up:How does the beak lab from Friday relate to

variation and adaptation?Objective: We will apply the principles of

natural selection to an animal using a scenario and by designing a lab.


Vestigial Structure: remnants of organs or structures that had a function in earlier ancestors

Choose one of the organisms below, come up with a situation where natural selection could take place. Give specifics as to what the selection was and what caused it. Organisms: Panda’s teeth, gray whale’s fin size,

foxes’ tail, mouse’s color, crab’s shellObjective: Today we will apply the principles of

natural selection using our lab.

Thursday, January 24Analogous structure – structures with

similar functions but different structureWarm-Up: Apply the 4 principles of

natural selection to one of the following animals: Shark, Whale, Jellyfish, Stingray

Objective: Today we will evaluate the evidence behind the theory of evolution using our notes and opinion statement.

Tuesday, January 10Warm-Up: Explain the similarities and

differences between the following terms: Homologous and analogous structure Adaptation and descent with

modificationObjective: We will explain the principles

of natural selection using our quiz answers.

Monday, January 28 Gene pool – the combined alleles of all individuals in a

population Warm-Up –

Do you see variation within this population? What would happen if there were no variation? How might this population change if Antarctica became warmer?

Objective: Today we will analyze what allele frequency is and how it can change with notes and an activity.


Directional selection – one extreme of an organism’s phenotype is favored

Warm-Up: Rabbit fur color is determined by dominant (Black) and recessive (white) alleles. If you have a population with 5 white rabbits and 10 black rabbits, half heterozygous and half homozygous dominant, what is the allele frequency for each allele?

Objective: We will demonstrate how harmful alleles can stay in a population using our lab activity.

Today we will distinguish between the 3 types of natural selection using lecture, response devices, and mini posters.

Thursday, January 31

Allele frequency – measure of how common an allele is in a population

Warm-Up: What creates the genetic variation necessary for natural

selection to take place? If medium sized sharks were advantageous for survival, what

would you expect to happen to the population of sharks over several generations?

Objective: Today we will explain how deadly traits can be maintained in a population using our lab activity.

Tuesday, January 17Disruptive selection – both extreme phenotypes

are favored, the middle becomes less commonWarm-Up:

Is it possible for an allele that is harmful to stay in a population? Why or why not?

If I toss a coin, what is the probability of tossing heads or tails? Would I see that ratio better in 6 tosses or 60?

Objective: Apply the principles of natural selection by creating a new species adapted to its environment.

Friday, February 1Gene flow – movement of alleles from one

population to anotherWarm-Up:

What effect has immigration had on the genetic variation in the US?

Objective: Today we will explain how gene flow, genetic drift, and sexual selection can lead to evolution of population through notes and discussion.

Monday, February 4Genetic drift – changes in allele frequencies due

to chanceWarmUp

Give an example of genetic drift Why are small populations more susceptible to

genetic drift? Explain the difference between genetic drift

and evolution.Objective: Today we will use the notes and create

examples to describe evolution patterns.

Tuesday, February 5Convergent evolution – evolution of similar

characteristics in unrelated speciesGive an example of coevolution.Objective: Today we will apply the ideas

of evolution to various animals using our review questions and key concepts.

Thursday, February 7

Divergent evolution – two related species become different

What were 3 interesting things you learned from the Life movie?

Objective: Today we will apply the concepts of evolution using our written response questions.

Monday, February 11 Word: capsid – protein shell surrounding a virus

Warm-up: What causes sickness?

Objective: Today we will analyze how disease can spread and where pathogens are found using our activities.

Wednesday, February 13 Word:

Vaccine: substance that stimulates the body’s immune response against invasion by microscopic particles

Warm-Up: What are some defense mechanisms your body

uses to keep out/get rid of germs? Objective: Today we will compare various pathogens

using notes and discussion.


Obligate anaerobe – bacteria that are poisoned by oxygen

Warm-Up: Create a Venn Diagram to compare and contrast the lytic and lysogenic cycles for viruses.

Objective: Today we will analyze the structure of various organisms and compare them to bacteria using our microscope lab.

Bacteria Microscope DataOrganism Hypothesis –

Draw what you think it will look like

Actual Drawing (under 100x or 400x magnification)

Observations/Description

Friday, February 3Obligate aerobe – requires oxygen to

surviveWarm-Up

What are 3 ways that we classify bacteria? How do bacteria cause disease?

Objective: Today we will compare diseased and healthy tissue using our microscope lab.

Thursday, March 17Warm-Up: Using your information and talking

with those around you, determine which person/cup # you think started with the virus, then answer these questions. Would this virus spreading most likely resemble a lytic or

lysogenic infection? Why? Why is washing your hands important to keep from

spreading an illness? What is your first line of defense against any pathogen?

What are some ways viruses can get past that?Objective: Use the movie to relate pathogens

to your immune system.

Monday, February 25Word: humoral immunity – immune

response that depends on antibodiesWarm-Up:

What are some signs that you are getting sick?

Why do you get tired when you are sick?Objective: Today we will evaluate the

scientific method as it applies to our lab reports.

IntroductionThis lab looks at the effects of variation

and adaptation in beaks on a bird population trying to pick up seeds. We have discussed variation and adaptation in class. Variation is the different options within a population for a given trait, while adaptation is the variation that is best suited for survival. Our procedure will use a variety of bird “beaks” to pick up seeds and try and determine which one is the most successful, thus best for survival and the adaptation for the birds.

Tuesday, February 26

Germ theory – specific microorganisms cause disease

Warm-Up: What are some causes of disease? Are all diseases able to be passed from one person

to another?

Objective: Today we will discuss what causes illness in your body using a video, WS, and notes.


Cellular Immunity – immune response involving T cells; used against viruses

Warm-Up: Contrast the various pathogens we discussed yesterday.

Objective: Distinguish between cellular and humoral immunity using our notes, devices, and questions.

Monday, March 4allergy – oversensitivity to a normally

harmless antigenWarm-Up: List 2 nonspecific defenses

your body can use against pathogens.Objective: Today we will create a skit

demonstrating the immune response for various pathogens.

Tuesday, March 5Phagocyte – white blood cell that engulfs

pathogens, a type of macrophageWarm-Up:

What role do phagocytes play in cellular immunity?

What are some ways you can be immune from a pathogen?

Objective: Today we will demonstrate how the body responds to pathogens using our skits.

Wednesday, March 6Autoimmune disease – failure of the body

to recognize healthy and diseased cellsWarm-Up:

Trace the steps for humoral and cellular immunity.

Explain how the immune system functions using our quiz.

Thursday, March 7Anaphylaxis – extreme swelling due to

large amount of histamineWarm-Up:

Why are opportunistic infections called opportunistic?

Why is HIV so hard to fight?

Objective: Today we will analyze key concepts about the immune system and pathogens using our review game and study guide.

Friday, March 8

Alveoli – tiny air sacs where gas exchange takes place in the lungs

Warm-Up: Can a person die from holding their breath? Why or why not?

Objective – Today we will explore how the respiratory/circulatory system work by creating a comic book with our research.

Monday, March 11Diaphragm – dome shaped muscle

at the base of the rib cage that helps with breathing

Warm-Up: WHY is smoking bad? What is it doing in our body that can cause problems?

Objective – Today we will distinguish and relate the respiratory and circulatory systems using our Power Notes and diagrams.

Thursday, March 14

Arteries – carry blood away from the heart

Warm-Up: How do the respiratory and circulatory systems function together to maintain homeostasis?

Objective – Today we will determine main ideas about the respiratory and circulatory systems using discussion and listen and sketch.

Monday, February 27Veins – blood vessels that carry blood

toward the heartWarm-Up:

When is pressure the greatest in the lungs? How do the diaphragm and rib cage help create this

pressure?

Objective: Today we will explain how gas exchange takes place in the lungs using our notes and discussion.

Friday, March 15Hemoglobin – iron-rich protein molecules

in red blood cells that carry oxygenWarm-Up:

Trace the flow of oxygen from the air to the blood The left ventricle is the largest chamber of the

heart. How is its size related to its function?

Objective: Today we will explain the structure and function of the circulatory system using our discussion and activities.

Wednesday, February 29

Atrium – smaller, top chambers of the heart; pump blood to ventricles

Warm-Up: Explain the difference between systolic and diastolic

blood pressure. Why does narrowing of the arteries increase blood

pressure?

Objective: Today we will analyze heart health using our BP lab and review assignment.

Thursday, March 1Ventricle – larger, lower chambers of the

heart; pump blood to lungs and bodyWarm-Up:

What happened to your blood pressure after lying down? After exercising? Why?

Objective: Today we will diagram how the heart and lungs maintain oxygen levels in the body using a pictorial.

Monday, March 18Lymphatic system – complex network of

organs, vessels, and nodes that helps in circulation

Warm-Up: Starting in the brain, trace the blood’s route through

the body.

Objective: Today we will explain the function of the lymphatic system using our books and study guide.

Tuesday, March 19Platelets – cell fragments that help in

blood clottingWarm-Up: Explain how the lymphatic

system works with both the circulatory and immune systems.

Objective: Today we will explain how the respiratory and circulatory systems function using our pictorial.

Wednesday, March 7Tissue – group of similar cells working

togetherWarm-Up:

What are some examples of tissues in your body? What are some examples of organs?

Objective: Today we will explain how cells are organized and the difference between positive and negative feedback loops using notes, devices, and a WS.

Wednesday, March 20

Organ – group of tissues working together Warm-Up: Give an example of a positive or

negative feedback loop. Objective: Today we will analyze how the nervous

system works our notes and discussion.

Friday, March 9Homeostasis – set of internal conditions

that need to be maintained for best survival

Warm-Up: What have you discovered about your nervous

system from the activities you have done?

Objective: Today we will analyze how the nervous system works using various activities.

Thursday, March 21Central nervous system – brain and spinal

cordWarm-Up:

What causes you to sweat and your pupils to dilate? How is that related to the nervous system?

Objective: Today we will explain how signals travel in the nervous system using our notes and activities.

Friday, March 22Peripheral nervous system – the nerves

leading to and from the spinal cordWarm-Up:

Write the steps for a neuron to transmit an impulse. Why does the nervous system use both electrical

and chemical signals?

Objective: Today we will analyze how our nervous system works using our olfactory lab.

Monday, March 25Hormones – chemical signals made by

glands of the endocrine system and released into the blood stream

Warm-Up: Create a Venn diagram comparing and contrasting

the endocrine and nervous system.

Objective: Today we will explain how the endocrine system and nervous system function using our notes.

Tuesday, March 20Glands – organs that produce hormones

and release them into the blood streamWarm-Up:

Why is the bloodstream a good means for transporting hormones such as growth hormone?

Objective: Today we will distinguish between the nervous and endocrine system using our notes.

Tuesday, March 26Resting potential – state of a neuron when

it contains the energy needed to transmit an impulse

Warm-Up: What are some body processes that are influenced

by the endocrine system? Why don’t hormones affect all cells?

Objective: Today we will review the systems of the body using our review questions.

Thursday, March 28Community – a group of different species

that live together in one areaWarm-Up: Brainstorm

What do you think of when you hear the word ecology?

Objective: Today we will learn how to use Prezi using our example and questions.

Monday, April 8Ecosystem – all the organisms and

nonliving things in a given areaWarm-Up:

Create a food chain using 3 organisms

Objective: Today we will explain how we classify things in ecology using our notes and devices.

Wednesday, April 10Keystone species – species that has an

unusually large effect on its ecosystemCA Standards Review pgs. 4,6,8Objective: Today we will explain how

energy flows within an ecosystem using our notes and food web posters.

Thursday, April 11Autotroph – organisms that make their

own foodWarm-Up: Pgs. 10, 12 Objective: Today we will create a food web

using our story and posters.

Friday, April 12Heterotroph – organism that must eat

different food for energyWarm-Up: Review pgs. 14, 16Objective: Today we will analyze changes

in a population based on predator prey relationships using our lab.

Monday, April 15Niche – specific factors within a habitat

that an organism needs to survive and reproduce

Warm-Up: Review pgs. 18 & 20Objective: Today we will analyze predator-

prey relationships using our lab.

Tuesday, April 16Symbiosis – close relationship between

two organisms of different species that live in direct contact

Warm-Up: Review pgs.22-26Objective: Today we will explain the cycles

using our diagrams.

Cycles VocabWater Cycle (Blue):PrecipitationCondensationEvaporationTranspirationRun-off

Nitrogen Cycle (Brown):Nitrogen fixationNitrificationAmmonificationDenitrificationDecomposition

Wednesday, April 17Competitive exclusion – two species

cannot occupy the same nicheWarm-Up: pgs. 32, 34Objective: Today we will explain various

ways organisms interact in ecosystems using our notes.

Monday, April 18

Kinesis – increase in random movement

Warm-Up: What reasons were there for behaviors you saw on the Planet Earth video Friday?

Objective: Explain why animals behave the way they do using notes and discussion.

Thursday, April 18Immigration – movement of individual into

a populationWarm-Up: Review pgs. 36,38,40Objective: Today we will analyze

population changes using our notes.

Friday, April 19Emigration– movement of individual out of

a populationWarm-Up: Review pg. 164Objective: Today we will apply ecology

concepts to real ecosystems using our Planet Earth assignment

Tuesday, April 19Taxis – movement toward or away from a stimulusWarm-Up:

What internal and external stimuli might trigger an Alaskan caribou to migrate?

A peacock uses its colorful tail feathers to attract a mate. What factors might control how large a peacock’s train of feathers grow to be?

Objective: Choose an animal and brainstorm ideas on behaviors to demonstrate in a movie.

Wednesday, April 20Habituation – an animal learns to ignore a

repeated stimulusWarm-Up

How is learning to read and write an adaptive behavior?

What other behaviors have you learned that are adaptive?

Objective: Use the internet to research behaviors for your animal.

Friday, April 26Cognition – mental process of knowing through

perception or reasoningWarm-Up: List the structures for each body system

Respiratory Circulatory Excretory Digestive

Objective: Explain the function and find the location of the parts of a rat using the rat handout and flashcards.

Monday, May 9Imprinting – a rapid and irreversible

learning process that only occurs during a short period of time

Warm-Up: If you had $1000, what are some

things you would consider spending it on?

How did you decide?Objective: Use research to create a

video about an animal’s behavior.

Tuesday, May 10Altruism – kind of behavior where an animal

reduces its own fitness to help members of its social group

Warm Up What are some behaviors you have that are

instinctive? What are some things you can learn through

imitation?Use PowerPoint lecture and discussion to

explain why animals have certain behaviors.

Wednesday, May 11

Animals Elk Ferrets Cockroache

s Porcupines Rhinoceros Goats Giraffes Monkeys Owls Crows Jays Frogs Sharks Tigers

Animal Group Names Streak Intrusion Gang Prickle Shiver Business Parliament Crash Tower Tribe Party Barrel Murder Army

Monday, May 16Cognition – mental process of

knowing through perception or reasoning

Warm-Up – explain the connection between the following words Stimulus, taxis Survivorship, territoriality Altruism, eusocial Instinct, innate

Objective: Use your knowledge of animal behavior to create a practice test

Practice Test Assignment

Requirements 25 - multiple choice 10 - true/false 10 - fill in the blank 5 - short answer (should require at least 2

sentences to answer) Answer Key on separate paper

Due Wednesday

Tuesday, May 17Survivorship – the number of individuals

that survive from one year to the nextPg. 843 #1-3Objective: Create a practice test using your

book and knowledge of animal behavior.

Tuesday, August 16 Biology – the study of life Warm-Up: For each of the groups of words below,...

Documents

Transcript of Tuesday, August 16 Biology – the study of life Warm-Up: For each of the groups of words below,...