Traffic Jam, a large Maf transcription factor, regulates ... · Traffic Jam, a large Maf...
134
Traffic Jam, a large Maf transcription factor, regulates the formation of the germline stem cell niche in the ovary of Drosophila melanogaster by Trupti Panchal A thesis submitted in conformity with the requirements for the degree of master’s of Science Department of Cell and Systems Biology University of Toronto © Copyright by Trupti Panchal 2012
Transcript of Traffic Jam, a large Maf transcription factor, regulates ... · Traffic Jam, a large Maf...
Traffic Jam, a large Maf transcription factor,
regulates the formation of the germline stem cell
niche in the ovary of Drosophila melanogaster
by
Trupti Panchal
A thesis submitted in conformity with the requirements for the degree of master’s of Science
Department of Cell and Systems Biology University of Toronto
© Copyright by Trupti Panchal 2012
ii
Traffic Jam, a large Maf transcription factor,
regulates the formation of the germline stem cell
niche in the ovary of Drosophila melanogaster
Trupti Panchal
Master’s of science
Department of Cell and Systems Biology University of Toronto
2012
Abstract
Cap cells form a niche for 2-3 germline stem cells (GSCs) in a Drosophila ovariole. Cap cells are
organised in a cluster at the base of a terminal filament stalk. The transcription factor Traffic Jam
(Tj) is expressed in cap cells, but not in terminal filament and germline cells. In a hypomophic tj
mutant, cap cells appear to be specified normally. However, their morphology and behaviour
changes and they are integrated into the stalk forming long terminal filaments. This reduces the
niche size. Consequently, on average only 1.5 GSCs are present and are maintained properly. In
tj null mutants, cap cells appear to be transformed into terminal filament cells. The transformed
cells recruit one GSC, but cannot maintain it. Together these data indicate that Tj is required for
the formation of cap cells and their organization into a cluster so that they can support 2-3 GSCs.
iii
Acknowledgments
Thank you Dorothea, I could not have done this without you. Thank you for the opportunity to
pursue research in your lab, I am very lucky. Thank you for your expert guidance over the past
three years, I have learned so much about research and science.
Thank you Dr. Howard Lipshitz, and Dr. Jennifer Mitchell for your expert guidance and help.
Thank you Dr. Ulrich Tepass for being my examiner, while being on Sabbatical! Thank you Dr.
Darius Bägli and Dr. Karen Aitken for the opportunity to purse research in your lab and
believing in me when I had given up on myself.
Gayaanan, you are an amazing friend! Thank you for teaching me how to write, I could not have
written this thesis without your help. Jane and Nicolas, thank you. Thank you guys for taking
care of me for the past three years, cheering me up when I was sad or just listening, and hanging
out. Thank you John, for the fun times and the Hugs!!! Hopefully we get to hangout soon!
Thanks Ritu for inviting us to your place and hanging out, it was super-duper fun and I loved
playing with Tanmay! Thanks Nhat for making it fun; you are always working hard! We need to
play soccer! Thanks Helen for everything! Thanks Jessica Yang for the fun night! We need to get
together for Heena! Thanks Duygu for the fun conversations and the ‘maggot’, I love it! Thanks
Felix for showing me how to use the confocal, I am very grateful. Thanks Sandy for taking us to
see the musical. Thanks Ridhdhi for your help with the antibodies, they always worked! Thanks
Daryl and Hoon for the fun times. Thanks Arun for the game and movie night, it was superduper
fun. Thanks Milena for always being there to help, no matter how busy you are. Thanks Audrey
and Henry for always helping out with the confocal!
iv
Scientific acknowledgements Thank you T. Tabata for the PMad antibody. Thank you D. Drummond Barbosa, M. Van Doren,
Haifa Lin, Howard Lipshitz, M. Siomi, Paul Lasko, Allan Spradling, Ken Howard and Dennis
McKearin for the reagents.
v
Table of Contents
Chapter 1. Introduction
1.1 Drosophila ovarian Germline Stem Cells (GSC) and oogenesis
1.2. The Drosophila female GSC niche: Cap cells
1.3. GSC maintenance and establishment
1.3.1 Dpp activates BMP signaling within GSCs, which silences transcription from the bam
promoter
1.3.2 Regulation of Dpp expression
1.3.3 Cap cell factors that are important for GSC maintenance
1.4. Gonad morphogenesis
1.4.1 Ovarian morphogenesis requires the formation of terminal filaments
1.5. Cap cells
1.5.1 Cap cell maintenance
1.5.2 Notch signaling controls cap cell formation
1.6. Traffic Jam
1.6.1 Expression pattern of Tj
1.6.2 Tj is required for ovarian morphogenesis
1.6.3 tj null mutant adult phenotype
1.7 Research objectives
Chapter 2. Materials and Methods
2.1. Ovary Immunostainings
2.1.1 Collection/Staging of tissues
2.1.2 Staining procedure
vi
2.1.3 Primary antibody list
2.1.4 Statistical analysis
2.2 Molecular characterization of tj39 allele
2.2.1 Genomic DNA isolation
2.2.2 PCR reaction
Chapter 3. Results
3.1. Loss of Tj affects the number of germline stem cells (GSC)
3.1.1 The number of GSCs is reduced in a hypomorphic tj mutant
3.1.2 GSCs are maintained properly in the weak tj mutant
3.1.3 Adult tj null mutant ovaries rarely contain GSCs
3.1.4 tj null mutant ovaries establish fewer GSCs than control ovaries at the prepupal stage
3.2. Loss of Tj affects the morphology, behaviour and expression profile of cap cells
3.2.1 Reduction or loss of Tj function causes formation of abnormally long terminal
filaments
3.2.2 Additional stalk cells express cap cell markers but are organized into a stalk in the
hypomorphic tj mutant
3.2.3 The number of GSCs associated with the cap cells in weak tj mutant ovarioles was
dependent on the three-dimensional organization of the cap cells
3.2.4 Cap cells are not correctly specified in the absence of Tj function
3.2.5 tj null mutant gonads contain additional somatic cell defects
3.2.6 Cap cells can form a cluster in the absence of the germline
3.2.7 Cap cells are organized into a cluster in piwi mutant ovarioles
vii
3.3. Analysis of the relationship between Tj and the Notch signaling pathway
3.3.1 Loss of tj function does not affect expression of components of the Notch signaling
pathway
3.3.2 Notch loss-of-function results in the formation of fewer cap cells that are organised into
a cluster
3.3.3 Ectopic Notch expression and Tj overexpression resulted in different mutant
phenotypes
Chapter 4. Discussion
4.1. Tj is required for the specification and the three-dimensional organization of cap cells
4.2. Reduction or loss of Tj reduces the niche size and consequently the number of GSCs
4.3. tj null mutant ovaries are defective in the maintenance of GSCs
4.3.1 The GSC maintenance defect in tj null mutant ovaries is unlikely caused by a defect in
cap cell-GSC interaction
4.3.2 Loss of Piwi expression in tj null mutants might cause the loss of GSCs, but does not
explain other aspects of the tj null mutant phenotype.
4.4. Notch and Tj appear to act independently in the regulation of cap cell formation
4.4.1 Notch signaling modulates the number of terminal filament cells
4.5. GSCs send out protrusions toward the cap cells
viii
List of Tables
Table 1. List of fly strains
Table 2. Stem cell markers
Table 3. Markers expressed in a cap cell specific manner
Table 4. Comparison of pMAD distribution in tj null mutant and control ovaries
Table 5. Comparison of the total number of terminal filament and cap cell in various genotypes
ix
List of Figures
Figure 1. Overview of the germarium and spatial organization of cells at the tip of the germarium
and in prepupal ovaries.
Figure 2. Signaling pathways within cap cells and germline stem cells
Figure 3. Average number of GSCs in control and tj39/tjeo2 (weak) mutant germaria
Figure 4. Weak tj mutant germaria contain reduced number of GSCs
Figure 5. The GSCs in weak tj mutant germaria do not express bam-GFP, a marker for
differentiating cystoblasts.
Figure 6. Average number of GSCs in control (bam-GFP) and weak tj (tj39/tjeo2; bam-GFP)
mutant germaria on Day2, 14 and 21
Figure 7. The GSCs in weak tj mutant germaria receive Dpp signaling indicated by the presence
of nuclear pMAD.
Figure 8. tj null mutant adult ovaries contain germline clusters adjacent to terminal filaments that
contain cells with a spherical spectrosome.
Figure 9. Adult tj null mutant ovaries rarely contain germline cells with nuclear pMAD.
Figure 10. Prepupal tj null mutant gonads contain GSC-like cells based on the lack of bam-GFP.
Figure 11. Prepupal tj null mutant ovaries establish very few GSC-like cells.
Figure 12. tj mutants contain abnormally long terminal filaments, containing additional stalk
cells.
Figure 13. Weak tj mutant (tj39/tjeo2) mutants contain additional stalk cells that are positive for
Traffic jam.
Figure 14. The additional stalk cells in weak tj mutant germaria express markers in a cap cell
specific pattern.
x
Figure 15. Additional stalk cells in the tj null mutant show an abnormal expression of LaminC
and B1-93F-lacZ.
Figure 16. The additional stalks cells in tj null mutant show abnormal expression of Bab2 and
1444-lacZ.
Figure 17. The cap cell marker 1444-lacZ is not detected in tj null mutant prepupal ovaries.
Figure 18. The additional stalk cells in tj null mutant pupal ovaries lack cap cell-typical
expression of markers.
Figure 19. Prepupal tj null mutant ovaries show the transformed cap cells behave like terminal
filament cells.
Figure 20. Both piwi and agametic (tudor) mutant germaria contain a reduced number of cap
cells that are organised into a cluster.
Figure 21. In tj mutant prepupal ovaries, Piwi expression is abolished in the additional stalk cells.
Figure 22. The additional stalk cells in tj null mutant prepupal ovaries show expression of Delta
and E(spl)mβ-CD2 in a cap cell specific manner.
Figure 23. The effects of Notch and Tj overexpression and Notch loss-of-function on cap cell
morphology and numbers.
Figure 24. Model for the function of Tj in cap cell specification and differentiation.
Figure A1. Molecular analysis of tj39.
Figure A2. Transgenic Tj rescues the weak tj mutant phenotype
xi
List of Appendices
1. Characterization of the tj39 allele
1.1 Molecular analysis of tj39
1.2 Phenotypic analysis of tj39 and tj-Gal4
1.3 Expression of full-length exogenous Tj was able to rescue the tj-Gal4/tjeo2 mutant
phenotype.
1
Chapter 1 Introduction
1.1. Drosophila ovarian Germline Stem Cells (GSC) and
oogenesis The Drosophila ovary is made of 16-20 repetitive structures called ovarioles (Reviewed in Lin,
1997). Each ovariole consists of a single germarium and a series of developing egg chambers.
Researchers knew that the ovariole functions as an assembly line for oogenesis: the process of
oocyte production (reviewed in King, 1970; Spradling, 1993); however, the source of the cells
that would provide a constant supply of precursors for oocyte production remained unknown for
a long time. King and colleagues postulated that the anterior tip of a germarium contains stem-
cell oogonia that undergo asymmetric divisions to produce a daughter cell that will give rise to
an oocyte (Kosh and King, 1966; Reviewed in Li and Xie, 2005). About a decade later two
articles proposed the existence of 2-3 Drosophila ovarian germline stem cells (GSCs) (Fig. 1;
Schüpbach et al., 1978; Wieschaus and Szabad, 1979). Finally, three decades later Lin and
Spradling (1993) discovered that 2-3 GSCs-undergoing self-renewing divisions-reside at the
anterior tip of a germarium (Reviewed in Li and Xie, 2005). When GSCs divide, one cell
remains within the niche and the second daughter cell exits the niche (Lin and Spradling, 1997;
Xie and Spradling, 2000). The daughter cell that remains within the niche retains the stem cell
properties whereas the other daughter cell called the cystoblast is displaced away from the niche
and turns on a differentiation program that will eventually give rise to an oocyte (Lin and
Spradling, 1997). This differentiation program begins with the expression of gene bag-of-
marbles (bam) (McKearin and Ohlstein, 1995; Ohlstein and McKearin, 1997).
2
Figure 1. Overview of the germarium and spatial organisation of cells at the tip of the
germarium and in prepupal ovaries. The tip of a Drosophila ovariole consists of a germarium.
The tip of the germarium consist of terminal filament cells that are aligned in a single row and
stacked on top of one another to form a stalk. At the base of terminal filament a cluster of non-
aligned cells called the cap cells form a niche for 2-3 germline stem cells (GSC). Unlike terminal
filaments, cap cells reside within the germarium. The GSCs are followed by cystoblasts, the
differentiating daughter cell of GSCs. Both the GSCs and the cystoblast contain a structure
called the spectrosome. The transit amplifying progeny of the cystoblast are called the
cystocytes. The cystocytes consist of 2-cell, 4-cell, 8-cell and 16-cell interconnected cysts. The
spectrosome in the cystocytes takes on various forms and is called a fusome. In the adult ovary,
the cap cells are followed by a group of somatic cells with triangular nuclei called the escort
cells. In the prepupal ovary, the undifferentiated somatic cells surrounding the germline cells are
called the interstitial cells. The organisation of terminal filaments and cap cells is similar to the
adult ovaries. Once the cap cells (non-aligned cells at the base of terminal filaments) have
formed, they recruit the underlying primordial germ cells (PGCs) to become germline stem cells.
The PGCs in the rest of the gonad start differentiation (cystocytes) as seen in the schematic.
3
4
Once bam is up-regulated the cystoblast undergoes four rounds of divisions with incomplete
cytokinesis to yield 2-cell, 4-cell, 8-cell and 16-cell cysts. The cells within a cyst are called
cystocytes (Fig. 1; Reviewed in Kirilly and Xie, 2007). At the posterior end of the germarium,
the 16-cell cysts get encapsulated by the follicular epithelium and bud off to form a separate egg
chamber (Kirilly and Xie, 2007).
1.2. The Drosophila female GSC niche: Cap cells
Attached to the distal end of the germarium is the terminal filament in each ovariole. The
terminal filament consists of 7-9 disc-shaped terminal filament cells that are stacked on top of
each other to form a stalk (Fig. 1; Godt and Laski, 1995; Sahut-Barnola et al., 1995). Posterior to
the terminal filament at the tip of the germarium is a group of 6-7 somatic cells, which are
roundish in shape, adhere to one another forming an irregular cluster (Fig. 1; Godt and Laski,
1995; Sahut-Barnola et al., 1995; Lin and Spradling, 1997; Song et al., 2007). These somatic
cells, called the cap cells form a niche for GSCs (Xie and Spradling, 2000; Ward et al., 2006;
Song et al., 2007). Posterior to cap cells and adjacent to GSCs and their transit amplifying
daughters, the third group of somatic cells, called the escort cells or inner germarial sheath cells
send out long cellular processes that wrap around individual GSCs and their daughter cystoblast
and cystocytes (Fig. 1; Schulz et al., 2002; Decotto and Spradling, 2005). So how do we know
that a population of somatic cells is controlling the existence and maintenance of GSCs?
In 1979, Schofield proposed the ‘niche’ concept: stem cells reside in a microenvironment
comprising of somatic support cells. These somatic support cells provide specific factors to stem
cells and thus regulate stem cell self-renewal and maintenance. The Drosophila ovarian GSCs
reside at the anterior tip of the germarium (Lin and Spradling, 1993). To characterize the support
cells that regulate these GSCs, Lin and Spradling (1993) focused on the surrounding group of
5
somatic cells as possible candidates for niche cells. If one such population existed, their
elimination would result in GSC loss. To see whether terminal filament cells form a niche for
GSCs, they eliminated these cells through laser ablation. Eliminating terminal filaments did not
result in GSC loss. To the contrary, they discovered that loss of terminal filaments increased the
rate of GSC division. Almost four decades after the initial discovery of GSCs, Xie and Spradling
(2000) postulated that among the three somatic cell populations that surround the GSCs, cap
cells form a niche for GSCs. Song and colleagues (2007) provided additional evidence for this
hypothesis because they show that ectopic cap cells without terminal filaments are able to
support the establishment and maintenance of GSCs. Furthermore, the ability of the niche to
reprogram differentiating cystocytes into stem cells demonstrates the power of the stem cell
niche (Kai and Spradling, 2004).
In recent years, the function of cap cells as a niche for GSCs has been intensively investigated
(Reviewed by Li and Xie, 2005; Kirilly and Xie 2007). Firstly, they restrict the anatomical
location of GSCs because cap cells are always restricted to the anterior tip of the germarium, but
posterior to the terminal filaments. Secondly, cap cells physically anchor GSCs via DE-cadherin-
based adherens junctions (Song et al., 2002). Both, DE-cadherin and Armadillo (Arm),
Drosophila ß-catenin, are highly concentrated at the GSC-cap cell interface. GSC clones mutant
for DE-cadherin exit the niche and in the absence of DE-cadherin GSCs are not established.
Thus, the physical contact between GSCs and cap cells allows cap cells to directly communicate
with GSCs to control their entry and exit from the niche. Thirdly, the direct physical contact
imparts an asymmetric structure that guides the division plane of GSCs, ensuring one daughter
cell remains within the niche while the second is displaced away from the niche (Deng and Lin,
1997). Lastly, the niche secretes diffusible molecules that act on GSCs to regulate their self-
renewal and thus their maintenance. Decapentaplegic (DPP), a BMP 4 signaling protein is one
6
such diffusible factor that is required and sufficient for GSC maintenance (Xie and Spradling,
1998). More specifically, Dpp signaling leads to the repression of differentiation promoting
genes within GSCs, thus allowing their self-renewal (Chen and McKearin, 2003; Song et al.,
2004).
1.3. GSC maintenance and establishment
1.3.1 Dpp activates BMP signaling within GSCs, which silences
transcription from the bam promoter
The niche must provide GSCs with factors either secreted or membrane-bound that guide stem
cell behaviours, such as GSC division and self-renewal (Schofield, 1978). One such niche factor,
Dpp, a BMP4 related factor is an essential extracellular signal (Xie and Spradling, 1998;
Reviewed in Chen et al., 2011). Overexpression of Dpp leads to an expansion of the GSC-like
cells. Conversely in Dpp mutants, GSCs loss was significantly accelerated (Xie and Spradling,
1998). Thus, a constant supply of Dpp from the niche ensures the self-renewal and maintenance
of GSCs (reviewed in Chen et al., 2011; Harris and Ashe, 2011). When Dpp binds to the TGF-ß
receptors on GSCs, ligand binding results in dimerization of the receptors and the receptors
phosphorylate each other. Then the phosphorylated receptor phosphorylates the transcription
factor Mothers against Dpp (MAD). Phosphorylated MAD (pMAD) associates with Medea in
the cytoplasm and this pMAD/Medea complex translocates to the nucleus (Fig. 2). It binds to
silencer elements on the bam promoter (Fig. 2). Thus, the function of BMP signaling is to repress
bam transcription and thereby prevent the differentiation of GSCs (Chen and McKearin, 2003;
Song et al., 2004). Hence, the maintenance of resident GSCs is determined by the presence of
BMP signaling. When the BMP signaling is active, pMAD localizes to the nucleus and bam
expression is turned off (Fig. 2). Contrary to GSCs, the cystoblasts leave the niche and as a result
7
Figure 2. Signaling pathways within cap cells and germline stem cells. Germline stem cells
(GSCs) are physically anchored to cap cells via DE-cadherin adherens junctions. Cap cells utilise
Jak-Stat signaling to express Dpp. The secreted Dpp binds to the receptors on GSCs and
activation of the Dpp signaling within GSCs results in the phosphorylation of MAD (pMAD).
pMAD associates with MEDEA in the cytoplasm. The complex translocates to the nucleus and
binds to the silencer elements on bam promoter, thereby ensuring bam expression is turned OFF
in GSCs. The cystoblast are the immediate differentiated progeny of GSCs. Because the
cystoblast reside one cell diameter away from the cap cells, they do not receive enough Dpp. As
a result MAD is not phosphorylated and does not translocates to the nucleus. The absence of
pMAD-MEDEA complex from the silence elements on the bam promoter results in de-
repression of the bam expression. Thus, the absence of Dpp signaling turns ON bam expression
in the cystoblast.
8
9
do not receive a high level of Dpp. Together with intrinsic mechanisms (reviewed in Zhang and
Xie, 2008) BMP signaling is inactivated in cystoblasts, which allows for de-repression of the
bam promoter (Fig. 2). The absence of BMP signaling in cystoblasts is indicated by an absence
of nuclear pMAD and bam up-regulation. Overexpression of bam results in depletion of GSCs
(Ohlstein and McKearin, 1997). Conversely, in bam mutants GSC-like cells accumulate
throughout the germarium in addition to the normal GSCs (McKearin and Ohlstein, 1995). These
results indicate that expression of Bam protein is required to initiate the cystoblast differentiation
program.
Given that cap cells form the niche for GSCs, this would suggest that cap cells must produce and
secrete Dpp. However, in situ hybridizations have shown that several cell types, including
terminal filament cells, cap cells and escort cells express the Dpp mRNA (Xie and Spradling,
2000; Wang et al., 2008). A recent paper found that cap cells can induce Dpp expression in
escort cells (Rojas-Ríos et al., 2012). Hence, the anterior half of a germarium contains several
somatic cell types that express Dpp. It is not known if all three somatic cell populations that
produce the Dpp mRNA also produce an active Dpp protein at the same level as cap cells or
whether cap cells produce more Dpp. This raises the question as to how is this niche factor
accessible to GSCs only? It came as a surprise when researchers discovered that Dpp functions
as a short-range signal. Studies over the last decade have uncovered several mechanisms that
restrict the range of Dpp signaling (reviewed in Chen et al., 2011). One mechanism that spatially
restricts Dpp diffusion and thus its accessibility involves extracellular matrix molecules. In
particular, Division abnormally delayed (Dally), a heparin sulphate proteoglycan, secreted from
cap cells, stabilizes and concentrates Dpp near the niche. Interestingly, GSCs themselves
contribute to Dpp accessibility. GSCs suppress dally expression in escort cells (Liu et al., 2010).
So that even though Dpp is made by several somatic cells in the anterior germarium, its
10
concentration is not sufficient to activate BMP signaling in the cystoblast and the posterior
cystocytes. The cystoblast that resides only one cell diameter away from the niche cannot tap
into a sufficient pool of Dpp.
The mechanisms that regulate GSC maintenance in the adult ovary also operate on primordial
germ cells (PGCs) to prevent their differentiation until the prepupal stage (Gilboa and Lehmann,
2004). The PGCs are undifferentiated germ cells. Unlike the larval gonads, where the
distribution of Dpp is much more widespread, in the prepupal gonads, Dpp expression becomes
more prominent and stronger in the newly formed terminal filament and cap cells while the
remaining somatic cells stop expressing Dpp (Sato et al., 2010). As a result, only the
anteriormost row of PGCs are protected from the expression of differentiation promoting genes.
This timing coincides with GSC recruitment and establishment. The second row of PGCs and
beyond are intermingled with somatic cells that do not express Dpp (Sato et al., 2010).
Therefore, these PGCs fail to receive BMP signaling and begin differentiation.
1.3.2 Regulation of Dpp expression
Dpp is an essential factor for GSC maintenance. This brings me to the next point about how Dpp
is transcriptionally regulated and what pathways regulate its secretion. Ectopic expression of
Upd, a Jak-Stat ligand, in somatic cells of the germarium resulted in accumulation of GSC-like
cells (Decotto and Spradling, 2005). The mechanism for the accumulation of these GSC-like
cells was later explained by the findings from two groups (Lopez-Onieva et al., 2008; Wang et
al., 2008). Their data support the view that Jak-Stat signaling regulates Dpp transcription within
cap cells. GSC loss was accelerated when Jak-Stat signaling was reduced, and GSCs juxtaposed
to a cap cell clone mutant for Jak-Stat pathway components underwent precocious
11
differentiation; further supporting the critical role of cap cells as a GSC niche (Wang et al.,
2008).
Dpp produced by escort cells is functionally relevant and also contributes to GSC maintenance.
Rojas et al. (2012) discovered that Engrailed, a transcription factor, regulates Hedgehog
production in cap cells. Cap cells extend Hedgehog-coated filopodia to activate Dpp
transcription in the adjacent escort cells. When Rojas et al. (2012) generated engrailed or
hedgehog mutant cap cells or abrogated the transduction of the Hedgehog pathway in escort
cells, they found a reduction in GSC number because GSCs were precociously undergoing
differentiation. These findings further highlight the role of cap cells as a niche for GSCs because
the factors- Engrailed and Hedgehog- from cap cells are required for upregulation of Dpp in the
escort cells.
1.3.3 Cap cell factors that are important for GSC maintenance
In addition to Dpp, cap cells express other factors: Yb, hedgehog, engrailed, and piwi that also
contribute to GSC maintenance (reviewed in Kirilly and Xie, 2007). Yb regulates piwi
expression in cap cells (King et al., 2001). Both germline cells and somatic cells express Piwi.
However, only somatic Piwi is important for GSC self-renewing divisions. Klenov et al. (2012)
have shown that it is the cytoplasmic Piwi and not the nuclear Piwi in somatic niche cells that
regulates GSC maintenance.
Yb also regulates Hedgehog expression in cap cells (King et al., 2001). Exogenous expression of
Hedgehog can rescue the Yb and piwi mutant GSC maintenance defect (Smulders-Srinivasan et
al., 2010). Rojas et al. (2012) showed that cap cells extend Hedgehog-coated filopodia to
activate Dpp transcription in the adjacent escort cells. They also found that as mentioned above
Engrailed regulates Hedgehog production within cap cells. Smulders-Srinivasan et al. (2010)
12
discovered another factor Corto, a chromatin factor that is able to rescue the GSC maintenance
defect in Yb and piwi mutants. Corto expression restored Hedgehog expression in Yb mutant cap
cells. piwi mutants are not defective in the production of Hedgehog and thus, the mechanism for
the Corto-mediated rescue of GSC maintenance defect in piwi mutants is unknown (Smulders-
Srinivasan et al., 2010). To summarise, hedgehog expression in cap cells seems to be regulated
by Yb, Engrailed and Corto. These findings further highlight the role of cap cells as a niche for
GSCs because Hedgehog signaling from cap cells is required for activation of Dpp in the escort
cells.
1.4. Gonad morphogenesis
During embryogenesis, primordial germ cells (PGCs) make contact with somatic gonadal
precursor cells (SGPs) to form a gonad (reviewed in Saffman and Lasko, 1999). The SGP cells
give rise to all the different somatic cell populations in adult gonads. The SGPs intermingle with
and wrap the PGCs to form a compact gonad. This ball of cells consisting of two different cell
populations continues to proliferate during larval stages where a feedback loop between the two
populations coordinates growth, and accordingly gonad size (Gilboa and Lehmann, 2006).
During the 3rd instar larval to prepupal stage, cell specification, rearrangement and migration
dramatically transform the gonads and essentially shape the ovariole structure seen in the adults
(Godt and Laski, 1995). Ovariole morphogenesis begins with the formation of terminal filaments
(King, 1970; Godt and Laski, 1995). Terminal filaments begin to form at the third instar larval
stage (Godt and Laski, 1995). Once terminal filament formation is complete, cap cells begin to
form at the base of terminal filament stalks during the larval to pupal transition (Sahut-Barnola et
al., 1995; Song et al., 2007). At the prepupal stage, cap cells (also called germarial tip cells)
begin to recruit GSCs from the underlying pool of PGCs, which are intermingled with somatic
13
interstitial cells (Fig 1; Zhu and Xie, 2003). PGCs not destined to become GSCs begin to
differentiate and give rise to the first eggs that the fly produces (Fig 1.). After terminal filament
formation, but prior to cap cell formation, a subpopulation of the apical somatic cells begins their
downward migration (King, 1968). They migrate between the terminal filament stacks and lay a
foundation of extracellular matrix molecules to compartmentalize the spherical gonad into
ovarioles, the structure that we see in adults. Lastly, during the pupal and adult stage, GSCs are
maintained through self-renewing divisions (Xie and Spradling, 1998). The terminal filaments
and cap cells are terminally differentiated and do not proliferate in the pupal and adult gonads
(King, 1970; Godt and Laski, 1995; Song et al., 2007).
1.4.1 Ovarian morphogenesis requires the formation of terminal
filaments
In agametic mutants that lack a germline, ovariole morphogenesis and terminal filaments seem to
be normal. This observation led King and colleagues (1968) to propose that somatic cells
orchestrate ovary morphogenesis and that formation of terminal filaments lies at the heart of this
morphogenetic process. Godt and Laski (1995) showed that terminal filament form through a cell
intercalation process at the boundary between apical somatic cells and posterior PGCs during the
third instar larval stage (Godt and Laski, 1995).
Factors required for terminal filament formation include Bric-á-brac (Bab) transcription factors
Bab1 and Bab2 (Godt and Laski, 1995; Couderac et al., 2002). Bab proteins are expressed in
terminal filament and cap cells of developing gonads. bab mutant females are sterile and their
gonads are not divided into ovarioles. Apart from Bab proteins, the two signaling pathways
known to regulate terminal filament formation include the Ecdysone receptor-mediated and the
14
Hippo signaling pathways. Ecdysone hormone-mediated signaling regulates the developmental
timing of ovarian morphogenesis through regulation of terminal filament formation (Gancz et al.,
2011). Sarikaya et al. (2012) discovered the second signaling pathway regulating terminal
filament formation: the Hippo pathway. Knockdown of Hippo pathway kinases Hippo and Warts
results in an increased number of terminal filament stalks that was attributed to an increase in the
total number of terminal filament cells.
1.5. Cap cells
1.5.1 Cap cell maintenance
Hsu and Drummond-Barbosa (2009) have reported that Drosophila insulin receptor (dinr)
mutants eclosed with fewer cap cells and these cap cells were being lost much faster compared to
wild type. Thus, Dinr-mediated signaling is important for cap cell maintenance and possibly
formation. Their analysis suggested an interaction between Dinr and Notch. When Notch was
reduced in Dinr mutants a further decrease in cap cell numbers was observed compared to a Dinr
mutant with normal Notch levels. Furthermore, ectopic Notch expression in dinr mutants rescued
the cap cell numbers and maintenance. Since Delta from GSCs and terminal filaments have been
reported to regulate the formation of cap cells (see section below), Hsu and Drummond-Barbosa
(2011) extended the analysis to show that Dinr was not regulating cap cell numbers by regulating
Notch ligand or receptor expression in either terminal filaments or GSCs. More specifically, they
proposed that insulin-mediated signaling likely acts upstream of Notch within cap cells and that
dinr was required cell-autonomously in cap cells during development and adulthood.
1.5.2 Notch signaling controls cap cell formation
Song and colleagues (2007) discovered that Notch signaling is required and sufficient for cap
cell formation. Notch signaling is distinct from many other signaling pathways because Notch
15
ligands and their receptor are transmembrane proteins and Notch pathway activation requires
direct cell-cell contact. Drosophila contains two Notch ligands: Delta and Serrate. When a ligand
binds to the Notch receptor in the adjacent cell, it results in proteolytic cleavage of the Notch
intracellular domain (NICD). The NCID translocates to the nucleus and modulates the
expression of downstream target genes (Reviewed in Guruharsha et al. 2012). Within the
developing gonads, Delta is highly expressed in the developing terminal filaments and weakly in
GSCs and cap cells. Notch protein is expressed highly in terminal filaments, cap cells, and
somatic interstitial cells. Notch signaling is active in terminal filament and cap cells. The somatic
interstitial cells do not show Notch activation or Delta expression. Thus, it seems terminal
filament and cap cells show a similar pattern for Notch expression and activation (Song et al.,
2007).
Ectopic Notch activation during the larval to pupal transition results in formation of extra and
ectopic cap cells (Ward et al., 2006; Song et al., 2007). Notch signaling acts alongside other
factors that are present only during the larval to pupal transition because ectopic Notch activation
at earlier or later stages does not induce the formation of extra cap cells. Transgenic expression
of the NCID, a constitutively active form of Notch in somatic cells of the larval ovary results in
formation of additional and ectopically located cap cells. These induced cap cells can support
additional GSC-like-cells that divide like stem cells and yield differentiating progeny, indicating
that these GSC-like-cells function similar to wild-type GSCs. When Notch temperature-sensitive
mutants are kept at the restrictive temperature, one week old adult ovaries contained a reduced
number of cap cells, suggesting Notch signaling is also required for cap cell maintenance in
addition to establishment.
16
Cap cells form between terminal filaments and the population of PGCs intermingled by and
somatic interstitial cells (Sahut-Barnola at al., 1995). Both terminal filaments and PGCs express
Delta. Given that Notch signaling requires direct cell-cell contact, terminal filaments and PGCs
would make excellent candidates for ligand presentation to the cells that develop into cap cells.
Consistent with this hypothesis, Hsu and Drummond Barbosa (2011) demonstrated that ovaries
in which the basal terminal filament cells were mutant for Delta contained a reduced number of
cap cells, but did not result in cap cell elimination. They highlighted the specific role of basal
terminal filament cells in cap cell formation because a normal number of cap cells developed
when non-basal terminal filament cells were mutant for Delta. This requirement of terminal
filament presence for cap cell formation is also corroborated by observations made by Gancz and
colleagues (2011). When ecdysone signaling was abrogated during the larval to pupal transition
terminal filaments did not form. In the absence of terminal filaments cap cells did not form. In
contrast, cap cells formed precociously when terminal filaments formed prematurely, further
emphasizing the significance of terminal filament presence for cap cell formation.
GSCs can also induce cap cell formation because overexpression of Delta in the germline results
in formation of extra and ectopic cap cells (Ward et al., 2006). However, when Ward and
colleagues generated GSC clones mutant for Delta, they did not observe a reduction in cap cell
numbers. It is important to note that transgenic expression of the NCID in germline cells did not
lead to an increase in cap cell numbers, emphasizing that GSCs act on the sending side of the
Notch pathway and not the receiving side. So where do cap cells come from? Song and
colleagues (2007) proposed that they might come from the interstitial cells in the developing
gonads as also escort cells are thought to do. Although cap cells and escort cells might derive
from a common progenitor population, cap cell formation is dependent on Notch activation
specifically at the larval to pupal transition stage. Transgenic expression of the NCID in
17
differentiated escort cells did not increase the cap cell number (Song et al., 2007). Whether the
interstitial cells are indeed the endogenous source of cap cells is still unknown.
1.6. Traffic Jam 1.6.1 Expression pattern of Tj
In the adult ovariole and pupal ovary, Tj is expressed in all the somatic cells that contact the
germline (Li et al., 2003). This includes the cap cells and the escort cells. Terminal filaments and
germline cells do not express Tj. Likewise, during the larval to pupal transition, both terminal
filaments and germline cells do not express Tj, but cap cells and interstitial cells are positive for
Tj (Li et al., 2003; Gilboah and Lehmann, 2004). The somatic cells intermingled with the PGCs
are called the interstitial cells (Fig 1.).
Tj is a large Maf transcription factor that localises to the nucleus (Li et al., 2003). Tj protein
consists of several domains. Tj has two DNA binding domains, a basic DNA binding domain and
the ancillary DNA binding domain. The leucine zipper domain at the C-terminus allows for
protein interaction. Tj is the only large Maf transcription factor in Drosophila (Li et al., 2003).
1.6.2 Tj is required for ovarian morphogenesis
Tj is required for proper ovarian morphogenesis (Li et al., 2003). In tj null mutant embryonic
gonads, there is a defect in cell intermingling. In contrast to wild type, where PGCs are
intermingled by SGPs, in tj mutants, the SGPs sort out to the periphery and the PGCs cluster
together in the middle. Hence, the germline-soma interactions are abnormal. However, the SGPs
appear to be specified normally ruling out the possibility that the defect in intermingling was a
consequence of SGP cell transformation. Steinberg (1963) showed that cell sorting phenotypes
can be caused by the differential expression of cell adhesion molecules. This is illustrated by the
work of Jenkins et al. (2003). When they overexpressed DE-cadherin in the PGCs, PGCs
18
clustered together and sort to the inside of the gonad; while the SGPs sorted to the outside and
formed a layer surrounding the PGC cluster. This phenotype is analogous to the tj mutant
embryonic gonad phenotype, and highlights the importance of cell adhesion molecules in
mediating cell-cell interaction. tj mutant larval gonads also show a pronounced segregation
between PGCs and interstitial cells (Li et al., 2003). In addition, tj null mutant larval ovaries
were much smaller in size and contained a reduced number of PGCs compared to wild-type
larval ovaries.
Another example where Tj influences germline-soma interactions is seen when Li et al. (2003)
removed Tj function from follicle cells. The tj mutant follicle cell clones sorted out of the
follicular epithelium and showed aberrant expression of some cell adhesion molecules: they
upregulated DE-cadherin, Fasciclin III, and failed to downregulate Neurotactin.
1.6.3 tj null mutant adult phenotype
tj mutant flies are sterile and contain rudimentary gonads (Schüpbach and Wieschaus, 1991; Li et
al., 2003). The ovary is not compartmentalized into ovarioles, and follicle cells that normally
form an epithelium around the 16-cell germline cysts appear to be missing. Terminal filaments,
however develop rather normally.
With respect to the germline, occasionally some ovaries contained germline clusters of irregular
size; however there was always a severe reduction in the number of germline cells (Li et al.,
2003). Many ovaries lacked a germline altogether. Li et al. (2003) ruled out the possibility that
Tj is required in the germline by analyzing GSC clones mutant for tj. When ovaries contained
GSC clones mutant for tj, the overall organization of the ovary was not defective. In addition, the
tj mutant GSC clones differentiated into normal looking follicles, showing that Tj is not required
19
in the germline for oogenesis (Li et al., 2003). Hence, in tj mutants the effect on the germline is
indirect and mediated through defects in one or more somatic cell populations.
1.7. Research objectives
Cap cells form a niche for 2-3 GSCs. Why does the Drosophila female GSC niche support 2-3
GSCs? Does the organisation of cap cells determine the GSC numbers? What factors determine
the number and specification of cap cells? How are cap cells organised into a cluster? Our lab
has discovered a factor Traffic Jam (Tj) that is expressed in cap cells, but not in cells of the
terminal filament and the germline. My analysis aims to answer those questions by investigating
the function of Tj in cap cells.
Aim 1: Tj is a soma specific factor not needed in the germline. Preliminary analysis had
suggested that a reduction in Tj caused a reduced number of GSCs. To determine whether Tj was
required in the GSC niche for either GSC establishment or maintenance or both, I counted the
total number of GSCs in the adult and pre pupal tj mutant ovaries. My analysis showed that a
decrease in Tj reduced the number of GSCs from 3 to 1. However, the remaining GSCs were
maintained properly. In comparison, the tj null mutant adult ovaries only occasionally contained
GSCs. My analysis finds that in the absence of Tj function fewer GSCs were established, and
these GSCs were lost prematurely. This suggests that Tj is required in the GSC niche for both
GSC establishment as well as maintenance.
Aim 2: Preliminary analysis had suggested that tj mutants contained abnormally long terminal
filaments. This is interesting because Tj is not expressed in terminal filaments. To understand
this phenotype and to determine the function of Tj in cap cells, I investigated how terminal
filaments and cap cells were affected in tj mutant ovaries. My analysis found that a reduction in
Tj altered the organisation of cap cells where they were organised into a stalk instead of a cluster.
20
Based on the available markers, my data suggest that these cells are specified as cap cells even
though they take on a different morphology. The addition of cap cells at the bottom of stalks
resulted in the formation of abnormally long terminal filaments. Furthermore my analysis
showed that, unlike a reduction in Tj, the absence of Tj, has a more pronounced effect on cap
cells: cap cells appear to be transformed into terminal filaments. Thus, my data suggest that Tj is
needed for the formation and morphogenetic behaviour of cap cells. We propose that in the
absence of Tj, terminal filament cell fate is the default fate for cap cells.
Aim 3: Lastly, I investigated whether Tj interacts with other factors within cap cells, in
particular Piwi and Notch.
(a) Piwi in cap cells is important for GSC maintenance (Cox et al., 1998; Klenov et al., 2011).
Interestingly, Piwi expression depends on Tj in the larval somatic interstitial cells (Saito et al.,
2011). Given these findings, I asked whether the GSC maintenance defect in tj null mutants was
due to a loss of Piwi expression in tj mutant cap cells. Piwi expression was indeed eliminated
from the transformed cap cells in tj mutants, which could be responsible for the GSC
maintenance defect observed in tj mutants. This finding led me to ask whether loss of Piwi was
also responsible for the cap cell morphology and specification defect observed in tj mutants. To
answer this question I characterised the terminal filament and cap cells in piwi mutants. I found
that unlike tj mutants, piwi mutants contained a reduced number of cap cells that were positive
for Tj. Importantly, these cap cells were organised into a cluster. Hence, my analysis suggests
that loss of Piwi from the somatic cells of tj mutants was unlikely the cause for the observed cap
cell morphology and specification defects in tj mutants.
(b) During the larval to pupal transition, Notch signaling induces cap cell formation (Ward et al.,
2006; Song et al., 2007; Hsu and Drummond Barbosa, 2011). To determine whether Tj and
21
Notch regulate cap cell formation independently or act in concert, I analysed Notch and Tj gain-
of-function and loss-of-function ovaries. I report for the first time that absence of Notch can
result in a severe reduction or loss of cap cells. More importantly, remaining cap cells were
organised into a cluster and positive for Tj. Ectopic Notch activation resulted in the formation of
extra cap cells that were organised into a cluster as previously reported, and I showed that these
extra cells were positive for Tj. My results indicate that Tj overexpression, unlike Notch
overexpression, did not result in the formation of extra cap cells. Furthermore, I found that the
transformed cap cells in tj mutants showed Delta expression and Notch activation similar to
wild-type cap cells, suggesting that Tj may not be required to induce their expression.
To summarise, Notch appears to be important for regulating the number of cap cells, while Tj
appears to be required for their specification and morphogenetic behaviour. Thus, collectively
my data suggest that Tj and Notch likely act independently in parallel pathways to regulate cap
cell formation.
22
Chapter 2. Materials and Methods
Table 1. Fly strains
Element Genotype (Chromosome) Description Reference tj39 tj39/ CyO, Kr-Gal4 UAS-GFP A hypomorphic P-element
excision allele Alchits and Godt, unpublished
tjeo2 b tjeo2 cn / CyO, Kr-Gal4 UAS-GFP
A genetic null, isolated from a female sterile screen
Schüpbach and Wieschaus, 1991; Li et al., 2003;
tjz4735 tjz4735cn bw/ CyO, Kr-Gal4 UAS-GFP
A genetic null, isolated from a male sterile screen
Li et al., 2003; Wakimoto et al., 2004
tjDf1 tjDf1/ CyO, Kr-Gal4 UAS-GFP A mRNA null allele Poon and Godt, unpublished
bam-GFP [w+bamP702-GFP] GFP gene driven by bam promoter
Chen and McKearin, 2003
B1-93F-lacZ
w; P{lacW} B1-93F(III) P-LacZ reporter construct is expressed strongly in terminal filaments and weakly in cap cells
Ruohola et al., 1991
babA128-lacZ
babA128 Enhancer trap line that is expressed strongly in terminal filament and cap cells
Bellen et al., 1989; Godt et al., 1993
tjeo21444-lacZ
b tjeo2 PZ hv(2)1444/ used in trans to CyO and b CyO, Kr-Gal4 UAS-GFP
Enhancer trap line expressed strongly in cap cells and IGS/ escort cells, recombined with tjeo2
Spradling, 1993; Margolis and Spradling 1995
piwi1 y; piwi1 / CyO, y+ P-element insertion in piwi gene exon 1
Lin and Spradling, 1997; Cox et al., 1998
piwi2 y; piwi2 / CyO, y+ P-element insertion in piwi gene exon 4
Lin and Spradling, 1997; Cox et al., 1998
tjeo2
E(spl)mβ-CD2
tjeo2 E(spl)mβ-CD2/ CyO, Kr-Gal4 UAS-GFP
Enhancer of split promoter driving CD2 expression, recombined with tjeo2
de Celis et al., 1998; Song et al., 2007 (Gift from D. Drummond Barbosa)
UAS-tj w1118;b tjeo2cn UAS-tj 1(2)/ SM6b
tj full length cDNA under UAS promoter, 2nd chr.
M. Li, M. Arandejelovic, and D. Godt, unpublished data
tj-Gal4 tj-Gal4 Gal4 gene driven by tj promoter, hypomorphic tj mutation, 2nd chr.
Hayashi, S. et al. 2002; Tanentzapf et al., 2007 (Kyoto DGRC)
23
c587-Gal4
c587-Gal4; Sco/CyO
Gal4 gene under a somatic driver that drives expression in most of the somatic cells of the larval ovary
Zhu and Xie, 2003
UAS-Nintra y w112; Sp/CyO; N754.BF/TM2.TM6b
UAS promoter driving Notchintra
Gift from Gary Struhl
UAS-NRNAi P{TRiP.JF02959}attP2 /TM3, Sb
UAS promoter driving Notch RNAi
Perkins et al., 2009 (BDRC)
tud1 tud1/CyO tudor allele Boswell and Mahowald, 1985 (Gift from M. Van Doren)
tud b45 w P{w+faf-lacZ}; P{ w+FRT} tudB45-06/CyO, P{w+ hs-hid }
tudor allele Moore et al., 1998; Arkov et al., 2006 (Gift from M. Van Doren)
tud b42 w P{w+faf-lacZ}; P{ w+FRT} tudB42-10/CyO, P{w+ hs-hid }
tudor allele Moore et al., 1998, Arkov et al., 2006 (Gift from M. Van Doren)
w; Bl/CyO; TM2/TM6b, Sb 2nd and 3rd chromosome balancer
Lindsley and Zimm, 1992. (BDRC)
2.1. Ovary Immunostaining 2.1.1 Collection/Staging of tissues
One to two day old females were collected and put in a vial with yeast for one day prior to
dissection. For prepupal ovary dissection, white immobile prepupa were selected and kept at
25ºC for 3-5 hours until dissection. All the experiments were carried out at 25ºC unless
mentioned otherwise. Prior to dissection, adult females were anesthetised with CO2 and
submerged in 95% ethanol for about 1 minute. Both adult and prepupal ovaries were dissected in
1X PBS (130 mM NaCl, 7 mM Na2HPO4, pH 7.2) and kept on ice before fixation.
2.1.2 Staining procedure
The ovaries were fixed in 5% formaldehyde in phosphate buffer saline (PBS) at room
temperature for 12 minutes. Then they were rinsed 3X with PBT (PBS + 0.15% Triton X-20),
24
followed by 4X 15 minutes washes in PBT before incubation in PBTS (PBT+ 5% goat serum +
0.2% bovine serum albumin) for 1hr at room temperature. The ovaries were incubated with
primary antibodies overnight in PBTBS at 4ºC. The following day, ovaries were rinsed 3X in
PBT, washed 4X 15 minutes in PBT and incubated in PBTBS for 1 hour at room temperature.
Tissues were incubated in secondary antibodies conjugated to Cy3, Cy5 (Jackson Immuno
research laboratories) or Alexa-flour 555, 488, 647 (Molecular probes, Invitrogen) in PBT at
1:400 for 2 hours. Lastly, ovaries were rinsed 3X PBT, washed 4X 15 min in PBT and mounted
in Vector Shield Mounting medium (Vector Laboratories) at 1:1 in PBT and left overnight.
All the confocal images were taken with the laser scanning confocal microscope (Zeiss LSM 510
confocal) using a 40X 1.3 Plan-Apo objective. All the images were made using Adobe
Photoshop or Adobe Illustrator.
2.1.3 Primary antibody list The following primary antibodies were used for immunostaining: guinea pig polyclonal α-Traffic
Jam (Tj-GP5, 1:5000, Li et al., 2003); rabbit polyclonal α-β-galactosidase (β-Galactosidase,
1:1500; Cappel, ICN, Pharmaceuticals Inc.); rat α-DE-cadherin (DCAD2; 1:25, DSHB); mouse
α-Hu-li Tai Shao (1B1; 1:5, DSHB); rabbit α-α-Spectrin (1:1000, gift from D. Branton); mouse
monoclonal α-Piwi (1:5, gift from M. Siomi); monoclonal mouse α-LaminC (LC28.26; 1:50,
DSHB); chicken polyclonal α-Vasa (1:3000, gift from K. Howard); rat α-Bab2 (Bab2-R10;
1:3000, Couderc et al., 2002); guinea pig polyclonal α-Myosin VIIA (Myo7a-GP6; 1: 2000, C.
Glowinski and D. Godt unpublished); mouse monoclonal α-Notch intra (C17.9C6; 1:5, DSHB);
monoclonal mouse α-Notch extra (C458.2H; 1:5, DSHB); monoclonal mouse α-Delta (C594.9B;
1:5, DSHB); mouse monoclonal α-CD2 (MCA 154R; 1:100; Serotec Ltd); rabbit monoclonal α-
phospho-Smad1/5 (41D10, 1: 100, Cell Signalling); rabbit polyclonal α-pMAD (PS1; 1:250,
25
Persson et al., 1998; gift from T. Tabata); mouse monoclonal α-GFP (ab1218, 1:100; Cedarlane
Laboratories); rabbit polyclonal α-GFP (1:100; BD Biosciences); α-β heavy Spectrin (1: 500,
Thomas and Kiehart, 1994; gift from G. Thomas).
Table 2. Stem cell markers
Markers GSC Cystoblast Staining pattern Marker for Dpp signaling
bam-GFP - +/- * bam promoter driving GFP expression, cytoplasmic
yes
pMad + - nuclear staining yes Hts + + marks spectrosome and fusome no Vasa + + cytoplasmic, germline specific marker no
* not always detected in cystoblast
Table 3. Markers expressed in a cap cell specific manner
Markers TF cells Cap cells Staining pattern LaminC strong weak Nuclear envelope protein, stains the nuclear envelope Bab2 weak strong transcription factor, nuclear staining Tj absent present transcription factor, nuclear staining 1444-lacZ absent present nuclear localisation of ß-galactosidase Hts yes yes Outlines all cells including cap and terminal filament cells 2.1.4 Statistical analysis
Statistical analysis was done using the Prism software. Unpaired Mann-Whitney two-tailed T-
test (95% confidence interval) was used to determine whether differences between the control
and the mutant genotype were statistically significant.
2.2 Molecular characterization of tj39 allele
2.2.1 Genomic DNA isolation DNA was extracted from male flies using crude DNA extraction method. Flies were crushed in
50ul of squishing buffer (10 mM Tris-Cl pH 8.0, 1mM EDTA, 25mM NaCl, 200ug/ml
proteinase K and the rest water). The mixture was incubated at 37 ºC for 30min for protein
26
digestion. Proteinase K was inactivated by heating at 95 ºC for 3min. Centrifuged fly extract for
1 min at 10,000rpm to sediment undigested fly parts.
2.2.2 PCR reaction
PCR was carried out using the following primers: Uni P 5’ACCACCTTATGTTATTTCATCAT
3’, Oligo3 Fwd: 5’ GCTCTTGCACAGTGGTCGAG 3’, Oligo2 Rev 5’
GTGTCGTTTATGGTGGGATC 3’, Oligo 4 Rev: 5’ GAACTCCTGTTGGAAACGTG3’. All
the primers were designed using the Primer-Blast online program. The PCR mixture consisted of
200ng of genomic DNA, 250ng of each primer, 0.2rnM of each dNTP, 1.5mM MgC12, 2.5
units of Platinum Taq polymerase (Invitrogen), 1X PCR buffer (Invitrogen), and autoclaved
double distilled water for a total reaction volume of 50µl. The DNA was amplified in 28
cycles at 95ºC (5 min), 55ºC (1 min), 72ºC (1 min), and a final extension at 72ºC (10 min).
27
Chapter 3. Results
3.1. Loss of Tj affects the number of germline stem cells
(GSC)
3.1.1 The number of GSCs is reduced in a hypomorphic tj mutant
Our lab conducted a P-element excision mutagenesis, using the tj-Gal4 line, to generate a null
allele of tj. Because the tjeo2 mutant phenotype results in female sterility, the new excision alleles
were tested for sterility in trans to tjeo2, a genetic null allele. A sterility test on the P-element
excision mutants revealed that transheterozygous tj39/tjeo2 females (weak tj mutant) laid a
significantly fewer number of eggs compared to wild type (Alchits and Godt, unpublished).
Throughout the thesis the tj39/tjeo2 genotype is referred to as ‘the weak tj mutant’. Molecular
characterization of the excision mutation revealed an internal deletion in the P-element that is
located in the tj 5’UTR. This excision does not affect the tj open reading frame (see Appendix
for details).
Since the weak tj mutant females were sterile we decided to address the morphological basis for
their sterility by studying the ovary in more detail. Unlike the tj null mutant that contained only
rudimentary gonads, in weak tj mutants we saw ovarioles with a germarium followed by egg
chambers; similar to the ovariole structure observed in wild type (Fig. 4E). However, the shape
of the germarium was abnormal. It appeared pear-shaped, narrow at the anterior tip and bulged
on the posterior side due to disorganized packing of the germarial cysts. These mutants also
contained other uncharacterized defects at later stages of oogenesis.
Preliminary analysis of the weak tj mutant suggested a reduction in the number of GSCs (Alchits
and Godt, unpublished). Hence, I counted GSCs in weak tj mutant ovaries using Vasa and Hts as
28
molecular markers. Vasa, an RNA helicase localizes to the cytoplasm of all germline cells and is
used to distinguish germline cells from somatic cells (Lasko & Ashburner, 1988).
Vasa staining is particularly prominent in GSCs and transit amplifying daughters. Huli-tai-shao
(Hts) is a membrane skeletal protein that localizes to the spherical spectrosome in both the GSCs
and the cystoblasts and is used to distinguish them from the connected cystocytes that contain a
Hts positive branched fusome (Lin et al., 1994). The limitations of molecular markers (Hts and
Vasa) to distinguish GSCs from cystoblasts are overcome by the use of additional morphological
markers. First, since cap cells are found at the tip of the germarium, GSC presence is restricted to
the anterior tip as well. Second, GSCs are physically anchored to the cap cells (Song et al.,
2002). Third, GSCs sent out protrusions towards cap cells (described in next paragraph). Thus,
GSCs were counted using a combination of both molecular and morphological markers.
Consistent with previously published literature (Xie and Spradling, 2000), two day old wild-type
germaria contained two to four GSCs, with 89% of the germaria carrying three or more GSCs
(n=29; Fig. 3, 4A). In comparison, weak tj mutant germaria contained one to three GSCs, with
53% of the germaria containing only one GSC (n=43; Fig. 3, 4B). On average, there was a
reduction in the number of GSCs from 3 in wild type to 1.5 in the weak tj mutant (Fig. 3;
p<0.0001). A similar result was observed in a tj mutant that carried the tj39 allele in trans to the
transcriptional null allele tjDf1. Interestingly, we observed that GSCs sent out protrusions towards
cap cells (visualized with Vasa) with one or two protrusion per GSC in the weak tj mutant (Fig.
4B, D) similar to wild type (Fig. 4A). However, often the protrusions in the weak tj mutant
appeared longer (Fig. 4D).
29
Figure 3. Average number of GSCs in control and tj39/tjeo2 (weak) mutant germaria. The
graph shows mean (average) and standard deviations.
30
31
Figure 4. Weak tj mutant germaria contain reduced number of GSCs. Vasa labels the
germline cells. Tj labels cap cells and escort cells. Hts labels spectrosome/fusome and cortex of
all cells. Cc=cap cells. P=cellular process. The images shown here consist of single confocal
sections. (A) A control (w1118) germarium carrying a total of 3 GSCs: two GSCs are visualised in
(A) and the third GSC is visualised in (A’). (B) A weak tj mutant (tj39/tjeo2) germarium carrying
two GSCs: one GSC can be seen in (B) and the second GSC can be visualised in (B’). (C) A
weak tj mutant germarium carrying only one GSC. (D) A GSC sending out a long process. (E)
Weak tj mutant ovariole consisting of a pear-shaped germarium (g) and egg chambers (e).
32
33
To confirm the reduction in GSC numbers observed in the weak tj mutant, I used the markers
bam-GFP in combination with the morphological markers stated earlier. bam-GFP is expressed
in cystoblasts, but not in GSCs (Chen and McKearin, 2003). Compared to the control where 69%
of the germaria carried 3 or more GSCs (absence of bam-GFP; n=29; Fig 5A, 6), there was a
significant reduction in GSC numbers in the weak tj mutant where 65% of the germaria carried
only one GSC (n=52; Fig. 5B, 6; p<0.0001). bam-GFP negative cells that were not juxtaposing
the niche were excluded from the GSC count, as these cells most likely represents the newly
formed cystoblasts, in which bam expression was too low to be detected (Fig. 5A, B, D; Song et
al., 2004). We noted that the percentage of germaria carrying one GSC in the weak tj mutant
females carrying the bam-GFP transgene on day 2 was higher by 12% compared to the weak tj
mutant females that did not carry the transgene (compare Fig. 3, 6). Statistical analysis showed
that the 12% increase was not significant. Thus, we speculate that either presence of the
transgene or specific environmental conditions or both contributed to an increase in the
percentage of the germaria carrying one GSC in the females carrying the transgene.
The bam-GFP negative cells in the weak tj mutant could be GSCs or germline cells that are
arrested at a stage prior to differentiation (Gilboa et al., 2003). To confirm that the presence of
bam-GFP repressing cells in the weak tj mutant corresponds to GSCs, I used nuclear pMAD,
which is a specific marker for GSCs. pMAD is present in nucleus of GSCs, but not in cystoblasts
(Kai and Spradling, 2003; Song et al., 2004). In the control germaria, Vasa positive nuclear
pMAD expressing cells were restricted to the anterior tip of a germarium (n=37; Fig. 7A). In
agreement with our hypothesis, the Vasa positive cells at the anterior tip of a germarium in weak
tj mutant also expressed nuclear pMAD at levels comparable to wild type (n=25; Fig. 7B). At 3
weeks, the weak tj mutant ovaries contain a string of egg chambers (data not shown) providing
additional evidence that the nuclear pMAD positive cells are indeed GSCs because loss of GSCs
34
Figure 5. The GSCs in weak tj mutant germaria do not express bam-GFP, a cystoblast
differentiation factor. Vasa labels germline cells. Bab2 labels cap cells. bam-GFP, shown
separately in A’-D’ labels differentiating germ cells. Cc=cap cells. (A,C) Day 2 and day 21
control (w1118) germaria containing 2 GSCs negative for bam-GFP. The terminal filaments are
not visible in this confocal section (B,D) Day 2 and day 21 weak tj mutant (tj39/tjeo2; bam-GFP)
germaria containing 1GSC negative for bam-GFP. These images shown here consist of single
confocal sections. (A, B, D) The bam-GFP negative cells that are located one cell diameter away
from the niche are cystoblasts (CB).
35
36
Figure 6. Average number of GSCs in control (bam-GFP) and weak tj (tj39/tjeo2; bam-GFP)
mutant germaria on Day2, 14 and 21. The graph shows mean (average) and standard
deviations.
37
38
Figure 7. The GSCs in weak tj mutant germaria receive Dpp signaling indicated by the
presence of nuclear pMAD. Vasa labels germline cells. LaminC labels terminal filament and
cap cells. Cc=cap cells. The presence of Dpp signaling results in the accumulation of pMAD in
the nucleus of GSCs. pMAD is also shown separately in panels A’-D’. (A,C) Day 2 and day 21
control (w1118) germaria showing 2 GSCs. (B,D) Day 2 and day 14 weak tj mutant (tj39/tjeo2)
germarium containing 1 GSC. These images were generated by projection of several confocal
sections.
39
40
would lead to a loss of the germline cells and we would expect to see empty ovarioles (Flatt et
al., 2008)
3.1.2 GSCs are maintained properly in the weak tj mutant
In wild-type germaria, when a GSC gets lost, one of the two remaining GSCs will divide
symmetrically to give rise to two daughter cells that will remain in the niche and replace the lost
GSC (Xie and Spradling, 2000). I wanted to determine if the reduction in GSCs observed in the
weak tj mutant is due to defects in the maintenance of the GSCs. Since weak tj mutant germaria
predominantly contain only one GSC, I looked to see if this GSC is lost over time, which would
indicate a defect in GSC maintenance. I counted the number of GSCs in the weak tj mutant on
day 14 (data not shown) and day 21 based on the absence of bam-GFP and the morphological
markers mentioned previously. If the weak tj mutant cap cells would not provide sufficient BMP
signaling, the bam silencer elements in resident GSCs would be de-repressed, initiating bam
expression that can be recapitulated using the bam-GFP transgene (Chen and McKearin, 2003;
Song et al., 2004). Hence, I would expect to see bam-GFP positive cells at the anterior tip of the
germarium if GSC loss was enhanced in weak tj mutant germaria. In both the control and the
mutant, the tip of the germaria on day 21 contained bam-GFP negative cells (Fig. 5C, D). On day
14, about 61% of the control germaria carried 3 GSCs compared to the weak tj mutant where
71% of germaria carried only one GSC. On day 21, in the control germaria I observed a
reduction in GSC number where 62% of the germaria carried 2 GSCs compared to day 2
(p=0.048; Fig. 5C, 6). A GSC reduction after week 3 was consistent with previous studies where
they reported a similar reduction in GSC numbers due to ageing (Hsu and Drummond-Barbosa,
2009). In comparison, 72% of weak tj mutant germaria carried one GSC, which is significantly
different from the wild type (p<0.0001; Fig. 5D, 6). However, the number of GSCs on day 2 and
21 was similar in the weak tj mutant (Fig. 6). Considering the age-related loss observed in the
41
control germaria, it is surprising that weak tj mutant GSCs did not show a similar reduction on
day 21.
One factor for age-related decline in GSCs is compromised BMP signaling (Zhao et al, 2008).
Consequently, I looked at pMAD levels in two week old GSCs in the weak tj mutant germaria.
The one GSC in weak tj mutant germaria (n=25; Fig. 7D) showed nuclear pMAD levels
comparable to the control GSCs (n=23; Fig. 7C). I did not observe germaria with GSCs showing
cytoplasmic pMAD staining, an indication of weakening BMP signaling. To summarize, in the
weak tj mutant, GSCs are maintained properly because I did not observe premature GSC loss.
3.1.3 Adult tj null mutant ovaries rarely contain GSCs
In a wild-type ovariole, a germarium is followed by a series of developing egg chambers (Fig.
9A). Similarly in weak tj mutants we saw an ovariole structure that was comparable to wild type
(Fig. 4E). However, in both tjeo2 and tj4735 homozygous mutants, the ovariole structure was
absent (Fig. 9B; Li et al., 2003). Throughout the entire thesis the tjeo2/tjeo2 genotype is referred to
as ‘the tj null mutant’. A quarter of the tj null mutant 1-2 day old females did not carry germline
cells. The remaining ovaries contained germline clusters that were variable in size and at various
degrees of differentiation (Li et al., 2003). To investigate whether the germ cell clusters observed
in tj null mutant germaria contained any GSCs, I stained these ovaries with Vasa and Hts in order
to distinguish between different populations of germline cells (Table 2).
In tj null mutant mutants, the Vasa positive cells were either present in clusters or as individual
germ cells (Fig. 8B-D). The individual germ cells contained a spherical spectrosome (Fig. 8B).
The clusters appeared round or oblong in shape and there were two types of clusters: one where
the entire cluster was made up of individual germ cells that each contained a spherical
spectrosome (Fig. 8C), and another type that contained a mixed population of both individual
42
Figure 8. tj null mutant adult ovaries contain germline clusters adjacent to terminal
filaments that contain cells with a spherical spectrosome. The images present a projection of
several confocal sections. Vasa labels germline cells. (A) A 1-2 day old adult tjeo2/tjeo2; babA128-
LacZ/+ mutant ovary. Terminal filaments (TF) strongly express babA128-LacZ. Hts labels
spectrosome/fusome and cortex of all cells. Five terminal filaments showing germline clusters
positioned at the base of those terminal filaments (yellow arrowheads). Note some terminal
filaments are not associated with any germline cells (red arrowheads). (B-D) shows germline
clusters from tjeo2/tjeo2 ovaries. Spherical spectrosome (s) indicate individual germline cells
(B,C). Spectrosome is normally found in PGCs, GSCs and cystoblasts. Fusomes indicate
connected, differentiating cystocytes (D).
43
44
germ cells and connected cystocytes indicated by the presence of a branched fusome (Fig. 8D). If
the germline clusters observed contained any GSCs, we would expect them to be in proximity to
terminal filaments because GSCs are anchored to cap cells that are located at the base of a
terminal filament (Song et al., 2002). To determine whether any GSCs are present, I looked for
germ cells in proximity to terminal filament-like structures in tjeo2/tjeo2; babA128-LacZ/+ mutants. I
analyzed 10 ovaries that had germline cells (N= 45 clusters). babA128-LacZ is an enhancer trap line
where the LacZ gene is highly expressed in terminal filament cells (Godt and Laski, 1995). We
found that some terminal filaments did not associate with any germline altogether (Fig. 8A, red
arrowheads). In the anterior region of the ovary that contained terminal filaments, 96% of the
clusters and/or individual germ cells were positioned at the base of a terminal filament (Fig. 8A).
These results suggested that the germline clusters may contain GSCs.
As mentioned earlier, we performed Hts and Vasa stainings to look for the presence of GSCs.
However, these markers are not entirely specific to GSCs. To confer the identity of the
individual germ cells observed in tj null mutants, I used an antibody against phosphorylated
MAD (pMAD). The distribution of pMAD reflects BMP signaling activity (positive marker for
GSCs). Consistent with previously published literature, pMAD exclusively accumulated in the
nucleus of GSCs in control ovaries (n=10, Fig. 9A, C) (Kai and Spradling, 2003). The cystoblast
do not contain pMAD (Table 2). Surprisingly, I found that often not all GSCs in a control
germarium were positive for nuclear pMAD. The total number of GSCs with nuclear pMAD
ranged from 0 to 3 in the control germaria. In contrast, the majority of germ cells in tj null
mutant clusters did not contain either nuclear or cytoplasmic pMAD (Fig. 9D). Out of the 21
clusters examined (n= 18 ovaries), 2 clusters contained nuclear pMAD (Fig. 9E), 4 clusters
contained cytoplasmic pMAD (co-localised with Vasa) and the remaining clusters showed only
background staining. This suggests that the adult tj null mutant ovaries rarely contain GSC-like
45
Figure 9. Adult tj null mutant ovaries rarely contain germline cells with nuclear pMAD.
Vasa labels germline cells. LaminC labels terminal filament (TF) cap cells (Cc), interfollicular
stalks (IS) and ovariole sheath cells (Os). The presence of Dpp signaling results in the
accumulation of pMAD in the nucleus of GSCs. (A) A control (w1118) ovariole consisting of a
germarium (g) and egg chambers (ec). (B) A tj null mutant (tjeo2/tjeo2) ovary showing two
germline clusters (cluster) juxtaposing a stalk. (C) A control (w1118) germarium showing two
GSCs indicated by the presence of nuclear pMAD. (D) A tjeo2/tjeo2 mutant germline cluster
juxtaposing a terminal filament showing the two anteriormost germline cells (blue arrowheads)
with no nuclear pMAD. (E) Germline cluster from a tjeo2/tjeo2 mutant showing two germline cells
with nuclear pMAD next to the terminal filament. The images represent a projection of several
confocal sections.
46
47
cells. One possible explanation is that GSCs are established in tj null mutants, but sometime
prior to the adult stage, a defect in GSC maintenance results in the depletion of the stem cell
pool. This would account for the severe reduction in GSC-like cells observed in adult ovaries.
Alternatively, GSCs might not be established during the larval to pupal transition in tj null
mutants.
3.1.4 tj null mutant ovaries establish fewer GSCs than control
ovaries at the prepupal stage To determine if the absence of GSCs in adult tj null mutant ovaries was due to a defect in GSC
establishment, I looked for GSC presence at the prepupal stage (2-4.5 hour) when they should
have already been recruited. At the larval to pupal transition, the germline (PGCs, GSCs,
cystoblasts and the differentiating cyst cells) can be easily recognized by the presence of
cytoplasmic Vasa. In control prepupal ovaries, germline cells were located in the middle part of
the gonad and were intermingled with smaller somatic interstitial cells (negative for Vasa). In
contrast, in tj null mutant prepupal ovaries, the germline was not intermingled with somatic cells
(Li et al., 2003; this thesis). Similar to what we observed in adult ovaries, in pre-pupal gonads,
germline cells in tj null mutants were organized either as aggregate or as individual germ cells.
We found that the germline aggregate within the tj null mutant gonad was often mis-positioned
and not located in the middle of the gonad (data not shown). More importantly, we found that in
tj null mutant ovaries not all terminal filaments were associated with germline cells. The
percentage of terminal filaments per ovary that had no direct contact to germline cells was highly
variable and ranged from 7% to 61% (n=15 ovaries) with an average of 31%.
In control prepupal ovaries, the anteriormost row of PGCs developed into GSCs as indicated by
the absence of bam-GFP (n=6) (Fig. 10A, Table 2). Conversely, PGCs not destined to become
GSCs had started to express bam-GFP concomitant with bam de-repression. In tj null mutant
48
Figure 10. Prepupal tj null mutant gonads contain GSC-like cells based on the lack of bam-
GFP. Vasa labels germline cells. Hts labels spectrosome/fusome and cortex of all cells. (A) A
bam-GFP control prepupal ovary showing that the anteriormost row of germ cells is negative for
bam-GFP. (B) A tj null mutant ovary (tjeo2/tjeo2; bam-GFP), in which the anteriormost germline
cells are negative for bam-GFP, suggesting the presence of GSCs. (C) A tj null mutant ovary
(tjeo2/tjeo2; bam-GFP) in which the anteriormost germline cells (yellow arrowheads) express GFP
indicating that they undergo differentiation. (A-C) The germ cells in the second row and beyond
are undergoing differentiation (cystocytes) indicated by the strong expression of bam-GFP and
the presence of fusomes.
49
50
ovaries, PGCs in the anteriormost row were also marked by the absence of bam-GFP, suggesting
they had developed into GSCs (n=9; Fig. 10B). However, in some tj null mutant prepupal
ovaries, PGCs in the anteriormost row did not develop into GSCs marked by the presence of
bam-GFP (Fig. 10C). In both, control and tj null mutant, apart from the anteriormost row of
germline cells, the remaining PGCs had developed into cysts, found at various stages of
differentiation and marked by the presence of bam-GFP (Fig. 10). Hence, using the absence of
bam-GFP as a marker for GSC presence, my data indicate that GSCs were established in tj null
mutant prepupal ovaries, although their number was reduced.
To confirm the presence of GSCs, I looked for the presence of pMAD in 3-5 hour old prepupal tj
null mutant ovaries. I used two different antibodies against pMAD that gave comparable results.
In control gonads, the anteriormost row of Vasa positive cells showed different distributions of
pMAD: cytoplasmic pMAD (co-localises with Vasa), nuclear pMAD (does not co-localise with
Vasa) and pMAD that was relatively evenly distributed between the nucleus and the cytoplasm
(n=8; Fig. 11A, B). Similarly in tj null mutants, the anteriormost row of germline cells also
contained a mixture of cells with cytoplasmic pMAD, nuclear pMAD, and pMAD evenly
distributed in the cytoplasm and the nucleus (n=10; Fig. 11B, D).
To determine whether there is a reduction in the number of GSCs being established in tj null
mutant prepupal ovaries, I counted the number of nuclear pMAD positive germline cells in
control and tj null mutants. In control prepupal gonads, I observed 18 to 35 cells with nuclear
pMAD per ovary (n=10; Table 4). In comparison, in tj null mutants there was a severe reduction
in the number of cells with nuclear pMAD (p<0.0001). These ovaries contained only 2 to 16
cells with nuclear pMAD per ovary (n=12; Table 4). The level of nuclear pMAD intensity in tj
null mutant germline cells was comparable to control. Thus, despite the presence of active BMP
51
Figure 11. Prepupal tj null mutant ovaries establish very few GSC-like cells. Vasa labels
germline cells. LaminC labels terminal filament (TF) and cap cells (Cc). (A-B) Two examples of
a control (w1118) prepupal ovary. (A’,B’) The anteriormost row of germ cells shows three types
of pMAD distribution: nuclear (n), cytoplasmic (c) and even distribution (e) of pMAD between
the nucleus and the cytoplasm. The germ cells beyond the second row show cytoplasmic
distribution of pMAD only. The confocal section in (A) shows 2 GSCs (side by side) per
terminal filament as indicated by the presence of nuclear pMAD and the cellular protrusions (P)
pointing towards terminal filaments. Note the unstained region (gap) between the anterior-most
germ cells and terminal filaments. The ‘gap’ is occupied by the cap cells that are not stained by
LaminC at this stage. (C-D) Two examples of a tj null mutant (tjeo2/tjeo2) ovary. (C’,D’) Similar
to the control, the anteriormost row of germ cells shows three types of pMAD distribution. The
confocal section in (C-D) shows only a single GSC-like cell per terminal filament, indicated by
its position, nuclear pMAD and/or cellular protrusion. The GSC-like cell is in direct contact with
LaminC-positive stalk cells. Notice there is no gap in the staining between the anteriormost germ
cells and the terminal filaments. (A-D) The germline cells in the second row and beyond show
cytoplasmic pMAD staining. (E) A confocal section of a control (w1118) prepupal ovary showing
a germline cell in the anteriormost row making contact with the cap cells (Cc). (F) A confocal
section of a tj null mutant prepupal ovary showing two germline cells in the anteriormost row
clearly making contact with the terminal filament cells. In one case the germline cell is sending
out two processes.
52
53
signaling, indicated by the presence of nuclear pMAD positive cells, tj null mutant ovaries
established fewer GSCs.
Table 4. Comparison of pMAD distribution in tj null mutant and control ovaries
Genotype Nuclear Cytoplasmic Even None y w (n=7) 14-32 3-15 8-23 0 tjeo2/tjeo2 (n=12) 0-10 1-7 3-9 1-7
In the control gonads, the PGCs in the second row and beyond were positive for cytoplasmic
pMAD (Fig. 11A, B). In comparison, in tj null mutant prepupal ovaries the posterior germline
cells showed an overall low level of cytoplasmic pMAD (Fig. 11C, D) with the periphery of the
germline cluster showing slightly higher pMAD levels than the interior of the cluster (data not
shown). Based on pMAD subcellular localization pattern, where presence of nuclear pMAD
indicates GSCs, I concluded that the number of GSCs was severely reduced in tj null mutant
ovaries.
In the control gonads, the anteriormost row consisted of 2-3 germline cells that were in close
proximity to individual stalks. However, these germline cells were not directly juxtaposing
terminal filaments as indicated by the presence of a ‘gap’ (Fig. 11A). This was not surprising
because the base of terminal filaments consisted of cap cells and hence, the Vasa positive
germline cells were not juxtaposing the terminal filaments. In the control prepupal ovaries,
germline cells in the anteriormost row sent out processes towards the newly formed cap cells
(Fig. 11A, E). Unlike the control gonads, germ cells in the anteriormost row in tj null mutants
were directly juxtaposing the stalks indicated by the absence of a gap: ‘no gap’ (Fig. 11D). In tj
null mutants, the stalks recruited only a single germline cell (n=15; Fig. 11C, D). Importantly,
the single germline cell was also competent to send out a process and clearly making contact
with the terminal filament cells (Fig. 11F). Thus, it appears there was a severe reduction in the
number of PGCs being recruited by the individual stalks in tj null mutant ovaries.
54
3.2. Loss of Tj affects the morphology, behaviour and
expression profile of cap cells
3.2.1 Reduction or loss of Tj function causes formation of abnormally long terminal filaments
The tip of each ovariole begins with a narrow cylindrical tube containing a terminal filament
followed by a broad tube called the germarium. The cap cells are part of the germarium and not
the narrow cylindrical tube. It has previously been noticed that the terminal filaments are longer
in both the null and weak tj mutants (Alchits and Godt, unpublished observations). To gain a
better understanding of this phenotype, I first counted the total number of cells in the stalks
above the germarium in control and in weak tj mutant 1-2 day old females. The number of cells
in a stalk was counted using a Hts antibody that labels the cell cortex of all the cells in an
ovariole. In a wild-type germarium, the terminal filaments contained on average 6.7 disc-shaped
cells that formed a stalk (n=6; ranging from 6-7; Fig. 12A). In comparison, the weak tj mutant
ovarioles contained an average of 11 cells that were organized into a stalk (n= 27; ranging from 7
to 14; Fig. 12A), which is significantly different compared to wild type (p<0.0002). The total
number of cells per stalk was underestimated both in the control and in the weak tj mutant
because Hts did not allow to clearly recognize all the cells in the stalk. Nevertheless, this
comparison demonstrates that a reduction of Tj results in the formation of abnormally long
terminal filaments. This raises the question as to where these extra cells are coming from. In
contrast to the terminal filaments, cap cells are normally not part of the distal stalk, but reside
within the germarium basally to the terminal filaments. I counted the total number of cap cells in
control and in weak tj mutant ovarioles using antibodies against Hts and Tj. The cap cells can be
55
Figure 12. tj mutants contain abnormally long terminal filaments, containing additional
stalk cells. (A) The graph shows the average total number of terminal filament cells per stalk in
wt, control (w1118), weak tj mutant (tj39/tjeo2) mutants, control (B1-93F-lacZ) and tj null mutant
(tjeo2/tjeo2; B1-93F-lacZ). The numbers do not include the cap cells that are part of the germarium.
(B) The average total number of cap cells/additional stalk cells in tj mutants is equal to the
number of terminal filament plus cap cells in wild-type germaria. The graph (A-B) shows mean
(average) and standard deviations. The total number of cells per stalk was underestimated both in
the control and in the weak tj mutant because Hts did not allow to clearly recognize all the cells
in the stalk.
56
(A)
(B)
57
distinguished from the anterior terminal filament cells and posterior escort cells based on
morphological characteristics and molecular markers. Cap cells and escort cells are Tj positive
(present in the nucleus), whereas terminal filaments do not express Tj. Cap cells are oval in
shape and their nuclei are rounded and seen in close proximity to each other. Unlike cap cells,
escort cells are squamous and their nuclei are triangular in shape and show a wide spacing
pattern.
All the Tj positive cells in the wild-type ovariole are located within the germarium and no Tj
positive cells were observed in the stalk (Fig. 13A’). On the contrary, in the weak tj mutant, the
top half of the terminal filaments contained on average of 6.7 cells negative for Tj (n= 30;
ranging from 5-8; Fig. 13B’,C’), however the bottom of these stalks contained cells that were
positive for Tj (Fig. 13B’,C’). This is interesting because wild-type terminal filaments do not
contain Tj positive cells (Fig. 13A’). The Tj positive cells that were incorporated into the stalks
(referred to as Tj positive stalk cells) in the weak tj mutant were categorized into three types
based on differences in their morphology. First, there were Tj positive disc-shaped cells that
were stacked on top of one another resembling the shape and arrangement of normal terminal
filament cells (Fig. 13B). The precise number of Tj positive cells that took on the disc-shaped
morphology and became part of the stalk was variable and ranged from 2 to 6 cells. Sometimes
the Tj positive stalk cells were not perfectly aligned in a single row. Secondly, there were Tj
positive cells that were round or oval in shape similar to cap cells but they were part of the stalk;
although located posterior to the disc-shaped Tj positive stalk cells (data not shown). Their
numbers were also variable and ranged from 2 to 6 cells. These cells were usually not aligned
into a single row. In other words, the weak tj mutant stalks contained disc-shaped Tj positive
cells often followed by rounded Tj positive cells. Third, there were Tj positive cells that had
rounded, closely spaced nuclei and were part of the germarium like normal cap cells (Fig. 13C’).
58
Figure 13. Weak tj mutant (tj39/tjeo2) mutants contain additional stalk cells that are positive
for Traffic jam. Traffic Jam (Tj) labels cap cells (Cc) and escort cells. Vasa labels germline
cells. Hts labels spectrosome/fusome and cortex of all cells. (A) A control (w1118) germarium
showing a terminal filament (TF) stalk and a cluster of cap cells (Cc). (A’) The Tj positive cap
cells are part of the germarium. (B) A weak tj mutant (tj39/tjeo2) germarium showing a stalk
consisting of the terminal filament cells and additional stalk cells. (B’) All the additional stalk
cells are positive for Tj indicating these are cap cells because terminal filaments do not express
Tj. (C) A weak tj mutant (tj39/tjeo2) germarium in which some cap cells have become part of the
stalk, while the remaining cap cells are part of the germarium and form a cluster. These images
represent a projection of several confocal sections.
59
60
The total number of cells that were Tj positive (therefore not terminal filament cells) and had no
wide-spaced triangular nuclei (therefore not escort cells) in wild-type and weak tj mutant
ovarioles was 7.4 (n= 24; ranging from 5-9) and 7.7 (n=32; ranging from 6-10; Table 5),
respectively. Thus, while the total number of cap cells in the weak tj mutant and in the wild type
was similar, we found that the organization of cap cells in the weak tj mutant was strikingly
different. In the weak tj mutant, the number of cap cells that were part of the germarium versus
the stalk was variable. At one end of the spectrum, we found that all the cap cells were disc-
shaped and nicely aligned forming a single stalk that resided outside the germarium. At the other
end, we would find 2 cap cells that were disc-shaped and part of the stalk, while the remaining
cap cells were round and part of the germarium. Thus, a reduction in Tj alters the shape and
arrangement of cap cells causing them to reside in a stalk outside the germarium.
Since weak tj mutants showed abnormally long stalks that contained Tj positive cells and the
number of Tj positive cells with cap cell morphology was reduced in the germarium, we
hypothesized that cap cells are incorporated into stalks, creating longer terminal filaments. To
confirm this, I counted the total number of terminal filament plus cap cells in wild-type and weak
tj mutant germaria using Hts and Tj. The average total number of terminal filament plus cap cells
in wild type and the average total number of terminal filament plus additional stalk cells and cap
cell-like cells in the germarium in the weak tj mutant was 13.75 (n=6) and 14.3 (n=23)
respectively (Fig. 12B). Thus, the average total number of somatic cells at the tip of the
germarium in wild type and weak tj mutants did not differ significantly.
Given that in weak tj mutants we saw longer terminal filament stalks compared to wild type, I
expected to see an increased number of cells in terminal filament stalks of tj null mutants as well.
I counted the total number of cells per terminal filaments in 1-2 day old ovaries. For this analysis
61
Table 5. Comparison of the total number of terminal filament and cap cells in various
genotypes
Genotype Terminal filaments Cap cells Average Range Sample size Average Range Sample
size w1118 6.5 6-7 (n=6) 7.4 5-9 (n=24) w1118; tj39/tjeo2 6.7 5-8 (n= 30) 7.7 6-10 (n=32) 1444-lacZ control/+ 7.8 7-9 (n= 19) 7 6-8 (n= 25) tj39/tjeo21444-lacZ 7.7 7-10 (n= 28) 6.9 5-9 (n= 29) B1-93F-lacZ control 8.8 8-10 (n=29) 6.3 5-9 (n=30) tjeo2/tjeo2; B1-93F-lacZ 15.9 12-22 (n= 30) 0 0 (n= 30) wt control for piwi and tudor mutant
8 7-9 (n=11) 7.7 7-9 (n=11)
piwi1/piwi2 8 7-9 (n= 31) 3 0-6 (n=42) tudor (agametic) mutant
7.1 6-9 (n= 44) 3.7 2-6 (n=49)
c587-Gal4/+; +/balancer; UAS-N RNAi/ + (notch Knock-down)
7 5-8 (n=13 ) 1.3 0-4 (n=11)
tj-Gal4/+; +/balancer; UAS-Notchintra/+ (notch overexpression)
9.8 8-11 (n=19) >20 estimation
N.d. N.d.
tj-Gal4/+; UAS- tj (Tj exogenous expression)
8.5 7-11 (n=20) 6 5-10 (n=20)
N.d.= not determined
I could not use Tj as a maker to identify cap cells because unlike the weak tj mutant that
produces a detectable level of Tj protein, in the tj null mutant, the Tj protein is not detected.
Hence, I used different markers for this analysis: a B1-93F-lacZ enhancer trap line and an
antibody for LaminC, a nuclear envelope protein. LaminC and B1-93F-lacZ are expressed in
terminal filament and cap cells, but not in other cells of the germarium, and therefore allowed me
to distinguish terminal filaments and cap cells from the rest of the somatic cell populations. In a
control germarium, on average 8.8 (n=29; ranging from 8-10 cells; Table 5) disc-shaped terminal
62
filament cells formed a stalk (Fig. 12B). Not surprisingly, tj null mutant ovaries contained
abnormally long stalks, a hallmark for the tj mutant. The tj null mutant stalks contained an
average of 15.9 cells (n= 30; ranging from 12-22 cells; Table 5), a significant increase (Fig. 12;
p<0.0001). This number is similar to the total number of terminal filament plus cap cells in wild-
type which has an average of 15.1 cells (n= 30; ranging from 13-19 cells; Fig 12).
Thus, my analysis of both weak and tj null mutants indicates that cap cells become integrated
into the terminal stalk. The total number of cells in the abnormally long tj mutant stalks equals:
terminal filament cells plus cap cells. While the cap cells in tj null mutants were accounted for,
clearly these cap cells are abnormal with respect to their morphology and position.
3.2.2 Additional stalk cells express cap cell markers but are
organized into a stalk in the hypomorphic tj mutant
The analysis of the weak tj mutant suggests that cap cells are not missing after all. Instead they
take on a different morphology. The atypical morphology of these cap cells led us to investigate
the possibility that when Tj is reduced, the increased number of terminal filament cells form at
the expense of cap cells. Therefore, I analyzed the weak tj mutant stalks for the presence of
various makers that are expressed in a cap cell specific pattern: LaminC, 1444-lacZ, and Bab2
(Table 3). LaminC is expressed strongly in terminal filaments and weakly in cap cells. 1444-
LacZ is an enhancer trap where LacZ expression is present in cap cells and escort cells, but not
in terminal filament cells (Margolis and Spradling, 1995). Bab2 is a transcription factor that is
expressed weakly in terminal filament cells and strongly in cap cells (Coudrec et al., 2002).
In a control germarium, terminal filament cells showed strong expression of LaminC, weak
expression of Bab2, and lack 1444-lacZ (Fig. 14A). On the other hand, cap cells showed weak
63
Figure 14. The additional stalk cells in weak tj mutant germaria express markers in a cap
cell specific pattern. (A) A control germarium (1444-lacZ/+) showing cap cells are organised
into a cluster. (A’) LaminC is expressed strongly in terminal filaments (TF) and weakly in cap
cells (Cc). This marker helps distinguish the cap cells from posterior escort cells. Note the one
cell nucleus below the cap cell cluster does not stain with LaminC. (A’’) Bab2 is expressed
weakly in terminal filament and strongly in cap cells. It also stains escort cells. (A’’’) terminal
filaments do not express 1444-lacZ. Cap cells and escort cells express 1444-lacZ. (B) A weak tj
mutant (tj39/tjeo2); 1444-lacZ/+) germarium showing cap cells are organised into a stalk. (B’) All
the cells in the stalk are positive for LaminC. There are no LaminC positive cells organised into a
cluster. (B’’) The upper 7 cells in the long stalk show weak Bab2 expression while the additional
stalk cells (lower 6 cells) show high expression of Bab2. (B’’’) The upper 7 cells in the stalk do
not express 1444-lacZ. The additional stalk cells (bottom 6 cells) show expression of 1444-lacZ.
These images represent a projection of several confocal sections.
64
65
expression of LaminC, high expression of Bab2 and also expressed 1444-LacZ (Table2; Fig.
14A). These cap cells are part of the germarium (Fig. 14A’’,A’’’). In contrast, weak tj mutant
germaria contained longer terminal filaments (Fig. 14B), in which the upper 7.7 cells (n=28;
ranging from 7-10) showed the same expression of markers as wild-type terminal filament cells
(Fig. 15B). The lower 6.9 cells (n=29; ranging from 5-9) in the stalk showed weak expression of
LaminC, but high expression of Bab2 and expressed 1444-LacZ (Fig. 14B’’,B’’’). The
expression pattern of the cells in the lower half of the stalks is similar to the wild-type cap cell
expression pattern (Table 3) suggesting the additional cells in the bottom half of the stalks are
cap cells. Based on these markers, the average number of cap cells in wild-type and weak tj
mutant ovaries consisted of 7 cells (n=25; ranging from 6-8) and 6.9 cells (n=29; ranging from 5-
9), respectively (Table 5). Statistical analysis revealed no significant difference between the
mutant and wild-type. The weak tj mutants contained an average of 7.7 terminal filament cells,
which was not statistically different from the wild-type 7.8 cells (Table 5). These results show
that in the hypomorphic tj39/tjeo2 mutant, cap cells were organized into a stalk but based on
available markers (Tj, LaminC, 1444-LacZ, Bab2) the expression profile resembled that of
normal cap cells. When this analysis was repeated with another transheterozygous (tj39/tjDf1)
mutant, it also resulted in longer terminal filaments with cap cells becoming part of the stalk
rather than forming a cluster (data not shown).
3.2.3 The number of GSCs associated with the cap cells in weak
tj mutant ovarioles was dependent on the three-dimensional
organization of the cap cells
In weak tj mutant ovarioles, while cap cells seem to be present, most of them take on an atypical
morphology and become part of the cylindrical terminal filament stalk outside the germarium.
66
Normally the cap cells are located at the tip of the germarium where they can be accessed by
GSCs. GSCs are physically anchored to cap cells by adherens junction (Song et al. 2002). The
more of the cap cells become part of a terminal filament stalk, the less remain in the germarium
where they are available to contact GSCs. In an extreme case, in which all the cap cells form a
perfectly aligned stack of cells, only the most basal cell would be able to make contact to a GSC.
I hypothesised that the number of cap cells remaining in the germarium would determine the
number of GSCs that can be recruited or anchored. Thus, the abnormal organization of cap cells
in weak tj mutant germaria would lead to a reduction in niche size, and consistent with this
hypothesis I found that 53% of germaria carried only one GSC. The remaining 47% of the
germaria carried two GSCs and occasionally 3GSCs. So how do we explain the presence of 2
and 3 GSCs in weak tj mutants when the cap cells are organized into a stalk? We find the answer
on closer examination of the spatial organisation of the cap cells in instances where we observed
one versus two versus three GSCs. I counted the total number of cap cells that were not part of
the stalk and compared this number to the number of GSCs. We observed that when a mutant
ovariole contained one GSC, two GSCs and three GSCs, the average number of cap cells that
resided in the germarium was 2.58, 3.7 and 5.7 cells, respectively (n=37). This supports the idea
that had been previously proposed by Xie and Spradling (2000) that on average 2 cap cells are
needed as a niche for one GSC.
3.2.4 Cap cells are not correctly specified in the absence of Tj
function
Considering that in weak tj mutant the additional stalk cells showed an expression profile that
was similar to cap cells, I asked what effect the complete loss of Tj function would have on cap
cells. I investigated the additional stalk cells of a tj null mutant using again the markers LaminC,
67
B1-93F, Bab2 and 1444-LacZ that show differences in expression between cap cells and terminal
filament cells (Table 3). In the control gonads, an average of 8.8 (n=30; ranging from 8-10)
terminal filament cells showed strong expression of both LaminC and B1-93F-lacZ. These
control germaria contained an average of 6.3 cap cells (n=30; ranging from 5-9 cells; Table 5)
formed a cluster at the tip of the germarium and expressed both LaminC and B1-93F-LacZ
weakly (Fig. 15A). Contrary to the expression pattern in the control germaria, in tj null mutant
stalks (tjeo2/tjeo2; B1-93F-lacZ), all the 15.9 cells (n= 30; ranging from 12-22 cells; Table 5)
within a stalk showed a strong expression of both LaminC and B1-93F-LacZ (Fig. 15B, C). In
this tj mutant, I did not observe a cluster of somatic cells at the tip of the germarium. Unlike the
control germaria where the terminal filaments were always nicely aligned in a single row within
the entire length of the stalk (Fig.15A), I found that the abnormally long tj null mutant stalks
often showed variable forms of disorganization. The top part of the terminal filament consisted
of better aligned cells compared to the bottom part of the stalk where the cells were somewhat
misaligned (Fig. 15B, C).
Next we looked at the expression of Bab2 and 1444-lacZ. In a control ovariole, Bab2 was
expressed strongly in cap cells and weakly in terminal filaments (n=34; Fig. 16 A’’). In
comparison, in tj null mutants, all the cells in the abnormally long stalks showed a weak
expression of Bab2, consistent with the wild-type terminal filament cell expression pattern
(n=27; Fig. 16B’’). Unlike LaminC, Bab2, and B1-93F-LacZ that are expressed in both cap cells
and terminal filaments although at different levels (Table 3), in a wild-type ovariole 1444-lacZ is
the only marker that is expressed in cap cells, but not in cells of the terminal filaments. In three
independent experiments I found that the additional stalk cells in tj null mutant ovaries
(tjeo2/tjeo21444-LacZ) did not express 1444-LacZ (n=27; Fig. 16B, B’’’). This analysis was
repeated with tj4735/tjeo21444-LacZ mutant ovaries where the bottom half of the abnormally long
68
Figure 15. Additional stalk cells in the tj null mutant show expression of LaminC and B1-
93F-lacZ in a terminal filament cell specific manner. (A) A B1-93F-lacZ control germarium.
(A’,A’’) Both LaminC and B1-93F-lacZ are expressed strongly in the terminal filament (TF).
However, the cap cells (Cc) express LaminC and B1-93F-lacZ weakly. (B-C) Two examples of tj
null mutant (tjeo2/tjeo2; B1-93F-lacZ) ovaries showing the abnormally long stalks consisting of
additional stalk cells (Asc). In both cases, all the cells in the stalk show a strong expression of
both LaminC and B1-93F-lacZ. The cluster of weak LaminC and B1-93F-lacZ expressing cells
was absent. (B-C) The top part of the stalk consisted of more aligned cells compared to the
bottom part. (C) An example where a terminal filament was followed by a double stalk. These
images represent a projection of several confocal sections.
69
70
Figure 16. The additional stalks cells in tj null mutant show expression of Bab2 and 1444-
lacZ in a terminal filament specific manner. These images represent a single confocal section.
(A) A 1444-lacZ control germarium. (A’) LaminC is expressed in both terminal filaments (TF)
and cap cells (Cc). This marker helps distinguish the cap cells from posterior escort cells. (A’’)
Bab2 is expressed weakly in terminal filament and strongly in cap cells. (A’’’) Terminal filament
cells do not express 1444-lacZ. Cap cells and escort cells express 1444-lacZ. (B) A tj null mutant
(tjeo2/tjeo2; 1444-lacZ) mutant ovary showing two abnormally long terminal filaments with
additional stalk cells (Asc). (B’) 17 cells in a stalk are nicely aligned and positive for LaminC.
(B’’) All 17 cells in the stalk show weak Bab2 expression. (B’’’) The additional stalk cells (Asc)
in the lower half of the stalk do not show expression of 1444-lacZ.
71
72
stalks showed Tj expression because unlike tjeo2, the tj4735 allele produces detectable levels of Tj
protein, which however is not functional. Using this null allelic combination the transformed cap
cells could be readily visualised. This analysis confirmed that additional stalk cells lacked
expression of the 1444-LacZ marker (data not shown). Thus, the altered expression of several
markers: LaminC, B1-93F-lacZ, Bab2 and 1444-LacZ suggests that cap cells are transformed
into terminal filament cells in the absence of Tj function.
Cap cells form at the larval to pupal transition (Song et al., 2007). To determine whether the
additional terminal filament cells form at the expense of cap cells at that stage or later, I looked
for cap cell presence in transheterozygous tj4735/tjeo21444-LacZ prepupal (1-5 hour old prepupae),
and pupal (3 day old pupae) gonads. I used LaminC, Tj and 1444-LacZ for this analysis. In
prepupal control gonads, terminal filaments do not express Tj and 1444-LacZ, and express high
levels of LaminC (Fig. 17A). Likewise, in tj null mutants, the terminal filament cells showed an
expression pattern similar to the control terminal filaments (Fig. 17B). In the control gonads, the
cap cells at the base of terminal filaments strongly expressed Tj and 1444-LacZ (n= 5; Fig. 17A)
while LaminC was not or only barely visible in cap cells at this stage. However, in the tj null
mutant, beginning at the prepupal stage, we saw Tj positive cells being incorporated into
terminal filament stalks (n=6; Fig. 17B). These Tj positive stalk cells showed high expression of
LaminC and lacked expression of 1444-LacZ. This analysis reveals that in tj null mutants, cap
cells do not form at the larval to pupal transition.
At the pupal stage, in both wild-type and tj null mutant ovaries, the terminal filament cells
showed an expression pattern identical to the prepupal stage terminal filaments (Fig. 18A,B).
The cap cells in the control gonads at the pupal stage showed a weak expression of LaminC and
strongly expressed both Tj and 1444-lacZ (Fig. 18A). In comparison, in tj null mutant ovaries,
73
Figure 17. The cap cell marker 1444-lacZ is not detected in tj null mutant prepupal ovaries.
(A) A tjZ4735/+ control prepupal ovary showing the newly formed cap cells (Cc) are organised
into a cluster (non-aligned cells) at the base of terminal filaments (TF). LaminC is expressed
strongly in TFs and barely visible in these cap cells. (A’) These cap cells are positive for Tj and
1444-lacZ. (A’’) Terminal filaments do not express detectable levels of 1444-lacZ. (B) A
tjeo2/tjZ4735; 1444-lacZ mutant prepupal ovary showing the newly formed cap cells are organised
into a stalk. These additional Tj positive stalk cells show high expression of LaminC. (B’) The Tj
positive cells are disc-shaped and are integrated into the TF stalk. (B’’) Tj positive stalk cells do
not express 1444-lacZ.
74
75
Figure 18. The additional stalk cells in tj null mutant pupal ovaries lack cap cell-typical
expression of markers. (A) A tjZ4735/+ control pupal germarium showing 7-8 cap cells (Cc) that
are organised into a cluster at the base of a terminal filament (TF). Cap cells express Tj and
1444-lacZ and weakly LaminC whereas terminal filaments only express LaminC. (B) A
tjeo2/tjZ4735; 1444-lacZ mutant pupal ovary showing an abnormally long terminal filament. The
upper 8 cells in the stalk only express LaminC. The additional stalk cells (Asc) do not express
the cap cell marker 1444-lacZ. (C) A projection of a the tjeo2/tjZ4735; 1444-lacZ pupal ovary
generated by taking several confocal sections showing the additional Tj positive stalk cells are
organised in various forms. Terminal filament cells are followed by: (1-2) Tj positive cells that
are organised into double stalks marked with brackets, (3) Tj positive cells that are nicely aligned
and organised into a single stalk, (4) 7 Tj positive cells organised into a stalk followed by a
cluster of numerous Tj positive cells.
76
77
the additional Tj positive stalk cells continued to show high expression of LaminC and lacked
the expression of 1444-LacZ (Fig. 18B). We found variations in the organisation of the Tj
positive stalk cells. At the base of terminal filaments, the Tj positive cells would either form a
single stalk (Fig. 18C-3) or a double stalk (Fig. 18C-1, 2), in which cells were aligned properly
and stacked on top of one another. We also found several cases where Tj positive cells that were
aligned in a single row were followed by Tj positive cells that were organised into a cluster (Fig.
18B, C-4).
To summarise, the cap cell analysis done utilizing the tj4735 allele (detectable levels of Tj)
showed that Tj positive additional stalk cells do not express cap cell markers and suggests that
these cells assume the terminal filament cell fate.
I also used B1-93F-lacZ to look at the organisation of cap cells and terminal filament cells in the
prepupal ovary. Compared to the adult ovaries, this marker has a different expression profile in
the prepupal ovary. In the prepupal control ovary, B1-93F-lacZ was expressed in the bottom 4-6
terminal filament cells (n=11; Fig. 19A). The non-aligned cells at the base of terminal filaments
are cap cells. Cap cells also express B1-93F-lacZ. In tjeo2/tjeo2; B1-93F-lacZ null mutant ovaries,
the cluster of non-aligned cap cells expressing B1-93F-lacZ was missing and we saw an
expansion in the number of terminal filament cells that were expressing B1-93F-lacZ: ranging
from 6-9 (n=9; Fig. 19B). This marker shows the transformed cap cells behave like terminal
filament cells with their nuclei aligned in a single row and integrated in the terminal stalk
compared to the wild-type cap cells.
3.2.5 tj null mutant gonads contain additional somatic cell defects
The tj null mutant phenotype is complex because the misregulation of several factors leads to a
78
Figure 19. Prepupal tj null mutant ovaries show the transformed cap cells behave like
terminal filament cells. (A) A control ovary (+; B1-93F-lacZ) showing LaminC and B1-93F-
lacZ expression. LaminC is expressed strongly in terminal filaments (TF) and barely visible in
cap cells (Cc). (A’) B1-93F-lacZ is expressed strongly in the bottom 4-6 terminal filament cells
and cap cells. The cap cells are organised into a cluster (non-aligned cells) at the base of the
terminal filament. (B) A tjeo2/tjeo2; B1-93F-lacZ prepupal ovary. All the cells in the terminal
filament stalk stain strongly for LaminC. (B’) B1-93F-lacZ is expressed strongly in 6-9 stalk
cells (yellow arrowheads) , an increase compared to the control. The cluster of non-aligned cap
cells at the base of these stalks is missing. This markers shows that at the prepupal stage
transformed cells are aligned into a stalk and behave similar to terminal filament cells. The
images here represent a projection of several confocal sections.
79
80
disruption in soma-germline interactions early on during development and this consequently
impairs other aspects of ovarian development (Li et al., 2003). My analysis indicates that in tj
null mutants while cap cells appear to be transformed, terminal filaments cells form normally
based on the expression profile of several markers that were expressed in a terminal filament cell
specific manner. However, the organization of terminal filament stalks within the gonads was
abnormal. The terminal filaments were often not parallel to each other and instead positioned
into different directions and frequently seemed entangled (data not shown). In addition, these tj
null mutant ovaries also contained reduced number of stalks. While wild-type (w1118) ovaries
contained an average of 19.2 stalks (n=17; ranging from 16-22), the tj null mutant ovaries
contained an average of 15 stalks (n=18; ranging from 12-18), a significant reduction
(p<0.0001).
3.2.6 Cap cells can form a cluster in the absence of a germline
In the weak tj mutant germaria ovaries, the number of GSCs was reduced by approximately 50%
and in tj null mutant ovaries even fewer GSCs were established. Given this severe reduction in
GSCs, and the fact that in both tj mutants-cap cells (weak tj mutant) and transformed cells (tj null
mutant)-are organized into a stalk, we asked whether it is due to the reduction in the number of
GSCs that cap cells were organized into a stalk. To address the possibility that GSCs are required
for the organization of cap cells into a cluster, I looked at the organization of cap cells in a tudor
mutant. tudor mutants are defective in the formation of pole cells that give rise to PGCs and
ultimately GSCs (Arkov et al., 2006). If GSCs are indeed required for preventing cap cells from
taking on a disc-shaped appearance and stacking up, I would expect to see tudor mutant cap cells
being incorporated into terminal filament stalks, similar to the tj mutant. My analysis showed
that in tudor mutant ovaries, the base of terminal filaments contained a cluster of non-aligned
81
round cells that were similar in morphology and position to the wild-type cap cells (Fig. 20A, C).
Moreover, these round cells showed high expression of Bab2 and Tj similar to the wild-type cap
cells (Fig. 20A). Unlike the wild-type cap cells that show weak LaminC, tudor mutants show
high LaminC staining (Fig. 20A’,C’). My analysis revealed that cap cell cluster morphology
seems not dependent on the presence of GSCs. This indicates that the abnormal organization of
cap cells in tj mutants is not due to a reduction in the number of GSCs.
Interestingly, compared to wild-type germaria that contained an average of 7.7 cap cells (n=11;
ranging from 7-9; Table 5), tudor mutant germaria consisted on average of 3.7 cap cells (n=49;
ranging from 2-6 cells), a statistically significant reduction in the number of cap cells (p<0.0001;
Table 5). This reduction in cap cells led me to ask whether the missing 3-4 cap cells may be
transformed into terminal filament cells. Therefore, I counted the total number of cells in
individual terminal filaments. tudor mutants contained on average 7.1 cells per stalk (n=44;
ranging from 6-9 cells; Table 5), which was a slight reduction compared to wild-type, which
contained an average of 8 cells per stalk (n=11; ranging from 7-9; p=0.01; Table 5). Since we did
not see an increase in the total number of cells per stalk, we concluded that in tudor mutants, cap
cells are not transformed into terminal filament cells. This observations suggests that germ cells
influence the number of cap cells, but not their morphology or behaviour.
3.2.7 Cap cells are organized into a cluster in piwi mutant
ovarioles
piwi is a potential target gene of Tj (Saito et al., 2009) and piwi and tj mutants show phenotypic
similarities. In both tj and piwi mutants, larval somatic cells fail to intermingle PGCs (Li et al.,
2003; Saito et al., 2009).
82
Figure 20. Both piwi and agametic (tudor) mutant germaria contain a reduced number of
cap cells that are organised into a cluster. (A) A wild-type germarium showing cap cells with
high expression of Tj and Bab2, whereas the terminal filament (TF) does not express these
markers. These cap cells are organised into a cluster at the base of the terminal filaments. (A’)
LaminC is expressed strongly in the terminal filament and weakly in most of the cap cells. The
image in (A) is a projection of several confocal sections whereas the image in (B-C) represent
single confocal section. (B) A piwi1/piwi2 mutant germarium, showing a reduced number of cap
cells that are organised into a cluster. The cap cells show high expression of LaminC (B’), Tj and
Bab2 (B’’). (C) A tudor mutant germarium showing two terminal filaments. The cap cells are
organised into a cluster at the base of these terminal filament and show high expression of Tj and
Bab2 (C’’). (C’) These cap cells show LaminC staining at levels similar to terminal filament
cells.
83
84
To determine whether Piwi expression in cap cells depends on Tj, I looked at Piwi expression in
cap cells at the prepupal stage using antibodies against Myosin VIIa and Piwi. In the wild-type
prepupal ovaries, terminal filaments and cap cells were identified by the strong expression of
Myosin VIIa (Fig. 21A’). Both the terminal filaments and the transformed cells in tj null mutant
expressed Myosin VIIa at levels that was comparable to the wild-type (Fig. 21B’). In the wild-
type ovaries, Piwi was expressed highly in terminal filament cells, cap cells, and germline cells
(Fig. 21A, A’’). In tj null mutant prepupal ovaries, Piwi expression was abolished in the
transformed cells (additional stalk cells) (Fig. 21B, B’’). Surprisingly, Piwi was also lost in
terminal filaments. Germline Piwi expression remained unchanged, consistent with previous
reports (Saito et al., 2009).
To determine whether similar to tj null mutants, the GSC loss, which had previously been
observed in piwi mutants (Cox et al., 1998), was due to a defect in niche formation, I decided to
look at the organisation and number of cap cells in the viable piwi1/piwi2 mutant. Both piwi2 and
piwi1 are P-element mutations where the insertion is located within exon 4 and exon 1of the piwi
gene, respectively (Cox et al., 1998). Whether these mutations are piwi null alleles has not been
characterised. Wild-type germaria carried on average 7.7 (n=11; ranging from 7-9; Fig. 20A) cap
cells compared to piwi mutant germaria, which contained an average of 3 cap cells (n=42;
ranging from 0-6; Fig. 20B). Statistical analysis showed that piwi mutants contained a
significantly reduced number of cap cells (p<0.0001, Table 5). Importantly, the cap cells in the
piwi mutant were organized into a cluster, and showed high expression of Bab2 and Tj;
consistent with the expression of these markers in a cap cell specific pattern (Fig. 20B; Table 3).
Similar to the tudor mutant, piwi mutant cap cells expressed high levels of LaminC, which was
different compared to the wild-type cap cells that expressed weak LaminC (Fig. 20A’, B’). To
85
Figure 21. In tj mutant prepupal ovaries, Piwi expression is abolished in the additional
stalk cells. (A) A wild-type ovary (w1118) showing three terminal filaments (TF) followed by the
cap cells (Cc). (A’) Myosin VIIa is expressed highly at the cell membrane in both the terminal
filament and cap cells. (A’’) Nuclear Piwi is seen in terminal filament cells, cap cells, escort cells
and germline cells. (B) A tj null mutant (tjeo2/tjeo2) ovary. (B’) The terminal filaments and
additional stalk cells (Asc) in tj null mutant ovary show high Myosin VIIa expression similar to
the control. (B’’) In the tj null mutant ovary Piwi expression was abolished from the terminal
filament and cap cells. Piwi is still expressed in the germline.
86
87
rule out the possibility that the reduction in cap cells was due to a subset of cap cells being
transformed into terminal filaments, I also counted the number of terminal filament cells per
stalk. piwi mutants contained an average of 7.7 (n=31; ranging from 7-9) terminal filament cells
per stalk, similar to wild type that contained an average of 8 (n=11; ranging from 7-9; Table 5)
cells per stalk. Thus, I did not see an increased number of cells in piwi mutant terminal filament
stalks. My analysis indicates that Tj and Piwi have different effects on cap cells.
3.3. Analysis of the relationship between Tj and the Notch
signaling pathway 3.3.1 Loss of tj function does not affect expression of components
of the Notch signaling pathway
Overexpression of Notch in developing gonads leads to formation of extra cap cells whereas
removal of Delta from the basal terminal filament cell leads to a reduction in the number of cap
cells being formed (reviewed in Intro section 5.2). In a tj null mutant, cap cells appear to be
transformed into terminal filament cells. As both Tj and Notch are important for cap cell
formation, I looked for a possible interaction between Tj and the Notch pathway. To test whether
tj acts upstream of Notch, I looked for the expression of Notch and its ligand Delta in tj null
mutants using antibodies.
If tj modulates the Notch pathway at the level of ligand expression, I would expect Delta
expression in the additional stalk cells to resemble Delta expression in terminal filament cells. In
a control ovary, I found that Delta was highly expressed in developing terminal filaments at the
late 3rd instar larval stage and this high expression level was maintained at prepupal stages (Fig.
22A’). It was expressed at lower levels in prepupal cap cells and GSCs (Fig. 22A’). In tj null
88
mutants, terminal filaments showed high Delta expression (n=6; Fig. 22B’) similar to the control
(n=7). Interestingly, the additional stalk cells showed weak Delta expression similar to the
control cap cells (Fig. 22B’). To determine whether Tj regulates the Notch pathway at the level
of receptor expression, I looked at the expression of Notch protein in terminal filament and cap
cells during the larval to pupal transition. The terminal filaments and cap cells in tj mutant
ovaries (n=6), expressed Notch protein at a level that was comparable to the control gonads
(n=5) (data not shown).
Although Tj does not appear to modulate Notch ligand or receptor expression, it is possible Tj
may regulate Notch activation instead. The Enhancer of split E(spl) genes, which encode the
effectors of the Notch pathway are also transcriptionally upregulated by activation of the
pathway (Delidakis and Artavanis-Tsakonas, 1992). In control prepupal gonads, a E(spl)mβ
reporter, E(spl)mβ-CD2, was strongly expressed in terminal filament and cap cells (n=7; Fig
22C’), consistent with previous observations of E(spl)mβ-CD2 expression within these cell
populations (Song et al., 2007). Likewise in tjZ4735/tjeo2 mutants, the terminal filaments continued
to show high expression of E(spl)mβ-CD2 and the transformed cells (marked with Tj) also
showed high expression of E(spl)mβ-CD2 (n=6; Fig. 22D’). These data suggest that Tj does not
modulate Notch activation in cap cells. However, E(spl)mβ is one of the seven proteins encoded
by the genes of the E(spl) complex, and it cannot be ruled out that Tj is involved in the regulation
of one of the other E(spl) genes. Taken together, there is no evidence that would suggest Tj acts
upstream of the Notch pathway.
89
Figure 22. The additional stalk cells in tj null mutant prepupal ovaries show expression of
Delta and E(spl)mβ-CD2 in a cap cell specific manner. (A) A confocal section of a control
tjZ4735/+; babA128-lacZ/+ ovary with terminal filaments (TF) showing high expression for Delta.
Cap cells (Cc) show a weak expression of Delta. (B) A tjeo2/tjZ4735; babA128-lacZ/+ mutant ovary
showing terminal filament cells continue to express high levels of Delta. The additional stalk
cells (Asc) express low levels of Delta. (C) A confocal section of a control tjZ4735/E(spl)mβ-CD2
ovary. Both terminal filament and cap cells highly express E(spl)mβ-CD2. (D) A confocal
section of a tjZ4735/tjeo2E(spl)mβ-CD2 mutant ovary. Both the terminal filament and the additional
stalk cells show high expression of E(spl)mβ-CD2.
90
91
3.3.2 Notch loss-of-function results in the formation of fewer cap
cells that are organized into a cluster
Next I investigated whether Tj might function downstream of the Notch pathway. To confirm the
effects of Notch on cap cell formation and to look for interactions with Tj, I did Notch loss-and
gain-of-function experiments. To determine whether knock-down of Notch produces a phenotype
similar to tj mutants, I looked at the arrangement and number of cap cells in the absence of
Notch. To knock down Notch (UAS-Notch-RNAi), I used a somatic driver (c587-Gal4) that is
expressed in most of the somatic cells in the developing ovaries. The wild-type germaria carried
on average 7.7 cap cells (n=11; ranging from 7-9; Table 5) and these cap cells showed strong Tj
expression and weak LaminC (Fig. 20A). In two day old adult females, Notch knock-down
resulted in a statistically significant reduction in the number of cap cells (n=15; p<0.0001; Table
5). Germaria in which Notch was knocked down carried on average only 1.3 cap cells with cap
cell numbers ranging from 0-4 (Fig. 23A, B). 40% of germaria lacked cap cells altogether
(n=11). The remaining few cap cells showed weak expression of LaminC and normal expression
of Tj, similar to wild-type cap cells (Fig. 20A, 23B). These remaining cells were organized into a
cluster, similar to wild-type cap cells. This shows for the first time, loss of Notch can lead to a
complete loss of cap cells.
To determine whether the missing cap cells in the absence of Notch were also transformed into
terminal filament cells similar to the tj mutant, I counted the number of terminal filament cells
within a stalk in Notch knock-down ovaries. Compared to the wild-type terminal filament stalks
that contained an average of 8 cells per stalk (ranging from 7-9; Table 5), the Notch knock-down
resulted in slightly shorter terminal filaments that consisted on average of 7 terminal filament
cells per stalk (n=13; ranging from 5-8; p<0.02; Table 5).
92
Figure 23. The effects of Notch and Tj overexpression and Notch loss-of-function on cap
cell morphology and numbers. (A) A c587-Gal4/+; +/balancer; UAS-Notch-RNAi/+ (Notch
knock-down) germaria showing one cap cell (Cc) at the base of a terminal filament (TF). It
shows weak LaminC staining and high Tj expression, similar to wild-type cap cells (Fig. 20A).
(B) Another c587-Gal4/+; +/balancer; UAS-Notch-RNAi/+ germarium (Notch knock-down) with
3 cap cells that are organised into a cluster. (C) A tj-Gal4/UAS-tj germarium (Tj overexpression)
showing about 7 cap cells that are positive for Tj and weakly express LaminC. They are
organised into a cluster. (C) A tj-Gal4/UAS-Notchintra germarium (Notch overexpression)
showing at least 19 cap cells that are positive for Tj and weakly express LaminC. These cap cells
are organised into a cluster. These images represent a projection of several confocal sections.
93
94
Thus, unlike tj mutants, reduction of Notch caused a decrease in the number of cap cells and
importantly, these cap cells were organised into a cluster.
3.3.3 Ectopic Notch expression and Tj overexpression resulted in
different mutant phenotypes
To determine whether the extra cap cells formed by ectopic expression of Notch were positive
for Tj, I expressed UAS-Notchintra , which encodes the NCID, using the c587-Gal4 somatic
driver. Unfortunately, the flies did not survive past embryonic stage (at 25ºC) or pupal stage
(18ºC). So I used tj-Gal4 another somatic driver instead. When tj-Gal4 was used to express
Notchintra, the two day old females contained extra cap cells, consistent with previous findings
(Fig. 23D; Song et al., 2007). These extra cap cells expressed LaminC and Tj in a cap cell
specific manner (Fig. 23D) and were organized into a cluster at the base of a terminal filament
similar to wild-type cap cells. Surprisingly, ectopic Notch activation also resulted in a
statistically significant increase in the number of terminal filament cells (P=0.0003). Notchintra
expressing germaria carried on average 9.8 terminal filament cells (n=19; ranging from 8-11)
compared to wild-type germaria, which contained an average of 8 cells (n=11; ranging from 7-9;
Table 5).
To investigate whether overexpression of tj also resulted in the formation of extra cap cells, I
overexpressed tj using again the somatic driver tj-Gal4. tj overexpressing germaria contained on
average 6 cap cells (n=20; ranging from 5-10; Fig 23C; Table 5), a reduction compared to wild-
type germaria that contained on average 7.7 cap cells (n=11; ranging from 7-9; p=0.0005). tj
overexpressing germaria contained an average of 8.5 terminal filament cells per stalk (n=20;
ranging from 7-11; Table 5), which was comparable to wild-type germaria, which had on
95
average of 8 terminal filaments cell per stalk. Thus, unlike ectopic Notch activation,
overexpression of tj does not result in the formation of extra cap cells.
Chapter 4. Discussion
4.1. Tj is required for the specification and the three-
dimensional organization of cap cells
In the Drosophila ovary, a group of 5-7 cap cells form a niche for an average of 3 GSCs. GSC
numbers can be increased or decreased when we alter the niche size by altering the number of
cap cells (Ward et al., 2006; Song et al., 2007; Hsu and Drummond Barbosa, 2011). Dansereau
and Lasko (2008) showed that niche size can be increased by increasing the size of cap cells.
Thus, to date most of the work has shown that GSC numbers can be altered through mechanisms
that alter the number or size of niche cells and not their organization. We have shown for the first
time that apart from altering the number of cap cells, niche size can also be altered by the spatial
organization of cap cells themselves. The three-dimensional organization of cap cells determines
the number of GSCs that can be recruited. Here, I have presented data that show that Tj is an
important factor required for the organization of cap cells into a cluster. In the absence of Tj, cap
cells are organized into a stalk. In the next chapter (4.2), I will argue that this organization
reduces the niche size and as a result the number of GSCs that can be anchored or recruited.
Apart from regulating the three-dimensional organization of cap cells, my analysis also shows
that in the absence of Tj cap cells are not specified properly.
tj mutants contain abnormally long terminal filaments. In adult gonads, we have shown that the
total number of cells in the abnormally long stalk is similar to the number of terminal filament
cells plus the number of cap cells in wild type. Furthermore, we found that the number of
96
terminal filaments was reduced in tj null mutant compared to wild type. In other words, tj
mutants contained fewer terminal filaments that were abnormally long.
One possible mechanism that could contribute to the formation of fewer, but abnormally long
terminal filaments could be changes in the cell intercalation process that leads to stalk formation
(Godt and Laski, 1995). Such a change has been proposed by Sarikaya et al. (2012) who found
that under certain conditions such as low temperature the number of terminal filaments cells
within stalks increases slightly-an increase of one or two cells per stalk-while the number of
stalks decreases with the total pool of terminal filament cells remaining constant. We can rule
such an explanation for the extra cells in the abnormally long tj mutant stalks due to the
following three observations. First, tj mutant stalks were much longer containing up to six to ten
additional cells per stalk. Second, we have shown that in the weak tj mutant, the cells at the
bottom of the stalks stained positive for Tj and expressed various markers in a cap cell specific
manner. Thus, in the weak tj mutant, cap cells appear to be specified normally. However, these
cap cells became incorporated into a stalk. Third, in a null allelic combination of tj (tjeo2 1444-
lacZ/tjZ4735) where the tjZ4735 allele produces detectable Tj protein, although non-functional, the
abnormally long stalks also contained Tj positive cells. Thus, the abnormally long stalks in tj
mutants are not created by an addition of more regular terminal filament cells. Rather, cap cells
arrange into a stalk instead of a cluster.
We asked whether this abnormal behaviour of cap cells might be a result of the reduced number
of GSCs? To test whether GSCs are important for the organisation of cap cells into a cluster, I
looked at cap cells in agametic ovaries that do not contain a germline. Song et al. (2007) have
reported the presence of LaminC positive cap cells (ranging from zero to 5) in agametic ovaries.
However, they did not address the organization of cap cells or report the average number of cap
97
cells. In addition, they did not use additional markers to show that LaminC positive cells
observed in agametic mutants were indeed cap cells. My data show that the agametic tudor
mutant contains cap cells that are organized into a cluster even though their number is reduced.
Thus, my analysis indicates that GSCs are not required for the organisation of cap cells into a
cluster.
Unlike the weak tj mutant where cap cells seem to be specified normally according to several
cell markers in the tj null mutant, we found that beginning at the prepupal stage the additional
stalk cells (transformed cells) showed expression of markers in a terminal filament cell-specific
manner. The transformed cells retained the abnormal morphology and expression during the
pupal and adult stages. This analysis suggests that Tj is needed for the establishment of the cap
cell fate. In the absence of Tj function, the cap cells appear to take on a terminal filament cell
fate, which might to be their default state.
Godt and Laski (1995) have proposed that the mechanisms that underlie terminal filament
formation utilise different adhesive properties of cells. Prior to basement membrane formation,
terminal filaments exclusively form cell-cell interactions with each other. However, the
formation of basement membrane provides a new interaction substrate and so in addition to the
cell-cell interaction, the terminal filaments also form cell-substrate interactions. Likewise, cap
cells also form cap cell-cap cell and cap cell-substrate interaction. However, unlike terminal
filaments, cap cells also interact with GSCs. My analysis of the agametic mutant has shown that
the absence of the germline did not contribute to the organisation of cap cells because these cap
cells were still part of the germarium, in contrast to tj mutants. Moreover, my analysis from both
weak and tj null mutants strongly suggests that cap cells are still able to adhere to GSCs in tj
mutants. Based on morphology and position of the cap cells and the transformed cells in weak
98
and tj null mutants respectively, we speculate that there is a change in the interaction between the
cap cells or their interaction to the extracellular matrix. Given that Tj has been shown to regulate
the expression of cell adhesion molecules (Li et al., 2003), we propose that changes in the
expression of one or more cell adhesion molecules could be responsible for the changes in the
morphogenetic behaviour of the cap cells. One possible scenario would be that a reduction in Tj,
increases the level of cell substrate adhesion molecules such as integrins resulting in an increase
in cell-substrate interactions. This would pull the cap cells away from the germarium into the
stalk where they are more extensively exposed to extracellular matrix.
To summarize, we have discovered that Tj is required for cap cell formation. The analysis using
the weak tj mutant and the tj null mutant was insightful because it allowed us to distinguish that
Tj is regulating two different aspects of cap cells: morphology and overall specification. One or
more genes that regulate cap cell morphology and behaviour seem to be particularly sensitive to
the amount of the transcription factor because a partial loss of Tj affects these aspects of cap
cells. Other genes seem to be less sensitive to reduced Tj concentration. However, when Tj
function is absent, the general expression profile changes dramatically in presumptive cap cells.
4.2. Reduction or loss of Tj reduces the niche size and
consequently the number of GSCs
In the weak tj mutant, cap cells even though they seem to be specified normally based on their
expression profile, take on a different morphology. The interesting finding was that the mutant
ovaries contained a reduction in the number of resident GSCs. 53% of the germaria only carried
one GSC. My analysis suggests that the number of resident GSCs was dependent on the number
of cap cells that were part of the germarium. Thus, in weak tj mutant ovaries the organization of
99
cap cells into a stalk reduces the niche size, and therefore fewer GSCs can reside within the
niche.
Another possible explanation for the presence of fewer GSCs could be insufficient secretion of
Dpp by the abnormal cap cells. Although we cannot entirely rule out this possibility, the
following observations strongly suggest otherwise: (1) we did not find an obvious reduction in
pMAD levels, which would be an indication that Dpp signaling is reduced, and (2) more
importantly, we have shown that the abnormal organization of cap cells in this mutant did not
affect the maintenance of resident GSCs. Based on the analysis of the tj null mutant, discussed in
the paragraphs below, we propose that in the weak tj mutant, the observed reduction in GSC
number is also due to a defect in GSC establishment caused by a reduction in niche size.
Compared to the wild-type situation where the cap cells in the developing ovarioles recruited 2-3
PGCs to be established as GSCs, in tj null mutant ovaries, we found that the abnormal stalks
only recruited a single PGC. We found that in the weak tj mutant, when most of the cap cells
were part of the stalk, GSCs were also reduced to one. We propose that the organisation into a
stalk leads to a severe reduction in niche size as there is only a single cell at the base of these
stalks that is in contact to a germline cell. Thus, in the absence of Tj, the organisation of the
transformed cells into a stalk reduces the niche size.
In the tj null mutant, cap cells seem to be transformed into terminal filament cells and therefore
might be expected to be defective in the production of niche factors. Hence, the finding that in tj
null mutant ovaries, an average of 69% of the terminal filaments recruited a germline cell was
surprising. This result suggests that the transformed cells are able to produce the niche factors
necessary for GSC recruitment. It has been reported that Dpp from the niche is required for the
recruitment of PGCs, which become the GSCs (Gilboah and Lehman, 2004; Zhu and Xie, 2003).
100
At the prepupal stage, terminal filaments and cap cells are a prominent source of Dpp (Sato et
al., 2010). Therefore, the transformed cells, which are now terminal filament-like, can be
expected to express Dpp, which might explain why some stalks recruit GSCs in the tj null
mutant. The reason that approximately one-third of the stalks did not recruit a PGC might be due
to two factors: a defect in physical proximity and/or insufficient Dpp. The physical proximity of
germline cells to niche cells in the prepupal ovary determines accessibility to niche signals
because in a wild-type situation, only the anterior PGCs can sense and respond to niche signals.
In tj null mutant ovaries, the germline cluster was often mis-positioned in such a way that it was
not in physical proximity to any terminal filaments. This might explain why these terminal
filaments could not recruit a GSC. The second possibility is that even though the abnormal tj
mutant stalks seem capable of secreting niche signals, the amount of signal may not be always
sufficient to recruit a PGC. Thus, the PGCs would remain unresponsive and cannot fill the empty
niches despite their proximity to the niche. One way to distinguish between these two
possibilities would be to express high levels of Dpp in the transformed cells and see whether this
would lead to an increase in the number of recruited GSCs.
There are several observations that together suggest that terminal filaments cannot recruit a GSC.
Both in wild-type germaria (own observation) and in a Notch overexpression experiment (Song
et al., 2007), cap cells were occasionally located to one side at the base of terminal filaments,
with only some overlap between the basal terminal filament cell and the cap cell cluster. In such
a case, terminals filaments are directly exposed to the underlying germline, which should provide
an opportunity for the basal terminal filament cell to recruit and anchor a GSC. This, however
was not the case. I observed that GSCs although in juxtaposition to terminal filaments were
sending out processes towards cap cells and not the basal terminal filament cell. Furthermore, in
the absence of Notch function, I observed that in some cases where the germaria did not contain
101
any cap cells, the terminal filaments were followed by a big egg chamber and not the germarium,
indicating a lack of GSCs. Third, it has been shown by two independent groups that the amount
of secreted Dpp is not sufficient to recruit GSCs, instead the secreted Dpp needs to be
concentrated so it can be made available to GSCs (reviewed in Chen et al., 2011). Only cap cells
secrete Dally, which helps concentrate Dpp. Terminal filaments do not express Dally and thus,
they cannot concentrate Dpp. This suggests the transformed cells in tj null mutants might be
capable of expressing Dally.
4.3. tj null mutant ovaries are defective in the maintenance
of GSCs
In comparison to the weak tj mutant, we found that two-day-old adult tj null mutant ovaries
rarely contained GSCs. Given that even the tj null mutant females were able to establish GSCs at
the prepupal stage-although at a reduced number-the analysis of the adult ovary suggests that the
GSCs were lost sometime during the pupal stage. This is different from GSCs in weak tj mutant
ovaries that did not appear to be defective in their maintenance.
4.3.1 The GSC maintenance defect in tj null mutant ovaries is
unlikely caused by a defect in cap cell-GSC interaction
Another important niche factor is DE-cadherin. Song et al. (2002) have implicated DE-cadherin
as an adhesion molecule required to anchor GSCs. If the transformed cells in tj null mutants were
defective in the expression of DE-cadherin, the germline clusters in the adult ovary would not be
positioned at the base of the abnormal stalks. Interestingly, my analysis shows that more than
90% of the germline clusters in the adult tj null mutant ovaries were positioned at the base of
abnormally long stalks. In addition, we found that the single germ cells juxtaposing the
102
transformed cells at the prepupal stage were clearly making contact with the cells at the base of
the abnormal stalks by sending out processes. Furthermore, preliminary observations of prepupal
ovaries suggested that DE-cadherin expression at the transformed cell-GSC-like cell interface
were comparable to the wild-type cap cell-GSC interface (data not shown). Thus, based on these
observations, my data strongly suggest that adhesion between cap cells and GSCs may not be
altered in tj null mutants and more importantly may not be contributing to the GSC loss that is
observed in these mutants.
4.3.2 Loss of Piwi expression in tj null mutants might cause the
loss of GSCs, but does not explain other aspects of the tj null
mutant phenotype
My analysis using GSC specific markers showed that tj null mutants established fewer GSCs and
these GSCs were lost overtime. Similarly in piwi mutants, GSCs appear to be established
normally, but at the pupal stage, a failure in GSC maintenance resulted in their loss (Cox et al.,
1998). Thus, adult piwi ovarioles do not contain GSCs. It was shown that it is somatic Piwi that
is important for GSC maintenance (Cox et al., 1998). Specifically, it is the cytoplasmic Piwi in
the somatic niche cells that is indispensable for GSC maintenance (Klenov et al., 2011).
Moreover, it has been shown that Piwi expression in larval somatic interstitial cells depends on
Tj (Saito et al., 2009), and I showed that Tj is also needed for Piwi expression in cap cells and
terminal filament cells. It has been proposed that Piwi might be a transcriptional target of Tj
(Saito et al., 2009). The observed GSC depletion in tj null mutants might therefore be due to the
loss of Piwi expression in tj null mutants. My analysis suggests that the GSC maintenance defect
in tj null mutants is a consequence of the loss of Piwi expression from the transformed cells.
103
In piwi mutants, we found a severe reduction in the number of cap cells. However, these cap
cells were organised into a cluster and resided within the germarium. This is different from the tj
mutant phenotype where, while the normal number of cap cells seems to be set aside during
development, they appear to be transformed into terminal filament-like cells. Thus, my analysis
of the piwi mutant suggests the observed cap cell morphology and specification defects in tj null
mutants are not a consequence of loss of Piwi expression.
The loss of Piwi expression in terminal filaments in the tj null mutants was unexpected because
terminal filaments do not express Tj. Gilboah and Lehman (2006) have shown that in the second
instar larval stage all the somatic cells express Tj. They proposed that sometime between the
second instar larval stage and the third instar larval stage, cells in the anterior half of the ovary
stops the expression of Tj. This suggests that the precursors of terminal filament cells express Tj.
The loss of Tj in the precursors in the tj null mutant could be responsible for the observed loss of
Piwi expression in terminal filaments.
4.4. Notch and Tj appear to act independently in the
regulation of cap cell formation
The results of this study reveal that while both factors Tj and Notch are important for cap cell
formation, they seem to act independently of each other. Overexpression of constitutively active
Notch in the somatic cells of the developing gonads resulted in the formation of extra cap cells
(Ward et al., 2006; Song et al, 2007; Own observations). My data show for the first time that
Notch knock down can lead to a complete loss of cap cells. This suggests that in the absence of
Notch cap cells do not form. This analysis was done using a tj-Gal4 driver expressing UAS-
Notch-RNAi. Probably because the RNAi mediated knock down is often not complete, the
104
phenotype was variable, and 60% of germaria still carried cap cells, ranging from one to five. I
have shown that these extra cap cells show Tj expression that was comparable to normal cap
cells. These findings suggest that both Notch gain-of-function and loss-of-function do not affect
Tj expression in cap cells, implying that Notch is not regulating Tj expression. It seems Notch is
required for the formation of cap cells particularly by regulating the number of cap cells because
Notch gain-of-function and loss-of-function alters the number of cap cells. The specification of
the cap cells seemed not to be defective based on the Tj expression pattern (this thesis) and other
cap cell markers (Ward et al., 2006; Song et al., 2007).
Unlike Notch knockdown, loss of Tj did not result in elimination of cap cells, instead they
appeared to be transformed into terminal filament cells. However, the transformed cells showed
Notch protein expression and Notch activation similar to wild-type cap cells. Thus, it appears Tj
does not directly modulate Notch receptor expression or activation. Unlike overexpression of
Notch, overexpression of tj in the interstitial cells of the developing ovaries did not lead to
formation of extra cap cells. Clearly, tj gain-of-function and loss-of-function does not alter the
number of cap cells.
As Delta is normally expressed highly in terminal filaments and weakly in cap cells we would
expect the transformed cells to upregulate Delta. However, the transformed cells failed to
upregulate Delta to a level that is seen in terminal filaments. This could be due to one of the
following three reasons. First, tj does not modulate Delta expression in cap cells, so in the
absence of Tj, the transformed cells will not upregulate Delta. Second, the additional stalk cells
in tj null mutants might only be partially transformed, and therefore retain some cap cell
properties, even though several molecular markers and the morphology and behaviour indicate
otherwise. Lastly, the factors that cause high Delta expression in terminal filament cells are only
105
expressed at a stage when terminal filament cell development takes place, but are absent when
cap cells form at a later stage.
Taken together, my data suggest that Notch and Tj function independently in parallel pathways.
Notch seems to regulate the number of cap cells. In contrast, we propose that Tj is required for
the proper specification and morphology of cap cells and does not regulate the number of cap
cells. Hence, we propose that they function independently in the process that determines cap cell
number, fate, and organization. We propose the following model (Fig. 24): Notch acts on the
SGPs determining the pool of cap cell precursors. Then Tj activity leads to the specification of
these cells as cap cells. Once the cap cells are specified, Tj is required to organize the cap cells
into a cluster. Finally, the organization of cap cells determines niche size and the number of
GSCs that can be anchored or recruited.
4.4.1 Notch signaling modulates the number of terminal filament
cells
It has been previously shown that Delta expression in the basal terminal filament cells and not in
the remaining cells of the stalk was important for cap cell formation, because when the
developing ovaries contained basal terminal filament cells mutant for Delta, these females had a
reduced number of cap cells (Hsu and Drummond Barbosa, 2011). So the significance of high
Delta expression in the basal terminal filament cells is understood. However, what function high
Delta expression serves in the rest of the terminal filament cells is unknown.
My data indicate that Notch signaling is active not only in cap cells, but also in terminal filament
cells. In the absence of Notch, I found a slight reduction in the number of terminal filament cells.
Ectopic activation of Notch signaling resulted in a slight increase in the number of terminal
106
Figure 24. Model for the function of Tj in cap cell specification and differentiation
107
108
filament cells per stalk. Clearly, ectopic activation of Notch has a more dramatic effect on cap
cell numbers compared to terminal filament cell numbers (Table 5). Notch signaling is highly
active in terminal filament cells and the cap cells whereas Tj is expressed in the cap cells and the
interstitial cells. Togather this suggest that it might be the combined action of both Notch and Tj
that is important for cap cell formation.
To summarize, although Notch signaling occurs in both terminal filament and cap cells, Notch
signaling is crucial for regulating the number of cap cells and to a much lesser extent terminal
filament cells.
4.5. GSCs send out protrusions toward the cap cells
We have reported for the first time that GSCs send out small protrusions that are directed toward
cap cells in the adult ovarioles. A GSC sends out at least one protrusion, and often multiple
protrusions were seen contacting cap cells. In the weak tj mutant, the GSCs were also sending
out processes similar to wild-type GSCs. However, we found several examples where GSCs
were sending out an unusually long single process that was not observed in wild type. We
propose that the GSCs are sending out these processes in response to a niche factor.
It has been proposed that 2 cap cells are needed to sustain one GSC and my analysis of the
variable phenotype of the weak tj mutant corroborates this. If all cap cells are organised into a
stalk, the GSC has only direct contact to the cap cells at the base of the stalk, but by sending out
a longer protrusion it might be able to reach a second cap cell. Because the cap cells were
organized into a stalk in the weak tj mutant, this would mean that GSCs could sense a reduction
in niche size or more specifically a reduction in niche factor. It would be interesting to measure
the length of processes in weak tj mutants ovaries to show that the more accessible the niche, the
109
shorter the processes. When all cap cells are organized into a stalk we expect that the GSCs
would send out a longer process to contact cap cells and access the niche factor. When several
cap cells remain in the germarium making the niche more accessible to GSCs similar to wild
type, the protrusions of the GSCs would be much shorter in length.
The GSC protrusions were not restricted to adult GSCs. During the prepupal stages, when GSCs
are recruited from PGCs, we found that the anteriormost germline cells in the ovary also send out
a process that was always directed anteriorly toward the newly formed cap cells. Also, in tj null
mutant prepupal ovaries, we saw protrusions extending from the anterior germline cells towards
the abnormally long stalks. This suggests that the PGCs in tj mutants can sense some signal and
respond by extending a protrusion in that direction. The source of this signal is most likely the
newly formed cap cells and possibly to a certain extent terminal filaments. One possibility is that
this signal is Dpp that has been shown to be required for the establishment and maintenance of
GSCs (Gilboah and Lehman, 2004; Zhu and Xie, 2003; Sato et al., 2010).
110
References:
Arkov A.L., Wang J.Y., Ramos A., Lehmann R. (2006). The role of Tudor domains in
germline development and polar granule architecture. Development, 133, 20: 4053-62.
Bellan, H.J., O’Kane, C.J., Wilson, C., Grossniklaus, U., Pearson, R.K., Gehring, W.J.
(1989). P-element mediated enhancer detection: A versatile method to study development in
Drosophila. Genes and Development, 3: 1288-1300.
Bosewell, R.E . and Mahawold, A. P.. (1985). tudor, a gene required for assembly of the germ
plasm in Drosophila melanogaster. Cell, 43: 97-104.
Chen, D and Mckearin, DM. (2003). A discrete transcriptional silencer in the bam gene
determines asymmetric division of the Drosophila germline stem cell. Development, 130: 1159-
70.
Chen S, Wang S, and Xie T. (2011). Restricting self-renewal signals within the stem cell niche:
multiple levels of control. Curr Opin Genet Dev, 6: 684-9.
Couderc JL, Godt D, Zollman S, Chen J, Li M, Tiong S, Cramton SE, Sahut-Barnola I,
Laski FA. (2002). The bric à brac locus consists of two paralogous genes encoding BTB/POZ
domain proteins and acts as a homeotic and morphogenetic regulator of imaginal development in
Drosophila. Development, 129: 2419-33.
Cox, D.N., Chao, A., Baker, J., Chang, L., Qiao, D., Lin, H. (1998). A novel class of
evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes
and Development, 12: 3715-27.
Dansereau, D.A., Lasko, P. (2008). RanBPM regulates cell shape, arrangement, and capacity of
the female germline stem cell niche in Drosophila melanogaster. J. Cell. Biology, 182: 963--977.
DeCelis, J.F., Tyler, D.M., DeCelis, J., Bray, S.J. (1998). Notch signalling mediates
segmentation of the Drosophila leg. Development, 125: 4617-4626.
111
Decotto, E. and Spradling, A.C. (2005). The Drosophila ovarian and testis stem cell niches:
similar somatic stem cells and signals. Dev. Cell, 9: 501–510.
Delidakis, C and Artavanis-Tsakonas, D. (1992). The Enhancer of split [E(spl)] locus of
Drosophila encodes seven independent helix-loop-helix proteins. Proc. Natl. Acad. Sci., 89:
8731-8735.
Deng, W. and Lin, H. (1997). Spectrosome and fusome anchor mitotic spindle during
assymetric germ cell divisions and facilitate the formation of a polarized microtubule array for
oocyte specification in Drosophila. Dev. Biol., 189: 79-94.
Flatt, T., Min, K.J., D'Alterio, C., Villa-Cuesta, E., Cumbers, J., Lehmann, R., Leanne, J.D,
and Tatar, M. (2008). Drosophila germline modulation of insulin signaling and life span.
PNAS, 105: 6368-6373.
Gancz D, Lengil T, Gilboa L. (2011). Coordinated regulation of niche and stem cell precursors
by hormonal signaling. PLoS Biol. 11:e1001202.
Gilboa, L., Forbes, A., Tazuke, S. I., Fuller, M. T., Lehmann, R. (2003). Germ line stem cell
differentiation in Drosophila requires gap junctions and proceeds via an intermediate state.
Development, 130: 6625–6634.
Gilboa, L., and Lehmann, R. (2004). Repression of primordial germ cell differentiation
parallels germ line stem cell maintenance. Curr.Bio., 14: 981-6.
Gilboa L, Lehmann R. (2006). Soma-germline interactions coordinate homeostasis and growth
in the Drosophila gonad. Nature, 443: 97-100.
Godt, D., Couderc, J.L., Cramton, S.E., Laski, F.A. (1993). Pattern formation in the limbs of
Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for
specification and proper segmentation of the tarsus. Development, 119: 799-812.
Godt, D., and Laski, F.A. (1995). Mechanisms of cell rearrangement and cell recruitment in
Drosophila ovary morphogenesis and the requirement of bric à brac. Development, 121: 173-87.
112
Guruharsha, K.G., Kankel, M.W., Artavanis-Tsakonaset, S. (2012). The Notch signalling
system: recent insights into the complexity of a conserved pathway. Nature Reviews Genetics,
13: 654-666.
Harris, R.E., Ashe, H, L. (2011). Cease and desist: modulating short-range Dpp signalling in
the stem-cell niche. EMBO Rep.12: 519-26.
Hayashi, S., Ito, K., Sado, Y., Taniguchi, M., Akimoto, A., Takeuchi, H., Aigaki, T.,
Matsuzaki, F., Nakagoshi, H., Tanimura, T., Ueda, R., Uemura, T., Yoshihara, M., Goto, S.
(2002). GETDB, a database compiling expression patterns and molecular locations of a
collection of Gal4 enhancer traps. Genesis, 34: 58–61.
Hsu, H.J., and Drummond-Barbosa, D. (2009). Insulin levels control female germline stem
cell maintenance via the niche in Drosophila. Proc. Natl Acad. Sci., 106: 1117-1121.
Hsu, H.J., and Drummond-Barbosa, D. (2011). Insulin signals control the competence of the
Drosophila female germline stem cell niche to respond to Notch ligands. Dev. Bio., 350: 290-
300.
Jenkins, A.B., McCaffery, J.M., Van, D.M. (2003). Drosophila E-cadherin is essential for
proper germ cell-soma interaction during gonad morphogenesis. Development, 130: 4417–4426.
Kai, T., and A. Spradling. (2003). An empty Drosophila stem cell niche reactivates the
proliferation of ectopic cells. Proc. Natl. Acad. Sci.,100: 4633-4638.
King, R.C. (1970). Ovarian development in Drosophila melanogaster. Academic Press, New
York.
King, R.C., Aggarwal, S.K., Aggarwal, U. (1968). The development of the female Drosophila
reproductive system. J. Morphol., 124: 143-165.
King, F.J., Szakmary, A., Cox, D.N., Lin H. (2001). Yb modulates the divisions of both
germline and somatic stem cells through piwi- and hh-mediated mechanisms in the Drosophila
ovary. Mol Cell, 7: 497-508.
113
Kirilly, D., and Xie, T. (2007). The Drosophila ovary: an active stem cell community. Cell Res.,
17:15-25.
Koch, E.A., and King, R.C. (1966). The origin and early differentiation of the egg chamber of
Drosophila melanogaster. J. Morphol, 119: 283–304.
Klenov, M.S., Sokolova, O.A., Yakushev, E.Y., Stolyarenko, A.D., Mikhaleva, E.A.,
Lavrov, S.A., Gvozdev, V.A. (2011). Separation of stem cell maintenance and transposon
silencing functions of Piwi protein. Proc. Natl. Acad. Sci., 108: 18760-18765.
Lasko P. F. and Ashburner M. (1988). The product of the Drosophila gene vasa is very similar
to eukaryotic initiation factor-4A. Nature, 335: 611-617.
Li, L. and Xie, T. (2005). Stem cell niche: Structure and Function. Annual Review of Cell and
Developmental Biology, 21: 605-631.
Li M.A., Alls, J. D., Avancini, R. M., Koo, K., and Godt D. (2003). The large Maf factor
Traffic Jam controls gonad morphogenesis in Drosophila. Nature Cell Biol. 5: 994-1000.
Lin, H., and Spradling, A. (1993). Germline stem cell division and egg chamber development
in transplanted Drosophila germaria. Dev. Biol., 159: 140-152.
Lin, H., Yue, L., Spradling, A.S. (1994). The Drosophila fusome, a germline-specific
organelle, contains membrane skeletal proteins and functions in cyst formation. Development,
120: 947-56.
Lin, H. (1997). The tao of stem cells in the germline. Annual Review of Genetics, 31: 455-49.
Lin, H. and Spradling, A.S. (1997). A novel group of pumilio mutations affects the asymmetric
division of germline stem cells in the Drosophila ovary. Development, 124: 2463-2476.
Lindsley, D.L., and Zimm, G.G. (1992). The genome of Drosophila melanogaster. Academic
Press Inc., San Diego, California.
114
Liu. M., Lim, T.M., Cai, Y. (2010). The Drosophila female germline stem cell lineage acts to
spatially restrict DPP function within the niche. Sci Signal, 3: ra57.
Lopez-Onieva, L., Fernandez, A., Gonzalez, R.A. (2008). Jak/Stat signaling in niche support
cells regulates dpp transcription to control germline stem cell maintenance in the Drosophila
ovary. Development, 135: 533-540.
Margolis, J. and Spradling, A. (1995). Identification and behavior of epithelial stem cells in the
Drosophila ovary. Development, 121: 3797-3807.
McKearin, D. and Ohlstein, B. (1995). A role for the Drosophila Bag-of-marbles protein in the
differentiation of cystoblasts from germline stem cells. Development, 121: 2937-2947.
Moore, M.S., DeZazzo, J., Luk, A.Y., Tully, T., Singh, C.M., Heberlein, U. (1998). Ethanol
intoxication in Drosophila: Genetic and pharmacological evidence for regulation by the cAMP
signaling pathway. Cell, 93: 997-1007.
Ohlstein, B. and McKearin, D.M. (1997). Ectopic expression of the Drosophila Bam protein
eliminates oogenic germline stem cells. Development, 124: 3651-62.
Perkins, L.A., Holderbaum, L., Perrimon, N. (2009). Update to TRiP stock collection.
Persson, U., Izumi, H., Souchelnytskyi, S., Itoh, S., Grimsby, S., Engstrom, U., Heldin, C.
H., Funa, K. and ten Dijke, P. (1998). The L45 loop in type I receptors for TGF-beta family
members is a critical determinant in specifying Smad isoform activation. FEBS Lett. 434: 83-87.
Rhoula, A., Bremer, K.A., Baker, D., Swedlow, J.R., Jan, L.Y., Jan, Y.N. (1991). Role of
neurogenic genes in establishment of follicle cell fate and oocyte polarity during oogenesis in
Drosophila. Cell, 66: 433-449.
Rojas-Ríos, P., Guerrero, I., and González-Reyes, A. (2012). Cytoneme-mediated delivery of
hedgehog regulates the expression of bone morphogenetic proteins to maintain germline stem
cells in Drosophila. PLoS Biol., 10: e1001298.
115
Saffman, E.E., Lasko, P. (1999). Germline development in vertebrates and invertebrates. Cell
Mol. Life Sci., 55: 1141-1163.
Saito K, Inagaki S, Mituyama T, Kawamura Y, Ono Y, Sakota E, Kotani H, Asai K, Siomi
H, Siomi MC. (2009). A regulatory circuit for piwi by the large Maf gene traffic jam in
Drosophila. Nature, 461: 1296-1299.
Sahut-Barnola, I., Godt, D., Laski, F.A., Couderc, J.L. (1995). Drosophila ovary
morphogenesis: Analysis of terminal filament formation and identification of a gene required for
this process. Dev. Biol., 170: 127-135.
Sarikaya, D.P., Belay, A.A., Ahuja, A., Dorta, A., Green, D.A. (2012). The roles of cell size
and cell number in determining ovariole number in Drosophila. Dev Biol., 363: 279-89.
Sato, T., Jun, O., Yuzo, N. (2010). BMP and Hh signaling affects primordial germ cell division
in Drosophila. Zoolog Sci., 27: 804-10.
Schofield, R. (1978). The relationship between the spleen colony-forming cell and the
hamatopopietic stem cell. A hypothesis. Blood Cells, 4: 7-25.
Schüpbach, T., Wieschaus, E., Nöthiger, R. (1978). A study of the female germ line in mosaics
of Drosophila. Wilhelm Roux Arch., 184: 41-56.
Schulz, C., Wood, C., Jones, D.L., Tazuke, S., and Fuller, M.T. (2002). Signaling from germ
cells mediated by the rhomboid homologue stet organizes encapsulation by somatic support
cells. Development, 129: 4523-4534.
Schupbach, T. and Wieschaus, E. (1991). Female Sterile Mutations on the Second
Chromosome of Drosophila melanogaster. II. Mutations Blocking Oogenesis or Altering Egg
Morphology. Genetics, 129: 1119-1136.
Smulders-Srinivasan, T.K., Szakmary, A., Lin, H. (2010). A Drosophila chromatin factor
interacts with the Piwi-interacting RNA mechanism in niche cells to regulate germline stem cell
self-renewal. Genetics, 186: 573-83.
116
Song, X., Zhu, C.H., Doan, C., and Xie, T. (2002) Germline stem cells anchored by adherens
junctions in the Drosophila ovary niches. Science, 296: 1855–1857.
Song, X., Wong, M.D., Kawase, E., Xi, R., Ding, B.C., McCarthy, J.J., and Xie, T. (2004).
Bmp signals from niche cells directly repress transcription of a differentiation-promoting gene,
bag of marbles, in germline stem cells in the Drosophila ovary. Development, 131: 1353-64.
Song X, Call G.B., Kirilly D., and Xie T. (2007). Notch signaling controls germline stem cell
niche formation in the Drosophila ovary. Development, 134: 1071-1080.
Spradling, A. (1993). Developmental genetics of oogenesis. In Drosophila Development, ed. M
Bate, A Martinez-Arias, pp. 1-70.
Steinberg, M.S. (1963). Reconstruction of Tissues by Dissociated Cells, Science: Current
Problems in Research, 141: 3579.
Tanentzapf, G., Devenport, D., Godt, D., and Brown, N.H. (2007). Integrin-dependent
anchoring of a stem-cell niche. Nat. Cell Biol. 9: 1413-1418.
Thomas, G.H., Kiehart, D.P. (1994). ß-heavy-spectrin has a restricted tissue and subcellular
distribution during Drosophila embryogenesis. Development 120: 2039-2050.
Xie, T. and Spradling, A.C. (1998). decapentaplegic is essential for the maintenance and
division of germline stem cells in the Drosophila ovary. Cell, 94: 251-60.
Xie, T. and Spradling, A.C. (2000). A Niche Maintaining Germ Line Stem Cells in the
Drosophila Ovary. Science, 290: 328-330
Wakimoto, B.T., Lindsley, D.L., Herrera C. (2004). Toward a comprehensive genetic analysis
of male fertility in Drosophila melanogaster. Genetics, 167: 207-16.
Wang L, Li Z, Cai Y. (2008). The JAK/STAT pathway positively regulates DPP signaling in
the Drosophila germline stem cell niche. The Journal of Cell Biology 180: 721-728.
117
Ward E. J., Shcherbata H. R., Reynolds S. H., Fischer K. A., Hatfield S. D., and Ruohola-
Baker H. (2006). Stem cells signal to the Niche through the Notch pathway in the Drosophila
Ovary. Current Biology, 16: 2352-2358.
Wieschaus E., Szabad J. (1979). The development and function of the female germline in
Drosophila melanogaster, a cell lineage study. Dev. Biol, 68: 29-46.
Zhang N, and Xie T. (2008). Extrinsic and intrinsic control of germline stem cell regulation in
the Drosophila ovary. In: VK Rajasekhar, and MC Vemuri, eds. Regulatory networks in stem
cells 1st ed. New York: Humana, 155-163.
Zhao R, Xuan Y, Li X, Xi R. (2008). Age-related changes of germline stem cell activity, niche
signaling activity and egg production in Drosophila. Aging Cell, 7: 344-54.
Zhu, C. H., and Xie, T. (2003) Clonal expansion of ovarian germline stem cells during niche
formation in Drosophila. Development, 130: 2579-2588.
118
Appendix
1. Characterization of the tj39 allele
1.1 Molecular analysis of tj39
Our lab generated a weak tj allele, tj39 that is a P element excision allele of tj-Gal4. From my
molecular analysis, (Fig. A1) it is evident that the P element excision was imprecise producing
an internal deletion in the P element. The P element is still present in the 5’ UTR of tj. PCR
sequencing revealed that flanking genomic sequences are intact. Sequencing of the tj open
reading frame showed that the tj coding region is wild type.
1.2 Phenotypic analysis of tj39 and tj-Gal4
tj39 homozygous females are fertile and have no obvious ovary defects. However, in trans to a tj
null allele, such as tjeo2 or tjDf1, tj39 causes defects in oogenesis and semisterility (Alchits and
Godt, unpublished). tj39/tjeo2 mutant ovaries showed an abnormal germarium architecture as
previously mentioned. The overall organization of the germline cysts within the germarium was
disorganized (data not shown). tj-Gal4 (the original line used for P-element mutagenesis) when
put in trans to tjeo2 (tj-Gal4/tjeo2) also gave a similar phenotype (data not shown). Importantly,
similar to tj39/tjeo2 mutant ovarioles, the cap cells in tj-Gal4/tjeo2 ovarioles were organised into a
stalk (Data not shown). Thus, my analysis of the two mutants suggests that the presence of the P
element in the 5’UTR of the tj gene affects the function of the tj gene at the transcriptional or
translational level.
119
Figure A1. Molecular analysis of tj39. (A-D) Molecular analysis of tj39 and tj-Gal4. Genomic
DNA from w1118; tj39 , w1118; tj-Gal4 and w1118 (=control) homozygous flies was used as a
template for the PCR. PCR bands using a P-element specific primer and a genomic primer show
genomic DNA amplification (A) upstream of the P-element and (B) downstream of the P-
element. (C) Genomic primers amplify genomic DNA upstream of the P-element starting one
nucleotide away from the P element insertion site. (D) Genomic DNA was amplified with
genomic primers flanking the P-element.
120
(A)
(B)
(C)
(D)
tj39 tj-Gal4 w1118
tj39 tj-Gal4 w1118
tj39 tj-Gal4 w1118
w1118 tj39
Oligo 3
Oligo 3
Oligo 3
Oligo 2
Oligo 2
UniP
UniP
Oligo 4
121
1.3 Expression of a full-length exogenous Tj was able to rescue
the tj-Gal4/tjeo2 mutant phenotype.
To verify that the presence of the P element in the tj 5’ UTR affects the function of the tj gene,
we decided to see whether exogenous expression of Tj could rescue the characteristic stalk
phenotype observed in weak tj mutants. Since I did not find any obvious difference in the
phenotype between tj-Gal4/tjeo2 and tj39/tjeo2, I decided to use tj-Gal4/tjeo2 for my rescue
experiment. I generated the genotype tj-Gal4/tjeo2 UAS-tj and compared its phenotype to that of
the mutant genotype tj-Gal4/tjeo2. I used tj-Gal4 for my rescue experiment (see Materials and
Methods) as it allowed me to drive expression of exogenous Tj (UAS-tj) in the endogenous
pattern of Tj in a tj mutant background. If exogenous Tj expression could rescue the stalk
phenotype in tj-Gal4/tjeo2 ovaries, I would expect to see an increase in the number of germaria
carrying cap cells in a cluster and a reduction in the number of germaria carrying cap cells in a
stalk. Hence, I counted the number of cap cells that take on a stalk-like morphology using Tj as a
marker.
In the control tj-Gal4/tjeo2 ovarioles, 96% of the germaria contained 3 or more cap cells that were
organised into a stalk (n=48; Fig. A2-A). In comparison, only 11% of the tj-Gal4/tjeo2 UAS-tj
germaria contained 3 or more cap cells that were organised into a stalk (n=52). Unlike the
mutant, where I found upto 7 cap cells in the stalk, in the exogenous Tj expressing germaria, not
more than 3 cap cells were found to be part of the stalk. Thus, exogenous Tj expression
dramatically reduced the number of cap cells that were integrated into a stalk. In 61% of these
germaria, all cap cells were organised into a cluster (Fig. A2-B). This analysis indicates that the
phenotype that is caused by the presence of the P element in the tj 5’ UTR, is specific to the tj
gene because expression of exogenous Tj was able to rescue the cap cell stalk phenotype.
122
Figure A2. Transgenic Tj rescues the weak tj mutant phenotype
(A) A tj-Gal4/tjeo2 mutant ovariole showing 6 cap cells that are organised into a stalk. (A’) The
terminal filament (TF) shows a high expression of LaminC, while the additional stalk cells show
weak LaminC expression. (A’’) Tj positive cap cells can be seen sitting outside the germarium,
residing in a stalk. (B) A tj-Gal4/tjeo UAS-tj mutant ovariole showing 6 cap cells that are
organised into a cluster at the base of the terminal filament. (B’) The terminal filament shows a
high expression of LaminC, while the cap cells show weak LaminC expression. (B’’) Tj positive
cap cells can be seen in a cluster.
123
