Proc. Nati. Acad. Sci. USAVol. 91, pp. 8577-8581, August 1994Plant Biology

Transcriptional photoregulation of cell-type-preferred expression ofmaize rbcS-m3: 3' and 5' sequences are involved

(C4 photosynthesls/mesophyil cells/bundle sheath cells/promoter structures/3' transcribed silencer)

JEAN-FREDERIC VIRET*, YASSER MABROUK, AND LAWRENCE BOGORADtThe Biological Laboratories, Harvard University, Cambridge, MA 02138

Contributed by Lawrence Bogorad, May 13, 1994

ABSTRACT In the C4 plant maize, members of the rbcSgene family, encoding the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, are not expressed inmesophyll cells (MC) but are expressed strongly in the adjacentbundle sheath cells (BSC). Expression of genes in an in situtransient expression assay indicates that the photostimulatedexpression seen in BSC during the first 24 h that leaves ofdark-grown seedlings are illuminated requires rbcS-m3 se-quences lying between -211 bp and +434 bp of the transcrip-tion start site. Photoregulated partial suppression of rbcS-m3expression in MC, on the other hand, requires gene sequencesthat lie between -907 bp and -445 bp together with sequencesthat lie between +720 and +957 bp within the 3' transcribedregion ofthe gene. Suppression inMC occurs during the second24-h period that dark-grown seedlings have been illuminated,but not during the first 24 h. The 3' +720- to +957-bp regionis also effective in lowering MC expression when it is relocatedto a position >2 kbp upstream of the transcription start site.Thus, suppression of rbcS-m3 expression in MC has, at theleast, a substantial transcriptional component. As reportedearlier, a converse pattern of suppression in BSC and stimu-lation of expression in MC is seen in the control of cab-ml inmaize leaves.

In C4 plants, such as Zea mays L. (maize), different sets ofphotosynthetic carbon metabolism genes are expressed in themorphologically distinct leaf mesophyll cells (MC) and bun-dle sheath cells (BSC). A single layer of BSC surrounds eachvein; MC surround the cylinders of BSC (1, 2).The small subunit of ribulose-1,5-bisphosphate carboxyl-

ase/oxygenase (Rubisco) is encoded by genes of the rbcSfamily. Transcripts of rbcS are detectable in MC and BSC ofetiolated maize leaves (3, 4), but within the first 24 h ofillumination their abundance increases 2- to 3-fold in BSC andthey are undetectable in MC (3, 4). Transcripts of the maizegene rbcS-m3 (5) follow this pattern of BSC-preferred accu-mulation upon illumination of dark-grown leaves and consti-tute about 35% of the total leaf rbcS mRNA in 24-h illumi-nated dark-grown maize (3). Using a 3-glucuronidase (GUS)in situ transient expression assay (6), we found that expres-sion from a reporter gene containing 2.1 kbp upstream of therbcS-m3 transcription start site [-2.1-kbp rbcS-m3 promoter(Pr):GUS:nopaline synthase (nos) terminator] is about thesame in MC and BSC of 24-h illuminated leaves. GUSexpression is promoted 2- to 3-fold in BSC by illumination, asexpected from the behavior of rbcS-m3, but this reportergene does not behave like rbcS-m3 in MC after illumination:GUS expression from the rbcS-m3 promoter is about thesame in MC of unilluminated and illuminated leaves (3, 6).We have now found that inclusion of a 238-bp sequence

from within the transcribed 3' end of rbcS-m3 (extending

from +720 to +957 bp relative to the transcription start site)in a reporter gene containing 2.1 kbp of rbcS-m3 fromupstream of the transcription start site preferentially reducesexpression ofGUS in MC in leaves of dark-grown seedlingsthat are greened (i.e., illuminated) for 24 h prior to bombard-ment. Furthermore, the 238-bp fragment provides MC-preferred suppression ofexpression through a transcriptionalmechanism. Through a series of promoter deletion experi-ments, we found that the 238-bp 3' end fragment cooperateswith a 463-bp promoter region sequence (from -907 to -445bp relative to the transcription site) to establish BSC-preferred expression through suppression of expression inMC. These results also demonstrate that the BSC-preferredexpression of the rbcS-m3 gene is dependent upon twotemporally separate light-evoked signals.t

MATERIALS AND METHODSPlant Material. Second leaves of 10-day-old dark-grown

maize (Z. mays L.; FR9Cms x FR37; Illinois FoundationSeeds, Champaign, IL) seedlings or similar dark-grown seed-lings greened for 24 h were harvested. Greening for 24 h wasachieved in growth chambers under 1000 microeinsteins perm2/s fluorescent lights at 25TC. For bombardment, four3.5-cm-long segments from tops of second leaves were flat-tened side by side on 1.2% agar Murashige and Skoogmedium (ref. 7; GIBCO) in 50-mm Petri dishes with the lowerepidermis facing upward (6).

Construction ofChimeric Genes. The plasmid pMTnos (ref.6; pM3TSSU2.1) was the basic construct used to create allother chimeric constructs tested in the present study. Meth-ods for cloning were adapted from Sambrook et al. (8).pMTnos contains 2.1 kbp ofrbcS-m3 (5) from upstream ofthetranscription start site plus 434 bp of transcribed region(including the unique rbcS-m3 intron) fused to the Esche-richia coli uidA gene coding sequence (GUS reporter), fol-lowed by 260 bp of the nopaline synthase (nos) terminator ofAgrobacterium tumefaciens (9). The plasmid pMT444 wasobtained by subcloning an EcoRI fragment of pMTnos intopBluescript II SK (Stratagene) (Fig. 1). The pMT211 plasmidwas obtained by first digesting pMT444 with Kpn I andHindIII, then treating it with exonuclease III and mung beannuclease, and religating it with T4 DNA ligase (10). It wasdetermined by dideoxysequencing (11) that pMT211 contains211 bp of rbcS-m3 from 5' of the transcription initiation site(Fig. 1). The plasmid pMT3' was obtained in three steps: (i)a 550-bp Sma I-Bgl II fragment of rbcS-m3 was introduced in

Abbreviations: GUS, P-glucuronidase; BSC, bundle sheath cell(s);MC, mesophyll cell(s); Pr, promoter; CaMV, cauliflower mosaicvirus.*Present address: Department of Biology, Massachusetts Institute ofTechnology, Cambridge, MA 02139.tTo whom reprint requests should be addressed.tThe sequences reported in this paper have been deposited inGenBank data base (accession nos. U09743 and U09744).

8577

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994)

pMTnos I-2.1 kbp +

E N +1 N B Si SC EpMT444

-444 +434

-21 1+-i SCpMT21 1 ----.T-_r.z-i.

+434

pMT3'

pMT9073'

434

K >c F -*lNB 51E-Smrn-2.1| kbp +4 4+720 -1269

Ad Ad > tlMN + ~ l)N2- 2, $rs1.Cz}.j+.......................

-907 --434 +720 +1269

IN +1i\J SI mSr <5cpMT4443 l

-444 +434 +720 +-1269

-21 1+l N BS Srn dicpMT21 13' " i..-

+-434+720 --1269

pMTnos3' N

-2.1 kbp +4:4 -720 +1260

pMTnosA3 i7L--_-0 ...ma-p. 1 kbp --434 +720 +957

t.,Sm K Sc El L+ N +1 N Si $c Ep3'MTnos >

+720 +1269'-2.1 kbp +434

pBI2213 71= ..500 Ubp+720 -1269

=rbcS-rn3 5' region zCaMV 35S promoter _rbcS-mT3 intror=rbcS-m3 3' region Cnos terminator =GUS gene

FIG. 1. Diagrams showing chimeric GUS reporter genes. Re-striction enzyme sites indicated are BamHI (B), EcoRI (E), Kpn I(K), Nco I (N), Sac I (Sc), Sal I (SI), Sma I (Sm), and Spe I (S).Segments of rbcS-m3 are delineated in base pairs from the gene'sown transcription start site (+1). The polyadenylylation site of thenormal rbcS-m3 transcript is indicated (A). CaMV, cauliflowermosaic virus.

the Sma I and BamHI sites of pBluescript II KS-, creatingpUCRPASmaI. (ii) The Sal I-EcoRI fragment of pRAJ275(Clontech) was introduced upstream of the rbcS-m3 SmaI-Bgl II fragment by ligation into the Sal I and EcoRI sites ofpUCRPASmaI, creating pGUS3'. (iii) The 2.5-kbp Kpn I-SalI fragment ofpMTnos was introduced into the Kpn I and SalI sites of pGUS3', creating pMT3' (Fig. 1). Both thepMT4443' and pMT2113' plasmids were obtained by substi-tuting the SnaBI-Sac I fragment in pMT444 and pMT211 withthe SnaBI-Sac I fragment of pMT3', thus in effect replacingthe nos terminator with the rbcS-m3 3' end after the GUSreporter gene (Fig. 1). The pMTnos3' construct was obtainedin two steps. (i) The EcoRP fragment of pMT444 was intro-duced upstream of the rbcS-m3 3' end in the EcoRI site ofpUCRPASmaI, creating pMT444nos3'. (ii) The Kpn I-Sal Ifragment of pMT3' was ligated into pMT444nos3' cut withKpn I and Sal I, thus creating pMTnos3' (Fig. 1). ThepMT9073' construct was obtained by introducing the Sac Ifragment of pMT3' into a pBCKS- vector (Stratagene). Thep3'MTnos construct was obtained in three steps. (i) The SmaI-Spe I fragment ofpMT3' was ligated into the Sma I and SpeI sites ofapSPORT 1 vector (GIBCO/BRL). (ii) The rbcS-m3550-bp 3' end in pSPORT 1 was removed by digestion withPst I and HindIII and ligated into the Pst I and HindIII sitesof pBluescript. (iii) This rbcS-m3 550-bp 3' end was removedfrom the pBluescript vector by Kpn I digestion and ligatedinto the Kpn I site of pMTnos (Fig. 1), yielding p3'MTnos.The pMTnosA3' was created by ligation of a PCR-amplifiedinsert from pMT3' cut with Sma I and Spe I in the corre-sponding sites of pMTnos3'; the 5' primer was the 25-mer5'-CCTGCAGCCCGGGCAGCGACTAGAC and the 3'primer was the 36-mer 5'-CATGCACTGCTTGCAACAC-

TAGTTACATCACATCCA. The pBI2213' construct wasobtained by replacing the SnaBI-Sac I fragment of pBI221(12) with the SnaBI-Sac I fragment of pGUS3' (Fig. 1).

Transient in Situ Expression Assay. This DNA bombard-ment assay (13, 14) was performed as described (6, 15).Segments of etiolated leaves were prepared and bombardedunder a dim-green safe light. After bombardment, thesesegments were incubated in the dark for 24 h and thenincubated for locating GUS activity. Similarly, light-treateddark-grown leaf segments (see Results; Fig. 3, 0-24 h) and24-h greened leaf segments (see Results; Fig. 3, 24-48 h, andFig. 5) were irradiated for 24 h after bombardment.

Localization of GUS Activity in MC and BSC. Histochem-ical localization of GUS activity was performed using thesubstrate 5-bromo-4-chloro-3-indolyl glucuronide (Biosyn-thag, Skokie, IL) as described (Fig. 4) (16). The cells ex-pressing GUS were identified either by counting the totalnumber of spots per shot and slicing transversely with avibrocutter (World Precision Instruments, Sarasota, FL)through a sample of =400 blue spots in GUS stained segmentsembedded in 2% agarose or by recording the locations of allblue spots in the segments using differential interferencecontrast microscopy (Fig. 4). As in previous works (6, 15), anindividual blue spot was counted as a single expression eventirrespective of the number of contiguous blue cells showingGUS activity and there was not a single spot localized in bothMC and BSC (Fig. 4). Each GUS construct was tested at leastthree times using the in situ assay and each experiment wasrepeated at least once.

RESULTSLalizing the Region of rbcS-m3 Required for Enhancing

Expression in BSC. The reporter gene -2.1 rbcS-m3 Pr:GUS:nos (pMTnos; Fig. 1) is expressed twice as actively in BSCof dark-grown maize seedling leaves illuminated for 24 h asin BSC of unilluminated leaves (6). We have now found that,as from pMTnos, expression from a -211 rbcS-m3 Pr:GUS:nos construct (pMT211) was also about doubled in BSC byillumination whereas expression was unchanged in MC (seeFig. 3D). Thus, only sequences lying between -211 bp and+434 bp of the rbcS-m3 transcription start are required forphotostimulated expression in BSC.As had been seen earlier (6, 15), expression of GUS from

CaMV 5' promoter sequences in pBI221 (ref. 12; Fig. 1) wasabout equal in MC and BSC of leaf segments of dark-grownmaize illuminated for 24 h (Fig. 3B) and was promoted byillumination. The latter phenomenon has not been exploredfurther.GUS Expression from the rbcS-m3 2.1-kbp Promoter and 3'

End (+720 to +1269 bp). Next, we investigated whether theexpression of the reporter gene -2.1 rbcS-m3 Pr:GUS:nos(pMTnos; Fig. 1) failed to be controlled in MC (6) becausesome part ofrbcS-m3 was missing. Using the in situ transientexpression assay (6), we tested whether the rbcS-m3 550-bp3' end (from +720 to + 1269 bp relative to the transcriptionstart) (Fig. 2) might contribute to the control ofGUS expres-sion in MC when included in the chimeric reporter pMT3'(-2.1 kbp rbcS-m3 Pr:GUS:rbcS-m3 3' end) (Fig. 1).The pMT3' construct was analyzed for expression in MC

vs. BSC by the in situ transient expression assay (6). TheCaMV 35S Pr:GUS:nos (pBI221) (12) and 2.1-kbp rbcS-m3Pr:GUS:nos (pMTnos) constructs were used as controls.Supercoiled DNA of pBI221, pMTnos, or pMT3' was pre-cipitated onto microprojectiles that were shot into segmentsof dark-grown maize leaves. After being maintained in dark-ness or in light for 24 h, the leaf segments were incubated withthe GUS substrate and bleached in 70% ethanol. Blue spotsresulting from GUS activity were counted and their locationsin MC or BSC were determined. The pMT3' and pMTnos

8578 Plant Biology: Viret et al.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 8579

A-907GAGCTCCCTT TAATCTGGCG CTAGATCTGC ATCCGCGGCT TGCAAAGATA AATGGCACATTTAGTGTGTT ATTETGCAAT ACCTTTCATA GTAGATATCC TTAAATGCAG TITTAGGCAT

__m -GTTGGGTAAT TAAATAACAT ?NTTAGGAGG AGTTTTAGAT TTACCTTTCT TTCGTGATGA

CTGATACAGA CGTGGGGAAT TCAAATGCAA CTCTAGCGAA AGTTCATATA rTTTICATAApHVML AT- I

ATAGCTGAGG CTGGGGTAAT TAT1TTGT AGAAAAATAG AATAGGTGGA ATGGTTTGGGGAAGGCGTAG GCGCTCGTGG ACGACGCCCG ATAAAAGACA AGAGGCGGAA TTGCCATGAATTCGAGGTAG CTAAGTAAGG CGCATGCATA TATATGCCAA AAATTCTACT GTCACTTTCC

-444AATTTAATG CGCTGCCAAA CAAGCCATCC TGGAAACTGA CTTIAATTCA GCCCAATTCTGTAGATCCAA ACAGGGCCGG CGTCAGTGCC TCAGGTGAGA GAGCAGCAGA CGATGCAAAGAGCCAAAAGT GGAAGCAGAC GCAGCCGAAG CCGAAGCCCA AGCCCAAAAC T"TTITGTCTTTGCCCAGAA CCGCGACGAG CCTAAACTOC CGCTTCCTCC TATCTACAAG TCCCTGGCAC

-211ATCACGCATA GTCCAACCAT GGCGCGCAGG CGATAAgGCG CGCCACGGGG ACGCGACATGTGTGCGGA CGCGATCAGG ATAGGGCCAG GCTGGCCGGG CGCGGCCACG GGAGAACGGTGGCCACTCGT CCCACATCCG CTTCGTCCTG TCCTGTACTG CGTCCTGCCC CCAACGAGAGCCGGAGCCGG CCATCCCGTC GCACACTCTC CCCCTCTATA TATGCCGTCG GTGTGGGGGAGCCTACTA(+1)

B +720 STOP CTAGCCCG GGCAGCGACI AGACCGCGCC CGCCGGCCGC CCCCCGCCGG CTAGCTAGCT

£PEATS -AGCTAGCTAG CTCCTGCGTG AGCTAGTAGC TAGTGCCATG CGTCGTCTCT GTCGTTCGGT

HOMOPYRIMIDINE STRETCHTTTGCTTCGG GTCACCGTAC CCTTTGCTTG CTrGTITCT TCTTTCCTTT TTTCCTTT

TT1TTCTTCT TTTCCCCGGC CATGGTTCCT TTGCTTTCAG CAGTTCTCTG CTGGATGTGA

TGTATCCATT GTTGCAAGCA TGGCCTTGCA TTGGCTACCT CTATACCTGC TACAAACTACTGCAACGCCT ATATATACTT GGGGTGAGGA ACATGTGAAT GCAAGCTCCG GCTATCATATACATGTAATA TGGATACAAA CTATATATAT AAATCCGCCG AGGCGCCGAC TAATACTATA

POLYADENYLATION SITECGACGACACC GTGTTAAGTT AATATATAAC TGGTGCTTTT TATTTATATA TCTGTCTCATCATATATATA TGCTAATTAA TGGATGTGTG TCCTCTTCAC TTCAATTCCT TCTTICC'TTCCTATGCTTT GAGATQ (+1269)

FIG. 2. Nucleotide sequences of 5' and 3' regions of rbcS-m3. (A)Upstream nucleotide sequence -907 to +1. The locations of PHYbox (a GT-1 binding site found in the rice phytochrome gene; ref. 17),an AT-1 box (found in tobacco light-harvesting chlorophyll a/bbinding protein gene; ref. 18), and ABRE (an abscissic acid regulatedelement; ref. 19) are indicated by overlines. (B) Downstream nucle-otide sequence +720 to + 1269. Seven CTAG repeats, a pyrimidine-rich region, and an AS-2 site (20) present in both the CaMV 35Spromoter and cab gene promoters are indicated by overlines. Dis-tances from the transcription start site are given in base pairs.

constructs were expressed very similarly (Fig. 3 A and C,etiolated and 0-24 h): expression in BSC was about doubledby illumination whereas expression from pMT3' was essen-tially unchanged in MC. Thus, replacing the nos terminatorwith the rbcS-m3 3' end does not greatly alter MC vs. BSCexpression in unilluminated leaf segments of dark-grownseedlings or during illumination of such seedlings for 24 h.Inasmuch as the pool of rbcS transcripts reaches a maxi-

mum size in dark-grown maize seedlings after 24 h of illu-mination (3), we decided to test whether inclusion of the550-bp rbcS-m3 3' end in the reporter gene influences ex-pression during the second 24 h of illumination. DNA of thepMT3', pMTnos, and pBI221 constructs (Fig. 1) was shot intosegments of leaves from dark-grown plants that had beenilluminated for 24 h and expression during hours 24-48 wasfollowed. The control reporter gene, pBI221 (12), was ex-pressed two to three times more in MC than BSC in contrastto 1:1 expression of this gene during the first 24 h ofillumination (Fig. 3B; see Fig. 5). Because a GUS reportergene using a maize polyubiquitin promoter (pAHC27; ref. 21)shows the same difference in relative expression as pBI221 inMC and BSC, perhaps physical changes in leaves occurduring the first 24 h of illumination that reduce the averagedepth to which the microprojectiles penetrate and thereforethe ratio of the BSC to MC cross section is lower. Totalexpression of the chimeric reporter gene -2.1 rbcS-m3Pr:GUS:nos in MC plus BSC and a few guard cells was lowerthan during the 0- to 24-h period of illumination (Fig. 3C) butrelative expression in MC:BSC was about 2:1 rather than 1:1.The decrease in BSC expression may be wholly or partiallyattributable to physical changes in microprojectile penetra-tion. In striking contrast to expression of pMTnos, expres-sion of the chimeric reporter gene, pMT3', was twice as great

A '! 60 pMT3 - B5 1 G0 pi122i

7-I.

N

C 0-pMTnos

MCoBSC.2.5>! 1 .1 2 1

D~~ ~~ ~~.Q.2

I 1:21

\:.:..

FIG. 3. Light-dependent in situ transient expression of pMTnos,pMT3', pMT211, and pBI221 in maize leaves. The average number(±SEM) of blue spots per shot is shown for each chimeric genetested. The distribution ofGUS activity and location inMC and BSCwere determined by sectioning leaf segments and locating all spots ora sample of at least 100 spots from different shots. Segments of10-day-old etiolated leaves (etiol.) were bombarded and exposed tolight for 24 h (0-24 h) or leaves of dark-grown plants that had beenilluminated for 24 h were bombarded and then exposed to light for 24h (24-48 h) before being incubated with the GUS substrate. (A) ForpMT3', n = 6 (etiolated, 0-24 h), n = 3 (24-48 h). (B) For pBI221,n = 8 (etiolated, 0-24 h), n = 3 (24-48 h). (C) For pMTnos, n = 8(etiolated), n = 6 (0-24 h), n = 3 (24-48 h). (D) For pMT211, n = 3(etiolated, 0-24 h). Data for pMTnos and pBI221 (etiolated and 0-24h) are reproduced from Bansal et al. (6).

in BSC as in MC (Fig. 3A, 24-48 h). Expression in BSC islower than during the 0- to 24-h period of illumination but notas greatly as in MC. Taking into account the behavior of thecontrol CaMV 35S promoter-driven GUS gene (and thesimilar construct using the maize polyubiquitin promoter),expression in BSC may, in fact, be four to six times greaterthan in MC. The construct pMTnos3', in which the 3'rbcS-m3 sequence is placed 3' to the nos terminator se-quence, behaves in the same BSC-preferred (i.e., MC ex-pression suppressed) way as the construct in which the nosterminator is replaced by the rbcS-m3 3' end (see Fig. 5).Thus, BSC-preferred expression involves not only enhance-ment of expression in BSC but also reduced expression inMC. Is the latter effect transcriptional or post-transcrip-tional?These results also demonstrate that a developmental

switch is required for the information in the 550-bp rbcS-m33' end (in the context of the 2.1-kbp rbcS-m3 promoter) to beutilized by leaf cells. Subsequent experiments were per-formed with 24-h greened leaves as starting material forGUSexpression analyses. In the latter experiments the location ofblue spots and their total numbers were determined by optical

Plant Biology: Viret et al.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994)

sectioning (Fig. 4). We found that the MC:BSC ratio of GUSexpression for every construct to be consistent from one shotto the next.The 550-bp 3' End Fragment Controls BSC-Preferred Ex-

pression by a Transcriptional Mechanism. It would be ex-pected that part of the rbcS-m3 3' transcribed sequencewould be included in mRNA expressed from -2.1 rbcS-m3Pr:GUS:rbcS-m3 (pMT3'; Fig. 1) and we have no evidencethat the 3' sequence is or is not represented in transcripts ofpMTnos3'. Reduced expression in MC could result fromsuppressed transcription or because rbcS-m3 3' sequences inthe transcripts reduce their longevity in MC. To investigatethis, another construct was made: in p3'MTnos (Fig. 1) the550 bp from the 3' end ofthe rbcS-m3 is relocated to upstreamofthe -2.1-kbp segment at the 5' end ofpMTnos (Fig. 1). Therelative expression of this gene in MC vs. BSC correspondedto that of pMTnos3' and pMT3' (Fig. 5). Thus, the 550-bprbcS-m3 3' sequence reduces expression in MC by a tran-scriptional, rather than a post-transcriptional, mechanism.The 3' end fragment does not affect expression of GUS

from the CaMV 35S promoter reporter genes (Fig. 5; com-pare pBI221 and pBI2213').GUS Expression Analysis from a 238-bp 3' End Fragment

(+720 to +957 bp). The rbcS-m3 mRNA polyadenylylationsite (determined by rbcS-m3 cDNA sequencing; M. Lebrun,personal communication) is located at +1174 bp within the550-bp rbcS-m3 3' (+720 to +1269 bp) segment (Fig. 2). Thetranslation stop codon is at +733 to +735 bp. To furtherdelineate the regions between +720 bp and + 1269 bp in-volved in regulating rbcS-m3 transcription, the deletion con-struct pMTnosA3' (Fig. 1), which contains a 238-bp fragment(from +720 to +957 bp; Fig. 2B) downstream of a 2.1-kbpPr:GUS:nos chimeric gene, was analyzed for cell-type-preferred expression. We found that the 238-bp fragment wassufficient for relatively stronger repression of expression inMC, as it gave 3.8 times more expression in BSC than in MCand behaved almost identically to the pMTnos3' construct,which contains the full 550-bp 3' end (Fig. 5). This resultindicates that the region of the rbcS-m3 3' end involved insuppressing transcription preferentially in MC lies within thetranscribed portion of the rbcS-m3 gene, between +720 bpand +957 bp relative to the transcription start site.

5' to 3' Deletion Analyses of the 2.1-kbp Pr in the Context ofthe rbcS-m3 3' End. Is the 238-bp sequence in the 3' region ofrbcS-m3 sufficient, together with the basic -211- to +434-bppromoter region, for controlling the transcription of rbcS-m3or are other segments of the 5' portion of the gene alsoinvolved? To investigate the latter, three 5' to 3' promoterdeletion constructs of pMT3' were analyzed. These con-structs, pMT9073', pMT4443', and pMT2113', contain, re-spectively, 907-bp, 444-bp, and 211-bp promoter regionsupstream of the GUS reporter gene followed by the rbcS-m3550-bp 3' end (Fig. 1). Relative expression of pMT9073' inMC vs. BSC resembled that of the pMT3' construct (con-taining the full 2.1-kbp promoter) as well as pMTnos3' and

ec

A

gc

B

FIG. 4. In situ GUS activity revealed by optical sectioning of

maize leaves that had been bombarded with pMT3' DNA. (A) GUSactivity localized in mesophyll cells (mc). (B) GUS activity localizedin bundle sheath cells (bsc). ec, Epidermal cell; gc, guard cell; v,vein. (Bars = 100 pm.)

80C

'D'1LLLJA. I1I LLJMCiBSCO 18.R1 2.3/1 293.5 1)2913 3.8 11 2. 2.4- 29,9Constructsi> XN N

<N

FIG. 5. In situ transient expression of various rbcS-m3:GUSreporter gene constructs and pBI221 in segments of leaves takenfrom dark-grown seedlings after being illuminated for 24 h. Theaverage number (±SEM) ofblue spots in MC, BSC, and all cell types(total) per shot is shown for each chimeric gene and was determinedby optical sectioning observations. Ten-day-old leaves were greenedfor 24 h, bombarded, exposed to light for 24 h, and incubated withthe GUS substrate. For pMT444, pMT2113', pMT4443', pMT9073',pBI221, and pBI2213', n = 3; for pMTnosA3', p3'MTnos, n = 6; forpMTnos3', n = 7.

pMTA3' (Fig. 5). In contrast, expression of both pMT4443'and pMT2113' was twice as great in MC as in BSC, much likepBI221 (Fig. 3B and Fig. 5) and pMTnos (Fig. 3C and Fig. 5).The relative MC:BSC expression of one other construct,pMT444, which includes the same rbcS-m3 5' sequences aspMT4443' but contains the nos terminator instead of therbcS-m3 3' end, resembles that ofpMTnos (Fig. 5). Thus, therbcS-m3 3' end is required together with sequences between-907 to -445 bp for the photoregulated reduction of expres-sion in MC.

DISCUSSIONWe have been investigating how rbcS-m3, a member of therbcS family, comes to be highly expressed in BSC but not inMC upon illumination of dark-grown maize seedlings (3).Using a transient in situ expression assay, we had found thatthe chimeric gene -2.1 rbcS-m3 Pr:GUS:nos (pMTnos, Fig.1) is expressed but not photoregulated in MC during the first24 h of illumination of leaf segments taken from dark-grownseedlings but that expression of this construct is stimulatedby light about 2-fold in BSC in the same period (6). We havenow determined that a reporter gene containing only 211 bp5' and 434 bp 3' to the transcription start site behaves likepMTnos.

Although the rbcS-m3 region -211 to +434 bp is sufficientfor the initial photostimulated expression ofthe reporter genein BSC of dark-grown maize seedlings, neither this sequencenor one extending upstream to -2.1 kbp confers negative orpositive photoresponsiveness on reporter gene expression inMC. A 550-bp region at the 3' end of rbcS-m3 has beenidentified, which, when included in a chimeric reporter genewith the rbcS-m3 sequence from -2.1 kbp to +434 bp, shiftsthe ratio of expression in MC:BSC from 2:1 to 1:2 (Fig. 3).The inclusion ofthe 3' sequence affects expression during thesecond 24 h of greening of dark-grown seedlings but notbefore. Thus, the photoreceptor-signal transduction system,of which the 3' sequence is a part, appears to be incompleteuntil seedlings have been illuminated for a period of hours.The sequence is equally effective whether it is located at the3' end of the transcribed region of the chimeric gene or >2kbp upstream of the transcription start site. Thus, it appears

8580 Plant Biology: Viret et al.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 8581

that photoregulated suppression of rbcS-m3 expression inMC is at least in part transcriptional. In the case of the maizegene cab-ml, which, conversely to rbcS-m3, is expressedpreferentially in MC, certain sequences are required tosuppress expression in BSC and other sequences are requiredfor photostimulated expression inMC (15). Thus, preferentialexpression in MC or BSC of these two genes involves activesuppression of transcription in one cell type and stimulationof transcription in the adjacent cell type. Destruction oftranscripts may well also contribute to establishing the verylow steady-state levels of rbcS-m3 transcripts in MC andrelatively low level of cab-ml transcripts in BSC. Theproduction of rbcS transcripts by MC nuclei in run-offexperiments in vitro (22) also suggests that post-transcrip-tional destruction of the mRNAs may contribute to theabsence of rbcS transcripts from MC of greening maizeleaves.The active 3' sequence that was identified initially extends

from +720 to + 1269 bp relative to the transcription start sitebut a 238-bp segment (from +720 to +957 bp) is sufficient forthe effect. However, the 3' sequence is ineffective unless thechimeric gene also contains the 463-bp 5' region from -907to -445 bp. The expression of chimeric reporter genescontaining rbcS-m3 sequences from -907 to -445 bp andfrom +720 to +957 bp appears to be suppressed inMC duringthe second 24 h that dark-grown maize seedlings are illumi-nated. It is this difference, plus the photostimulated expres-sion in BSC in which rbcS-m3 sequences between -211 bpand +434 bp are involved, that results in relatively highexpression in BSC vs. MC. The precise sequence elementswithin the regions +720 to +957 bp and -907 to -444 bp thatare involved in photoregulation ofrbcS-m3 expression are yetto be identified. A number of cis-acting sequence elementsthat have been described in other plant nuclear genes (17-20)are present (Fig. 2) in the regions ofrbcS-m3 of interest here.It remains to be seen whether these and/or other repeatedsequences in this portion of the gene are control elements.

Photoregulatory elements have been found downstream ofthe transcription start site in other plant genes (23, 24);however, it is not known whether these affect transcriptionor post-transcriptional events. Here we demonstrate that thepresence of the rbcS-m3 3' end in the chimeric gene resultsin the photoregulated suppression of its transcription prefer-entially in MC.

It has been shown that sequences downstream of thetranslation start site oftwo petunia rbcS genes contribute toquantitative differences in their expression, and nuclearrun-on transcription experiments indicated that 3' se-quences affect their transcription rates in light-grown plants(25). Also, tissue-specific expression of the ArabidopsisGLABROUSI gene requires a "downstream enhancer" inconjunction with upstream elements (26). It is possible that3' sequences also may be involved in organ-, tissue-, orlight-regulated expression of rbcS genes of some C3 plantsinasmuch as the C4 habit evolved independently in manyplant families (27).

We thank Peter Quail for the pAHC27 plasmid, Kate Viret andJulie O'Neil for help with typing the manuscript, and Ethan Signer,Sumit Maneewannakul, and Sheng Luan for comments on themanuscript. Y.M. would like to thank Efat Badr for advice and wassupported by a fellowship from Alexandria University in Egypt.J.-F.V. would like to thank Rodolphe Schantz for advice and wassupported by a Lavoisier fellowship from the French Ministry ofForeign Affairs cofinanced by Rh6ne-Poulenc. This work was sup-ported in part by the U.S. Department of Agriculture CompetitiveGrants Program and in part by the NEDO-RITE Program of theGovernment of Japan.

1. Edwards, G. E. & Walker, D. A. (1983) C3, C4: Mechanismsand Cellular and Environmental Regulation ofPhotosynthesis(Blackwell, Oxford).

2. Langdale, J. A., Lane, B., Freeling, M. & Nelson, T. (1989)Dev. Biol. 133, 128-139.

3. Sheen, J. Y. & Bogorad, L. (1986) EMBO J. 5, 3417-3422.4. Langdale, J. A., Zetlich, I., Miller, E. & Nelson, T. (1988)

EMBO J. 7, 3643-3651.5. Lebrun, M., Waksman, G. & Freyssinet, G. (1987) Nucleic

Acids Res. 15, 4360.6. Bansal, K. C., Viret, J.-F., Haley, J., Khan, B. M., Schantz,

R. & Bogorad, L. (1992) Proc. Natl. Acad. Sci. USA 89,3654-3658.

7. Murashige, T. & Skoog, F. (1962) Physiol. Plant. 15, 473-497.8. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab.Press, Plainview, NY), 2nd Ed.

9. Bevan, M., Bames, W. M. & Chilton, M. D. (1983) NucleicAcids Res. 11, 369-385.

10. Henikoff, S. (1984) Gene 28, 351-359.11. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. USA 74, 5463-5467.12. Jefferson, R. A., Kavanagh, T. A. & Bevan, M. W. (1987)

EMBO J. 6, 3901-3907.13. Klein, T. M., Wolf, E. D., Wu, R. & Sanford, J. (1987) Nature

(London) 327, 70-73.14. Klein, T. M., Fromm, M. E., Gradziel, T. & Sanford, J. (1987)

BiolTechnology 6, 559-563.15. Bansal, K. C. & Bogorad, L. (1993) Proc. Natl. Acad. Sci.

USA 90, 4057-4061.16. Jefferson, R. A. (1987) Plant Mol. Biol. Rep. 5, 387-405.17. Kay, S. A., Keith, B., Shinozaki, K., Chye, M.-L. & Chua,

N.-H. (1989) Plant Cell 1, 351-360.18. Castresana, C., Garcia-Luque, I., Alonso, E., Malik, V. S. &

Cashmore, A. R. (1988) EMBO J. 7, 1929-1936.19. Guiltinan, M. J., Marcotte, W. R. & Quatrano, R. S. (1990)

Science 250, 267-271.20. Lam, E. & Chua, N.-H. (1989) Plant Cell 1, 1147-1156.21. Christensen, A. H., Sharrock, R. A. & Quail, P. H. (1992)

Plant Mol. Biol. 18, 675-689.22. Schiffner, A. R. & Sheen, J. (1991) Plant Cell 3, 997-1012.23. Dickey, L. F., Gallo-Meagher, M. & Thompson, W. F. (1992)

EMBO J. 11, 2311-2317.24. Gallo-Meagher, M., Sowinski, D. A., Elliott, R. C. & Thomp-

son, W. F. (1992) Plant Cell 4, 389-395.25. Dean, C., Favreau, M., Bedbrook, J. & Dunsmuir, P. (1989)

Plant Cell 1, 209-215.26. Larkin, J. C., Oppenheimer, D. G., Pollock, S. & Marks,

M. D. (1993) Plant Cell 5, 1739-1748.27. Moore, P. D. (1982) Nature (London) 295, 647-648.

Plant Biology: Viret et al.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 17

, 202

0