APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2011, p. 7508–7516 Vol. 77, No. 210099-2240/11/$12.00 doi:10.1128/AEM.06034-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Toward Improvement of Erythromycin A Production in an IndustrialSaccharopolyspora erythraea Strain via Facilitation of GeneticManipulation with an Artificial attB Site for Specific Recombination�

Jiequn Wu,1,2 Qinglin Zhang,1,2 Wei Deng,2 Jiangchao Qian,1 Siliang Zhang,1 and Wen Liu2*State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China,1 and

State Key Laboratory of Bioorganic and Natural Products Chemistry, Shanghai Institute of Organic Chemistry, Chinese Academy ofSciences, 345 Lingling Rd., Shanghai 200032, China2

Received 29 June 2011/Accepted 4 August 2011

Large-scale production of erythromycin A (Er-A) relies on the organism Saccharopolyspora erythraea, inwhich lack of a typical attB site largely impedes the application of phage �C31 integrase-mediated recombi-nation into site-specific engineering. We herein report construction of an artificial attB site in an industrial S.erythraea strain, HL3168 E3, in an effort to break the bottleneck previously encountered during geneticmanipulation mainly from homologous or unpredictable nonspecific integration. Replacement of a crypticgene, nrps1-1, with a cassette containing eight attB DNA sequences did not affect the high Er-producing ability,setting the stage for precisely engineering the industrial Er-producing strain for foreign DNA introduction witha reliable conjugation frequency. Transfer of either exogenous or endogenous genes of importance to Er-Abiosynthesis, including the S-adenosylmethionine synthetase gene for positive regulation, vhb for increasing theoxygen supply, and two tailoring genes, eryK and eryG, for optimizing the biotransformation at the late stage,was achieved by taking advantage of this facility, allowing systematic improvement of Er-A production as wellas elimination of the by-products Er-B and Er-C in fermentation. The strategy developed here can generally beapplicable to other strains that lack the attB site.

Saccharopolyspora erythraea is the organism currently used inindustry for large-scale production of erythromycin A (Er-A;Fig. 1), a potent 14-membered macrolide antibiotic activeagainst pathogenic Gram-positive bacteria (20). Er-A has beenwidely used in the clinic and further developed by semisynthe-sis into a number of new drugs (e.g., azithromycin, flurithro-mycin, and telithromycin) showing an expanded antibacterialspectrum and improved pharmaceutical properties (6, 15).Over the past 50 years, the commercial importance of Er-A hasprompted extensive efforts toward improving the production ofEr-A and its purity at the fermentation stage. Historically, thisimprovement mainly depends on the traditional methods thattypically require multiple rounds of random mutagenesis of theEr-producing strain S. erythraea in association with heroiclarge-scale screening (1, 26).

In recent years, the application of genetic engineering as apromising biotechnique complements use of the traditionalmutagenesis method alone (2, 10), showing the significant in-crease in production that can be achieved by rationally enhanc-ing the oxygen or precursor (e.g., methylmalonyl coenzyme A[methylmalonyl-CoA]) supply and positive regulation of Er-Abiosynthesis (5, 23, 29, 30). As a model system for formingcomplex natural products, Er-A biosynthesis has been wellestablished and shows a set of multifunctional type I polyketidesynthases (PKSs) responsible for the formation of a macrolideintermediate, 6-deoxyerythronolide B (6-DEB) (34, 39), which

is then subjected to elaborate modifications to furnish the endproduct (Fig. 1) (12, 21, 27, 33). On the basis of systematicallymodulating the expression of the tailoring genes eryK (encod-ing a P450 protein for C-12 hydroxylation) and eryG (encodingan O-methyltransferase for C-3� O-methylation), the bio-transformation process has recently been optimized in anindustrial strain, S. erythraea HL3168 E3, leading to theimprovement of Er-A purity in fermentation by convertingthe by-products Er-C (pathway I) and Er-B (pathway II)into Er-A (Fig. 1) (7).

The current success in genetic engineering of S. erythraearelies mainly on homologous recombination-based manipula-tions, particularly for endogenous biosynthetic gene duplica-tion via a single-crossover integration (7, 29, 30). The applica-tion of this strategy raises a common concern regarding thestability of the resulting recombinant strains, which, withoutthe given selective pressure, may undergo elimination of theinsertion and reversion back to the original genotype duringDNA replication. Though the double-crossover mutation isgenetically stable, the process used to make the crossover islaborious and often requires multiple rounds of screening tointroduce the desired gene. In contrast, phage �C31 integrase-catalyzed site-specific exchange provides an efficient methodfor precise engineering of various Streptomyces hosts to gener-ate stable mutants with a clear genetic background (8, 11, 35).For integration, the bacterial attB site undergoes a conserva-tive and reciprocal recombination with the phage attP site ofthe introduced DNA to form the hybrid sites attL and attR.However, the Er-producing strain S. erythraea apparently lacksthe typical attB site on the chromosome (3, 31), largely imped-ing efforts to apply the site-specific integration approach toengineering for exogenous DNA delivery. Although in some

* Corresponding author. Mailing address: Shanghai Institute of Or-ganic Chemistry, Chinese Academy of Sciences, 345 Lingling Rd.,Shanghai 200032, China. Phone: 86-21-54925111. Fax: 86-21-64166128.E-mail: wliu@mail.sioc.ac.cn.

� Published ahead of print on 12 August 2011.

7508

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

cases �C31-based vectors, such as pSET152, can be introducedinto S. erythraea, sequence analysis revealed the diverse distri-bution of their integration locations (31), which is consistentwith the low efficiency often found, given the occurrence ofnonspecific recombination.

Guided by the accessible genome information regarding S.erythraea NRRL 23338 (an original soil isolate from whichmany strains with improved yields have been derived) (25), weintegrated an attB cassette into a selected site on the chromo-some of the industrial Er-producing strain S. erythraea HL3168E3 and herein report the findings. The engineered recombi-nant, which retains the high Er-producing ability comparableto that of the original strain, offered a useful platform signifi-cantly expediting genetic manipulation upon �C31 integrase-mediated, site-specific recombination. Introduction of eitherexogenous or endogenous genes of importance to Er-A bio-synthesis was achieved upon this facility, leading to the con-tinuously rational evolution of new Er-producing S. erythraeastrains with improved Er-A production and purity. The strat-egy for constructing a system amenable to site-specific engi-neering can generally be applicable to other strains that lackthe attB integration site.

MATERIALS AND METHODS

Bacterial strains, plasmids, and reagents. The bacterial strains and plasmidused in this study are summarized in Table 1. Biochemicals, chemicals, media,restriction enzymes, and other molecular biological reagents were purchasedfrom standard commercial sources.

DNA isolation, manipulation, and sequencing. DNA isolation and manipula-tion in Escherichia coli and Streptomyces were carried out according to standardmethods (18, 32). PCR amplifications were carried out on an authorized thermalcycler (AG 22331; Eppendorf, Hamburg, Germany) using either Taq DNApolymerase or Pfu Ultra High-Fidelity DNA polymerase (Promega). Primersynthesis and DNA sequencing were performed at Shanghai GeneCore Biotech-nology Inc.

Integration of an attB cassette. A 426-bp DNA fragment that contains eightcontinuous �C31 attB sites (31) was synthesized at Shanghai Invitrogen Biotech-nology Co. Ltd. as follows: CTTCTCAGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGA

TCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCCCTGGAG (sites of restrictionenzymes BglII and BamHI are shown in italics, and attB sites are underlined).This fragment was cloned into the BglII/BamHI site of pANT841 to givepZL2001, which was subjected to BglII/BamHI digestion and sequencing toconfirm the fidelity of the insertion.

Using the genomic DNA of S. erythraea HL3168 E3 as the template, a 1,409-bpfragment was amplified by PCR using the primers 5�-AAA GAA TTC CGGAAC CTG CTG GCC GAC CA-3� (the EcoRI site is underlined) and 5�-TTTGGA TCC GAG AAG TCG AAG GCG TAG GA-3� (the BamHI site isunderlined), and a 1,412-bp fragment was obtained by using the primers 5�-TTTGGA TCC CTG GAG CTG GAC CGC GAG CA-3� (the BamHI site is un-derlined) and 5�-AAA AAG CTT GGA TCA CCC TCC GCA CCG AG-3� (theHindIII site is underlined). The 1.4-kb EcoRI/BamHI fragment and 1.4-kbBamHI/HindIII fragment described above were recovered and coligated into theEcoRI/HindIII site of pKC1139 to give pZL2002. After digestion with BglII/BamHI, the resulting 412-bp fragment from pZL2001 was recovered and in-serted into the BamHI site of pZL2002 to generate the recombinant plasmidpZL2003, in which the 317-bp fragment of SACE_1035 (encoding NRPS1_1) wasdeleted and replaced by eight attB DNA sequences.

Introduction of pZL2003 into S. erythraea was carried out by E. coli-Strepto-myces conjugation, following the procedure described previously (22). For single-crossover DNA exchange, colonies that were apramycin resistant at 37°C wereidentified as the mutants. Further screening of colonies that were sensitive toapramycin resulted in the double-crossover mutant ZL2001, the genotypes ofwhich were confirmed by PCR amplification and sequencing. From the genomicDNA of ZL2001, an expected 3,773-bp product was amplified using the primersp1f (5�-TCG CCG CCG CAC TAC TGA A-3�) and p1r (5�-GCA CCA GGCTGT TGA CGA AGA A-3�). Sequencing of this PCR product by using theprimers p2f (5�-GAC GCT GTT CCA CTC CTA CGC C-3�) and p2r (5�-CGCCCG CCA CGT ACA TCT CA-3�) revealed that DNA replacement occurred atthe designed site of nrps1-1 in S. erythraea.

To test the effectiveness of the integrated attB cassette, pSET152 was intro-duced into ZL2001 to generate the recombinant strain ZL2002, whose genotypewas confirmed by PCR amplification using the primers p2f and p2r. From thegenomic DNA of ZL2002, an expected 6.0-kb product was obtained. Sequencingof this PCR product by using the same primer pair, p2f and p2r, revealed thatpSET152 was inserted specifically at the attB site in ZL2001.

Introduction of endogenous or/and exogenous genes into ZL2001. To enhancethe expression of the S-adenosylmethionine (SAM) synthetase gene (SAMSgene) in ZL2001, a 1,432-bp DNA fragment that contains the complete sequenceof SACE_2103 was amplified from the genomic DNA of S. erythraea HL3168 E3

FIG. 1. Biosynthetic pathway and structures of Er-A and its intermediates (including the shunt product), Er-B, Er-C, Er-D, and 6-DEB. Solidarrows, native pathway I to generate Er-A via intermediate Er-C; dashed arrows, shunt pathway II for Er-B production.

VOL. 77, 2011 ARTIFICIAL attB SITE FOR SPECIFIC RECOMBINATION 7509

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

by PCR using the primers 5�-A TTG GAT CCA CAT TGT GGG ATG CGGTGA GCC-3� (the BamHI site is underlined) and 5�-CT GTC TAG ACT GACGAC TGC CCG TAC AAC GAC-3� (the XbaI is site underlined). After diges-tion with BamHI/XbaI, the resulting 1.4-kb fragment was recovered. This frag-ment was then inserted into the BamHI/XbaI site of pZL2004, a pSET152derivative carrying a 0.5-kb fragment containing the constitutive promoterPermE*, yielding the recombinant plasmid pZL2005. In pZL2005, the expressionof SACE_2103 was under the control of PermE*.

To express vhb in ZL2001, the 463-bp DNA fragment that contains the com-plete sequence of vhb was amplified from the DNA template (provided by ShengYang at the Institute of Plant Physiology and Ecology, Shanghai Institutes ofBiological Sciences, Chinese Academy of Sciences) by PCR using the primers5�-G TAG GAT CCA GCG GTG TTA GAC CAG CAA ACC A-3� (the BamHIsite is underlined) and 5�-ATT TCT AGA TTA TTC AAC CGC TTG AGC-3�(the XbaI site is underlined) and cloned into the vector pUC19 to give pZL2006.After sequencing to confirm the fidelity, the 457-bp BamHI/XbaI fragment wasrecovered and coligated with a 285-bp PermE*-containing EcoRI/BamHI frag-ment amplified from pZL2004 by PCR using the primers 5�-ATT GAA TTCCCA GCC CGA CCC GAG CAC GC-3� (the EcoRI site is underlined) and 5�-CGCT GGA TCC TAC CAA CCG-3� (the BamHI site is underlined) into theEcoRI/XbaI site of pSET152, yielding pZL2007. To coexpress the SAMS genewith vhb, a 1,535-bp SACE_2103-containing fragment from ZL2005, which wasamplified by PCR using the primers 5�-ATT ACT AGT GCC TTC GAG GGCGAG GAC AA-3� (the SpeI site is underlined) and 5�-CT GTC TAG ACT GACGAC TGC CCG TAC AAC GAC-3� (the XbaI site is underlined), was digestedwith SpeI/XbaI and then inserted into the XbaI site of pZL2007, followed byenzymatic digestion to determine the orientation of sams. In the resulting re-combinant plasmid, pZL2008, the expression of vhb and sams was under thecontrol of PermE*.

To coexpress the tailoring genes eryK and eryG along with vhb and the SAMSgene, ZL1014, which carries the PermE*-eryK-eryG-eryK construction in

pKC1139 (7), was digested with EcoRI/SpeI. The resulting 4.6-kb internal frag-ment was recovered and cloned into pSET152 to give pZL2009. With pZL2008as the template, a 2.3-kb DNA fragment was amplified by PCR using the primers5�-ATT GAA TTC CCA GCC CGA CCC GAG CAC GC-3� (the EcoRI site isunderlined) and 5�-ATT GAA TTC CGC CAG GGT TTT CCC AGT CACGAC-3� (the EcoRI site is underlined). This fragment was digested by EcoRIand then inserted into the same site of pZL2009, followed by enzymatic digestionto determine the orientation of PermE*-vhb-SAMS gene, yielding the recombi-nant plasmid pZL2010. In pZL2010, the expression of constructs vhb-SAMSgene and eryK-eryG-eryK was under the control of PermE*.

The recombinant plasmids pZL2005, pZL2008, and pZL2010 were introducedinto S. erythraea individually by intergeneric conjugation using a method de-scribed previously (7). Colonies that were apramycin resistant were identified asthe recombinant strains, including ZL2003 (PermE*-SAMS gene), ZL2004(PermE*-vhb-SAMS gene), and ZL2005 (PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK). Two sets of primers, the pair p2f and p3r (5�-CAG GGC GAGCAA TTC CGA GA-3�) for determining the region surrounding attL and thepair p3f (5�-CAG AGC AGG ATT CCC GTT GAG-3�) and p2r for determiningthe region surrounding attR, were used for PCR amplification and sequencing toconfirm that each recombination specifically took place at the artificial attB site.

Er production in S. erythraea. S. erythraea HL3168 E3 and recombinant strainswere grown on agar plates (with appropriate antibiotics for recombinant strains)with medium consisting of 1% corn starch, 1% corn steep liquor, 0.3% NaCl,0.3% (NH4)2SO4, 0.5% CaCO3, and 2% agar, pH 7.0, at 34°C for sporulation.For fermentation, an agar piece of about 1 cm2 was inoculated into a 500-ml flaskcontaining 50 ml of the seed medium [consisting of 5% corn starch, 1.8%soybean flour, 1.3% corn steep liquor, 0.3% NaCl, 0.1% (NH4)2SO4, 0.1%NH4NO3, 0.5% soybean oil, and 0.6% CaCO3, pH 6.8 to 7.0] and incubated at34°C and 250 rpm for 2 days. To a 500-ml flask containing 50 ml of the freshfermentation medium [consisting of 4% corn starch, 3% soybean flour, 3%dextrin, 0.2% (NH4)2SO4, 1% soybean oil, and 0.6% CaCO3] was then added 5

TABLE 1. Bacterial strains and plasmids used in this study

Strain/plasmid Characteristic(s) Source or reference

E. coliDH5� Host for general cloning InvitrogenET12567(pUZ8002) Host for genomic library construction 18

S. erythraeaHL3168 E3 Industrial Er-producing strain 7ZL2001 Derivative of HL3168 E3 containing the artificial cassette with eight attB sequences This studyZL2002 Derivative of ZL2001 containing pSET152 integrated by �C31 integrase-mediated, site-specific

recombinationThis study

ZL2003 Derivative of ZL2001 containing pZL2003 integrated by �C31 integrase-mediated, site-specificrecombination with the genotype PermE*-SAMS gene

This study

ZL2004 Derivative of ZL2001 containing pZL2003 integrated by �C31 integrase-mediated, site-specificrecombination with the genotype PermE*-vhb-SAMS gene

This study

ZL2005 Derivative of ZL2001 containing pZL2003 integrated by �C31 integrase-mediated, site-specificrecombination with the genotype PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK

This study

PlasmidspANT841 E. coli subcloning vector AF438749pUC19 E. coli subcloning vector InvitrogenpKC1139 E. coli-Streptomyces shuttle vector, temperature-sensitive replication 4pSET152 E. coli-Streptomyces shuttle vector containing the �C31 attP site and the integrase gene 4pZL1014 pKC1139 derivative for the PermE*-controlled expression of eryK-eryG-eryK 7pZL2001 pANT841 derivative containing a continuous cassette with eight attB sites This studypZL2002 pKC1139 derivative for gene replacement of nrps1-1 This studypZL2003 pKC1139 derivative containing the attB cassette flanked by the homologous fragments of

nrps1-1, construct for �C31 attB cassette integration via double-crossover recombinationThis study

pZL2004 pSET152 derivative containing the constitutive promoter PermE* This studypZL2005 pSET152 derivative for the PermE*-controlled expression of SACE_2103 (SAMS gene) This studypZL2006 pUC19 derivative containing 457-bp BamHI-XbaI fragment of vhb This studypZL2007 pSET152 derivative for the PermE*-controlled expression of vhb This study

This studypZL2008 pSET152 derivative for the PermE*-controlled expression of vhb and the SAMS gene This studypZL2009 pSET152 derivative for the PermE*-controlled expression of eryK-eryG-eryK This studypZL2010 pSET152 derivative for both the PermE*-controlled expression of vhb and SAMS gene

fragment and PermE*-controlled expression of eryK-eryG-eryKThis study

7510 WU ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

ml of the seed culture, and incubation was continued at 34°C and 250 rpm for 6days. The mixture was supplemented with an additional 0.5 ml of n-propanolafter 1 day of cultivation.

Chemical analysis of Er production. Er isolation from the fermentation cul-ture was carried out according to the methods described previously (36). High-pressure liquid chromatography (HPLC) analysis of Ers was carried out on aNucleosil 100-5 CN column (250 by 4.6 mm; catalog no. 720090.46; Macherey-Nagel Inc., Germany), which was equilibrated with 69% solvent A (32 mMpotassium phosphate buffer, pH 8.0) and 31% solvent B (acetonitrile/methanolat a ratio of 75/25). An isocratic program (9) was carried out at a flow rate of 1ml/min, and UV detection was performed at 215 nm using an Agilent 1100 HPLCsystem (Agilent Technologies, Palo Alto, CA). Liquid chromatography-massspectrometry (LC-MS) analysis of Ers was carried out on a Microsorb-MV C18

column (250 by 4.6 mm; catalog no. 281505; Varian Inc.), which was equilibratedwith 62% solvent A (30 mM ammonium acetate, pH 4.8) and 38% solvent B(acetonitrile). An isocratic program (36) was carried out on an LC-MS 2010 Aliquid chromatograph-mass spectrometer (Shimadzu, Japan) at a flow rate of 1ml/min (UV detection at 215 nm), showing (M � H)� ions at m/z 734.2 (forEr-A, C37H67NO13), 718.3 (for Er-B, C37H67NO12), and 720.3 (for Er-C,C36H65NO13). For qualitative analysis of Ers, standards Er-A, Er-B, and Er-Cwere used (7). For quantitative analysis, the concentrations of Er-A, Er-B, andEr-C were individually calculated according to the standard curve of each ref-erence Er (7).

Bioassay-based titration of Er production. From the liquid culture, fermen-tation supernatant (250 �l) was added to stainless steel cylinders on agar platescontaining the test medium (consisting of 0.5% peptone, 0.3% beef extract, 0.3%K2HPO4, and 1.5% agar), which was preseeded with an overnight Bacillus pumi-lus CMCC(B)63 202 culture at a concentration of 0.8% (vol/vol). The plates wereincubated at 37°C for 16 h, and the Er production was estimated by measuringthe sizes of the inhibition zones and calculated according to the standard curvemade by using the commercially available Er as a control. Since Er-A is biolog-ically much higher in activity than the other Er components, the production ofEr-A is nearly equal to the total Er production, according to the titration doneby assaying antibacterial activity against Bacillus pumilus.

RESULTS

Insertion of an attB cassette into an NRPS gene site on thechromosome of S. erythraea HL3168 E3. The genome of S.erythraea contains 25 biosynthetic gene clusters (25), includ-ing that encoding Er biosynthesis, for forming putativepolyketides, terpenes, and nonribosomally synthesized pep-tides. Among them we chose the location of the gene nrps1-1(SACE_1305) for the attB cassette integration (Fig. 2A). Thepredicted product of nrps1-1 belongs to a family of nonribo-somal peptide synthetases (NRPSs), which incorporate intopeptide products the amino acids, instead of the short carbox-ylic acids, for PKS to synthesize polyketides (37). Of impor-tance, nrps1-1 is functionally cryptic, given the presence offrameshift mutations (25), avoiding the possibility that theproduct may have an impact on Er-A production via the com-plicated metabolic network in S. erythraea. Thus, we synthe-sized a DNA cassette in a form with eight attB sequences whichwas used for replacing the 317-bp internal fragment of nrps1-1(Fig. 2A).

The pKC1139 (an apramycin-resistant, Escherichia coli-Streptomyces shuttle vector carrying the temperature-sensitivereplication origin) derivative pZL2003, containing the attB cas-sette flanked with the homologous fragments of nrps1-1, wasintroduced into S. erythraea HL3168 E3 by conjugation. Thecolonies that were apramycin resistant at 37°C were identifiedas the integrating mutants in which a single-crossover homol-ogous recombination event took place. These mutants werecultured in liquid tryptic soy broth medium for 11 rounds in theabsence of apramycin, leading to identification of the apramy-cin-sensitive recombinant ZL2001 (Fig. 2A). PCR amplifica-

tion-coupled sequencing further confirmed the genotype ofZL2001 (Fig. 2B), showing a desired double-crossover ex-change for replacing nrps1-1 with the attB cassette. ZL2001 wascultured and then subjected to comparative analysis with S.erythraea HL3168 E3. Without the change in growth featureand morphology, the recombinant ZL2001 had an Er titer at3,059 � 783 U/ml and produced 3,050 mg/liter of Er-A alongwith 530 mg/liter of Er-B and 360 mg/liter of Er-C, showing aratio of Er-A to a sum of Er-B plus Er-C of 3.4:1 (similar tothat for S. erythraea HL3168 E3, which produced Ers with atiter at 3,152 � 521 U/ml, in which a ratio of Er-A [3,180mg/liter] to a sum of Er-B [580 mg/liter] plus Er-C [420 mg/liter] was 3.2:1) (Table 2 and Fig. 2C and D). The Er produc-tion ability of ZL2001 was slightly lowered but still comparableto that of the original strain, validating the rationality of engi-neering at this locus in S. erythraea.

Effectiveness of artificial attB cassette for site-specific re-combination. We then selected the �C31-based integrativevector pST152 to examine the effectiveness of the introducedattB site (Fig. 2A). pSET152 contains the gene encoding the�C31 integrase and its associated attP attachment site forsite-specific recombination with attB. Using the methylation-deficient donor system E. coli ET12567 (containing the non-transmissible vector pUZ8002), the transfer of pSET152 wascarried out by conjugation, showing an exconjugant frequencyat 5.0 � 10�7 when 1.0 � 108 cells of ZL2001 served as therecipients. This frequency was constantly much higher thanthat for the original strain, S. erythraea HL3168 E3, as two orthree exconjugants (assumed to be generated by nonspecificintegration of pSET152) were occasionally found in parallelunder the same condition.

To probe the integrating location, nine pSET152-based ex-conjugants of ZL2001 were randomly selected for PCR ampli-fication-coupled sequencing (Fig. 2A). They were identical ingenotype (attL linear pSET152 attR), showing that pSET152exclusively was inserted into the artificial attB cassette (Fig.2B). Together with the above-described efficient exconjugantfrequency, this finding ascertained that the attB integration sitesignificantly facilitates genetic manipulation in S. erythraeaupon �C31 integrase-mediated site-specific recombination toafford the desired recombinants. The pSET152-based integra-tion at the attB locus did not affect the phenotype, as ZL2002produced Ers in quantity and quality (with the titer at 3,102 �478 U/ml for Ers, Er-A at 3,110 mg/liter, Er-B at 480 mg/liter,and Er-C at 200 mg/liter) similar to those of ZL2001 and theoriginal strain, S. erythraea HL3168 E3 (Table 2 and Fig. 2Cand D).

The artificial cassette consists of eight contiguous attB sites;however, careful analysis of all sequenced exconjugants ofZL2002 revealed only attL and attR at the flanking regions ofthe inserted linear pSET152, where no attB sequence wasmaintained. How the additional seven attB sites were elimi-nated remains to be further determined. Considering that allattB sequences can be recognized by the �C31 integrase andsubsequently cleaved at the recombination site, we proposedthat the uninterrupted DNA exchange may occur only whenthe end sites on both sides of the attB cassette, S1-1 of attB1and Sn-2 of attBn, are recombined with the correspondingcleaved sites S2� and S1� of attP, respectively (Fig. 3). Other

VOL. 77, 2011 ARTIFICIAL attB SITE FOR SPECIFIC RECOMBINATION 7511

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

linkages could result in chromosome incompletion potentiallyfatal to cells and therefore be excluded.

Duplication of endogenous SAMS gene SACE_2103 inZL2001. SAM plays an important role in many intracellularprocesses, and recent investigations showed that various bio-synthetic machineries can be enhanced by increasing its con-centration in cells to improve the yields of the metabolites,including antibiotics (19, 24). SAM synthetase, a key enzyme inthe recycling of SAM from S-adenosylhomocysteine (a productin the SAM-dependent methylation reaction), catalyzes theconversion of the substrates L-methionine and ATP into SAM.

The chromosome of S. erythraea harbors two genes encodingSAM synthetases (25), among which SACE_2103, located inthe core region (total of 4.4 Mbp) extending on either side ofthe origin of replication (oriC), can be essential and active forSAM supply. Taking advantage of the artificial attB cassette,we therefore duplicated SACE_2103 as an endogenous sams inZL2001 for production improvement. Accordingly, pZL2005, apSET152 derivative carrying the SAMS gene under the controlof the constitutive promoter PermE* (of the Er resistance geneeryE), was constructed and then efficiently introduced intoZL2001 by conjugation, giving the recombinant strain ZL2003

FIG. 2. Integration of artificial attB cassette into the chromosome for site-specific recombination. (A) Construction of ZL2001 by replacingnrps1-1 with eight attB sequences via double-crossover mutation and of ZL2002 by taking advantage of the attB site in ZL2001 via site-specificrecombination. Primer sets are labeled along with their predicted fragment sizes. (B) Validation of the genotypes by PCR amplification. Lane 1,marker I; lane 2, 3.7-kb product from the original strain, S. erythraea HL3168 E3, using primers p1f and p1r (control); lane 3, 3.8-kb product fromZL2001 using primers p1f and p1r; lane 4, 0.6-kb product from ZL2001 using primers p2f and p2r; lane 5, 6.0-kb product from ZL2002 usingprimers p1f and p1r; and lane 6, marker II. (C) Er titers in fermentations of HL3168 E3, ZL2001, and ZL2002. (D) HPLC analysis of theproduction of Er-A, Er-B, and Er-C in HL3168 E3, ZL2001, and ZL2002. mAU, milli-absorbance units.

7512 WU ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

(Fig. 4A). Analysis of the genotype of ZL2003, attL linearpZL2003 (PermE*-SAMS gene) attR, confirmed the plasmidintegration in a site-specific manner at the locus of the attBcassette (Fig. 4B). ZL2003 was cultured and fermented andshowed increases in Er titer (11.5% improved) and in Er-Aproduction (10.8% improved), in contrast to those of ZL2001(Table 2 and Fig. 4C and D). This improvement was less thanthat in a previous report showing a 132% Er-A increase byadding the SAMS gene into S. erythraea (38) but consistentwith the finding that SAM has a positive effect on Er yield.

Introduction of Vitreoscilla hemoglobin vhb gene into ZL2001along with the SAMS gene. We next added an exogenous gene,vhb, along with the SAMS gene into ZL2001, aiming at im-proving Er production by increasing the oxygen supply. Vhb isa potent bacterial hemoglobin for oxygen uptake and transpor-tation. Heterologous overexpression of its encoding gene (vhb)in various cells (e.g., bacteria, fungi, yeasts, and plants) oftenenhances the oxygen-dependent metabolic processes, leadingto improvements in cell growth and in metabolite-producingability (13, 14, 16, 17, 28). Using a �C31-based vector as the

TABLE 2. Production of Ers and ratios of Er-A to Er-B plus Er-C in S. erythraea HL3168 E3 and its recombinant strains

S. erythraeastrain

No. of independentcultures (no. ofisolates tested)

Concn (mg/liter) Avg Er-A/Er-B Er-C ratio

Improvement of Er-Aproduction (%)

Total Er titer(U/ml)

Improvement ofEr titer (%)Er-A Er-B Er-C

HL3168 E3 58 (8) 3,180 580 420 3.2 3,152 � 521ZL2001 53 (8) 3,050 530 360 3.4 0.0 3,059 � 783 0.0ZL2002 29 (4) 3,110 480 200 4.6 3,102 � 478ZL2003 33 (5) 3,380 610 530 3.0 10.8 3,410 � 624 11.5ZL2004 37 (5) 3,640 760 530 2.8 19.3 3,701 � 537 21.0ZL2005 39 (5) 4,170 50 110 26.1 36.7 4,148 � 591 35.6

FIG. 3. Predicted mechanism for �C31-based recombination in the presence of multiple attB sites. (Left) Uninterrupted DNA exchange viaend-site ligation to eliminate additional attB sequences; (right) interrupted DNA exchange via internal-site ligation.

VOL. 77, 2011 ARTIFICIAL attB SITE FOR SPECIFIC RECOMBINATION 7513

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

carrier, a previous study showed that expression of vhb in S.erythraea positively impacted Er production (5); however, thelocus for chromosomal integration has not been precisely de-termined. By the efficient conjugation method describedabove, we consequently integrated into the chromosome ofZL2001 a pSET152 derivative (pZL2008) that carries PermE*-vhb-SAMS gene, yielding recombinant strain ZL2004 with thegenotype attL linear pZL2004 (PermE*-vhb-SAMS gene) attRonly at the designed attB locus (Fig. 4A and B). Compared withZL2001, ZL2004 produced Er with a titer at 3,701 � 537 U/ml(21.0% improved), among which the Er-A yield was 3,640mg/liter (19.3% improved), showing that an accumulated pos-

itive effect on Er production resulted from the introduction ofvhb and the SAMS gene into ZL2001 (Table 2 and Fig. 4C and4D).

Incorporation of additional tailoring genes eryK and eryGwith vhb and the SAMS gene in ZL2001. Inspired by the suc-cess with ZL2003 (PermE*-SAMS gene) and ZL2004(PermE*-vhb-SAMS gene), which produced Ers with appar-ently improved yields, we finally incorporated into ZL2001 twotailoring genes from the Er-A biosynthetic pathway—that is,the P450 hydroxylase gene eryK and the O-methyltransferasegene eryG—along with vhb and the SAMS gene, in order toeliminate the Er-A-associated by-products Er-B and Er-C at

FIG. 4. Foreign DNA introduction for improving Er-A production. (A) Genotypes of recombinant S. erythraea strains ZL2003, ZL2004, andZL2005. Primer sets are labeled along with their predicted fragment sizes. (B) PCR amplification with the genomic templates from S. erythraeastrains. The primer pair p2f and p3r was used to examine a 0.5-kb product for determining the region surrounding attL (lanes 1 to 4). The primerpair p3f and p2r was used to examine a 0.6-kb product for determining the region surrounding attR (lanes 5 to 8). Lanes 1 and 5, the original strain,S. erythraea HL3168 E3; lanes 2 and 6, ZL2003; lanes 3 and 7, ZL2004; lanes 4 and 8, ZL2005; and lane 9, marker II. (C) Er titers in fermentationsof ZL2003, ZL2004, and ZL2005. (D) HPLC analysis of the production of Er-A, Er-B, and Er-C, with standards as the control, in ZL2003, ZL2004,and ZL2005.

7514 WU ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

the fermentation stage of S. erythraea. We have previouslyshown that upon homologous recombination for introducingadditional eryK and eryG sequences, both Er-B and Er-C canbe nearly completely converted into Er-A when the copy num-ber ratio of eryK to eryG is 3:2, given the improved but opti-mized activities for EryK-catalyzed C-12 hydroxylation of theaglycone and EryG-catalyzed C-3� O-methylation of the mac-rose moiety (7). As a result, a pSET152 derivative that carriesPermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK, pZL2010,was constructed and then introduced into ZL2001 by the es-tablished conjugation method to give recombinant strainZL2005 (Fig. 4A). The exconjugants were identified, showing afrequency similar to that when pSET152 was used as the con-trol to generate ZL2002. At least 10 exconjugants were se-lected for PCR amplification-coupled sequencing, revealingthe identical genotype, attL linear pZL2010 (PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK) attR (Fig. 4B). Since theintroduced DNA harbors the endogenous genes eryK (two cop-ies) and eryG (one copy), there is the potential for homologousrecombination to an eryK- and eryG-containing, Er biosyntheticgene cluster. The only genotype for all exconjugants, as de-scribed above, supported the finding that in the presence of theartificial attB cassette, the efficiency of �C31-based site-spe-cific integration apparently preceded that of homologous re-combination in S. erythraea. Using ZL2001 as the control, wesubsequently evaluated the Er-producing ability of ZL2005,showing a significant increase in Er titer (4,148 � 591 U/ml,35.6% improved) (Fig. 4C). In particular, HPLC analysis re-vealed that the concentration of Er-B (50 mg/liter, 90.6%lower) plus Er-C (110 mg/liter, 69.4% lower) dramatically de-creased in ZL2005 and that Er-A production (4,170 mg/liter,36.7% improved) and purity (given the ratio of Er-A to a sumof Er-B plus Er-C of 26.1:1) accordingly increased in the fer-mentation broth (Table 2 and Fig. 4D). These findings indi-cated that most of the Er-B and Er-C impurities were con-verted into Er-A by optimizing the enhanced activity oftailoring enzymes EryK and EryG.

DISCUSSION

As the outcomes of countless pioneers working with thetraditional methods for over half a century, the industriallyused antibiotic-producing strains serve as the starting point toincorporate the recent genetic approaches for further improve-ment. On the other hand, many of them (including the Er-producing S. erythraea strains), which have suffered multiplerounds of random mutagenesis during the screening process,are experientially more resistant than the original isolates tothe available methods of genetic manipulation. To rapidly eval-uate the effectiveness of various optimizing strategies, it isextremely necessary to construct genetically amenable testingplatforms based on industrial strains.

By replacing the three PKS genes (i.e., eryAI-eryAII-eryAIIIwithin the Er biosynthetic gene cluster) for 6-DEB formationwith an attB sequence in an industrial Er-producing S. eryth-raea strain, Rodriguez and coworkers have previously ex-ploited its overproduction properties via efficient conjugationfor delivering large PKS expression vectors by �C31-basedintegration (31). This validated the feasibility of applying �C31

integrase-catalyzed site-specific recombination into S. erythraeaengineering; however, genetic manipulation had been confinedto the biosynthetic gene cluster itself before genome sequenc-ing. In the past 10 years, the explosion of DNA sequencingtechnologies has greatly benefited investigations of antibiotic-producing strains, and the Er producer S. erythraea is no ex-ception (25). Apparently, the availability of the genome infor-mation for S. erythraea extends the range for geneticengineering from the gene cluster to the whole genome. Ac-cording to this, we constructed an artificial attB cassette at thelocus of a cryptic gene, nrps1-1, on the chromosome of anindustrial Er-producing strain, S. erythraea HL3168 E3, settingthe stage for �C31 integrase-mediated precise engineering forintroduction of foreign DNA at this locus. The advantage ofthis method is that it provides a specific site for engineering tosystematically evaluate various strategies for improving Er pro-duction as well as retaining the intrinsic high-Er-producingability of the original strain.

Our initial goals of inserting an eight-attB-sequence cassetteinclude (i) the insertion of a cassette of a suitable size of 426 bpthat facilitates general cloning and (ii) the offering of multipleattB sequences for tandem insertions of the constructs derivedfrom the vectors that contain the �C31 integrase gene and attPsite but that differ in resistance (S. erythraea is sensitive toapramycin and thiostrepton) marker genes (aiming at rapidlytesting the combined strategies). Though the latter applicationwas excluded, given that an additional seven attB sequenceswere accordingly eliminated when one integration took place,the engineered Er-producing strain ZL2001 is amenable torational genetic engineering via �C31-based site-specific re-combination with a reliable conjugation frequency (about5.0 � 10�7 when 1.0 � 108 cells of ZL2001 served as therecipients in all tests in this study, even though the insertedDNA fragments varied in length from 5.5 kb to 12.4 kb) thatwas constantly much higher than that of the original strain. Theprevious study showed that more than 30-kb PKS genes can betransferred in a similar way (31); therefore, the potential forintegration of a large DNA fragment (e.g., gene cluster) inZL2001 exists, if needed in future evaluation efforts.

In this study, the utility of the engineered strain ZL2001broke the technical bottlenecks previously encountered duringmanipulation mainly from homologous or unpredictable non-specific recombination. Taking advantage of the useful plat-form, introductions of either exogenous or endogenous genesthat are of importance to Er biosynthesis, including the SAMSgene for enhancing positive regulation, vhb for increasing theoxygen supply, and tailoring genes eryK and eryG for optimiz-ing the biotransformation of the by-products Er-B and Er-Cinto Er-A, were achieved via the designed artificial attB cas-sette. The recombinant strains generated in this fashionshowed an Er-producing ability improved in quantity and qual-ity, making it practical to continuously evolve the Er biosyn-thetic system for improving Er-A production and purity in S.erythraea. In general, the strategy developed here can be ap-plicable to other industrial or academic microorganisms toestablish an efficient site-specific method of foreign DNA in-troduction that is challenging for strains lacking the attB site onthe chromosome.

VOL. 77, 2011 ARTIFICIAL attB SITE FOR SPECIFIC RECOMBINATION 7515

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

ACKNOWLEDGMENTS

This work was supported in part by grants from the National NaturalScience Foundation (20832009 and 20921091), the National Basic Re-search Program (973 program, 2012CB721100 and 2010CB833200),the Chinese Academy of Sciences (KJCX2-YW-201), and the Scienceand Technology Commission of Shanghai Municipality (09QH1402700)of China.

REFERENCES

1. Adrio, J. L., and A. L. Demain. 2006. Genetic improvement of processesyielding microbial products. FEMS Microbiol. Rev. 30:187–214.

2. Baltz, R. H. 2006. Molecular engineering approaches to peptide, polyketideand other antibiotics. Nat. Biotechnol. 24:1533–1540.

3. Baltz, R. H. 2010. Streptomyces and Saccharopolyspora hosts for heterologousexpression of secondary metabolite gene clusters. J. Ind. Microbiol. Biotech-nol. 37:759–772.

4. Bierman, M., et al. 1992. Plasmid cloning vectors for the conjugal transfer ofDNA from Escherichia coli to Streptomyces spp. Gene 116:43–49.

5. Brunker, P., W. Minas, P. T. Kallio, and J. E. Bailey. 1998. Genetic engi-neering of an industrial strain of Saccharopolyspora erythraea for stableexpression of the Vitreoscilla haemoglobin gene (vhb). Microbiology 144(Pt9):2441–2448.

6. Butler, M. S. 2008. Natural products to drugs: natural product-derived com-pounds in clinical trials. Nat. Prod. Rep. 25:475–516.

7. Chen, Y., et al. 2008. Genetic modulation of the overexpression of tailoringgenes eryK and eryG leading to the improvement of erythromycin A purityand production in Saccharopolyspora erythraea fermentation. Appl. Environ.Microbiol. 74:1820–1828.

8. Combes, P., R. Till, S. Bee, and M. C. Smith. 2002. The Streptomyces genomecontains multiple pseudo-attB sites for the (phi)C31-encoded site-specificrecombination system. J. Bacteriol. 184:5746–5752.

9. Deubel, A., and U. Holzgrabe. 2007. Development of an enhanced separationof erythromycin and its related substances by liquid chromatography.J. Pharm. Biomed. Anal. 43:493–498.

10. Fischbach, M. A., and C. T. Walsh. 2006. Biochemistry directing biosynthe-sis. Science 314:603–605.

11. Gupta, M., R. Till, and M. C. Smith. 2007. Sequences in attB that affect theability of phiC31 integrase to synapse and to activate DNA cleavage. NucleicAcids Res. 35:3407–3419.

12. Haydock, S. F., et al. 1991. Cloning and sequence analysis of genes involvedin erythromycin biosynthesis in Saccharopolyspora erythraea: sequence simi-larities between EryG and a family of S-adenosylmethionine-dependentmethyltransferases. Mol. Gen. Genet. 230:120–128.

13. Holmberg, N., G. Lilius, J. E. Bailey, and L. Bulow. 1997. Transgenic tobaccoexpressing Vitreoscilla hemoglobin exhibits enhanced growth and alteredmetabolite production. Nat. Biotechnol. 15:244–247.

14. Kallio, P. T., and J. E. Bailey. 1996. Intracellular expression of Vitreoscillahemoglobin (VHb) enhances total protein secretion and improves the pro-duction of alpha-amylase and neutral protease in Bacillus subtilis. Biotech-nol. Prog. 12:31–39.

15. Katz, L., and G. W. Ashley. 2005. Translation and protein synthesis: macro-lides. Chem. Rev. 105:499–528.

16. Khosla, C., and J. E. Bailey. 1988. Heterologous expression of a bacterialhaemoglobin improves the growth properties of recombinant Escherichiacoli. Nature 331:633–635.

17. Khosla, C., and J. E. Bailey. 1988. The Vitreoscilla hemoglobin gene: mo-lecular cloning, nucleotide sequence and genetic expression in Escherichiacoli. Mol. Gen. Genet. 214:158–161.

18. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Howood. 2000.Practical Streptomyces genetics. John Innes Foundation, Norwich, UnitedKingdom.

19. Kim, D. J., et al. 2003. Accumulation of S-adenosyl-L-methionine enhances

production of actinorhodin but inhibits sporulation in Streptomyces lividansTK23. J. Bacteriol. 185:592–600.

20. Labeda, D. P. 1987. Transfer of the type strain of Streptomyces erythraeus(Waksman 1923) Waksman and Henrici 1948 to the genus Saccharopolys-pora Lacey and Goodfellow 1975 as Saccharopolyspora erythraea sp. nov., anddesignation of a neotype strain for Streptomyces erythraeus. Int. J. Syst.Bacteriol. 37:19–22.

21. Lambalot, R. H., D. E. Cane, J. J. Aparicio, and L. Katz. 1995. Overproduc-tion and characterization of the erythromycin C-12 hydroxylase, EryK. Bio-chemistry 34:1858–1866.

22. Liu, W., and B. Shen. 2000. Genes for production of the enediyne antitumorantibiotic C-1027 in Streptomyces globisporus are clustered with the cagAgene that encodes the C-1027 apoprotein. Antimicrob. Agents Chemother.44:382–392.

23. Minas, W., P. Brunker, P. T. Kallio, and J. E. Bailey. 1998. Improvederythromycin production in a genetically engineered industrial strain ofSaccharopolyspora erythraea. Biotechnol. Prog. 14:561–566.

24. Okamoto, S., A. Lezhava, T. Hosaka, Y. Okamoto-Hosoya, and K. Ochi.2003. Enhanced expression of S-adenosylmethionine synthetase causes over-production of actinorhodin in Streptomyces coelicolor A3(2). J. Bacteriol.185:601–609.

25. Oliynyk, M., et al. 2007. Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338. Nat. Bio-technol. 25:447–453.

26. Parekh, S., V. A. Vinci, and R. J. Strobel. 2000. Improvement of microbialstrains and fermentation processes. Appl. Microbiol. Biotechnol. 54:287–301.

27. Paulus, T. J., et al. 1990. Mutation and cloning of eryG, the structural genefor erythromycin O-methyltransferase from Saccharopolyspora erythraea, andexpression of eryG in Escherichia coli. J. Bacteriol. 172:2541–2546.

28. Pendse, G. J., and J. E. Bailey. 1994. Effect of Vitreoscilla hemoglobinexpression on growth and specific tissue plasminogen activator productivityin recombinant Chinese hamster ovary cells. Biotechnol. Bioeng. 44:1367–1370.

29. Reeves, A. R., et al. 2006. Effects of methylmalonyl-CoA mutase gene knock-outs on erythromycin production in carbohydrate-based and oil-based fer-mentations of Saccharopolyspora erythraea. J. Ind. Microbiol. Biotechnol.33:600–609.

30. Reeves, A. R., et al. 2007. Engineering of the methylmalonyl-CoA metabolitenode of Saccharopolyspora erythraea for increased erythromycin production.Metab. Eng. 9:293–303.

31. Rodriguez, E., et al. 2003. Rapid engineering of polyketide overproductionby gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotech-nol. 30:480–488.

32. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

33. Stassi, D., S. Donadio, M. J. Staver, and L. Katz. 1993. Identification of aSaccharopolyspora erythraea gene required for the final hydroxylation step inerythromycin biosynthesis. J. Bacteriol. 175:182–189.

34. Staunton, J., and K. J. Weissman. 2001. Polyketide biosynthesis: a millen-nium review. Nat. Prod. Rep. 18:380–416.

35. Thorpe, H. M., and M. C. Smith. 1998. In vitro site-specific integration ofbacteriophage DNA catalyzed by a recombinase of the resolvase/invertasefamily. Proc. Natl. Acad. Sci. U. S. A. 95:5505–5510.

36. Tsuji, K., and J. F. Goetz. 1978. HPLC as a rapid means of monitoringerythromycin and tetracycline fermentation processes. J. Antibiot. (Tokyo)31:302–308.

37. Walsh, C. T., and M. A. Fischbach. 2010. Natural products version 2.0:connecting genes to molecules. J. Am. Chem. Soc. 132:2469–2493.

38. Wang, Y., J. Chu, Y. Zhuang, L. Zhang, and S. Zhang. 2007. Improvedproduction of erythromycin A by expression of a heterologous gene encodingS-adenosylmethionine synthetase. Appl. Microbiol. Biotechnol. 75:837–842.

39. Weissman, K. J., and P. F. Leadlay. 2005. Combinatorial biosynthesis ofreduced polyketides. Nat. Rev. Microbiol. 3:925–936.

7516 WU ET AL. APPL. ENVIRON. MICROBIOL.

on Novem

ber 23, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from