Today House Keeping CARC Primer order Final report (manuscript style) Start RT(-PCR), PCR next class...
-
Upload
damian-snow -
Category
Documents
-
view
221 -
download
0
description
Transcript of Today House Keeping CARC Primer order Final report (manuscript style) Start RT(-PCR), PCR next class...
Today House Keeping CARC Primer order Final report (manuscript style) Start RT(-PCR), PCR next class Precipitate fungal sequencing reactions RNA Quality Control 15min.ppt Phylogeny, COI Stay on schedule, breaks are for Background Fungal amplicons Exosap, BigDye Physella COI phylogeny PARASITES AND SNAIL BIOLOGY identity, possibilities phylogenetics intentions transcriptomics PCR rDNA/mito Bioanalyzer DNA-free, direct sequencing gel electrophoresis nanodrop spec Sequence ID (BLAST) editing Phylogenetics electrophoresis RT-PCR gel CTAB Trizol TA cloning, B/W screening M13 sequencing Primer design, walking Qiagen plasmid extraction Restriction digests DNA RNA GenBank submission + Sevilleta snails RNA DNA Central Dogma of Molecular Biology A Reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. It is mainly associated with retroviruses. RT inhibitors are widely used as antiretroviral drugs. RNase H specifically degrades only the RNA in RNA:DNA hybrids, it is commonly used in molecular biology to destroy the RNA template after first-strand complementary DNA (cDNA) synthesis by reverse transcription,molecular biology complementary DNAreverse transcription Protocol on-line https://lifescience.roche.com/shop/PrintView?langId=-1&storeId=15016&articleId=68045 MM-denat MM-RT Start RT AMOUNTS OF RNA? (also from bioanalyzer) Calculate your volume for ~1000 ng RNA, if 9 l, use 9 l. Group[ng/ml]add x l sample to YOUR MM-denat DEPC water for 9 l total (0, work with group 6) (0, work with group 9) DN2413 Diethyl pyrocarbonate (DEPC) is an efficient, nonspecific inhibitor of RNases. It is typically used to treat water and solutions before working with easily degraded RNA. https://www.thermofisher.com/us/en/home/references/ambion-tech-support/nuclease- enzymes/tech-notes/rnase-and-depc-treatment.html Start RT AMOUNTS OF RNA? (also from bioanalyzer) Calculate your volume for ~1000 ng RNA, if 9 l, use 9 l. Group[ng/ml]add x l sample to YOUR MM-denat l DEPC water l DEPC water l DEPC water 5(0, work with group 6)2 + 7 l DEPC water l DEPC water l DEPC water l DEPC water (0, work with group 9)9 (DN24139) Cleanup extension products fungal amplicon sequencing TYPICAL OUTPUT FORMATRatio = RN number For quality! Hidden break van Keulen et al. Organization of the ribosomal RNA genes in Schistosoma mansoni. Mol Biochem Parasitol May;15(2): The organization of the rRNA genes of Schistosoma mansoni has been determined by Southern blot analysis of genomic DNA digested with restriction enzymes, by isolation of the entire repeat on a single fragment of about 11 kilobase pairs from a genomic DNA library constructed in bacteriophage lambda and by characterization of three cloned EcoRI fragments which span the entire repeat. The segments encoding both the large and small rRNA subunits have been identified using specific cloned yeast rDNA fragments as probes and EcoRI, HindIII and BamHI restriction enzyme maps of the rRNA genes were constructed. The ends of the RNAs have been precisely mapped on the genomic DNA by S1 protection experiments. Our data indicate that the rRNA genes are present as a tight cluster. The total length of the rDNA repeat is about 10 kilobase pairs. There appears to be no variation in the size of transcribed and non-transcribed spacer DNA. At the RNA level we have characterized and mapped a small gap in the 28S RNA molecule. The interruption causes the RNA to dissociate into two equal sized fragments when analyzed under denaturing conditions. PMID: [PubMed - indexed for MEDLINE] Ishikawa. Evolution of ribosomal RNA. Comp Biochem Physiol B. 1977;58(1): The G + C content of ribosomal RNA of animals seems correlated with the length of periods required for maturation of those organisms. 2. In Protostomes of the animal kingdom, the size of the 28S rRNA molecule does not seem to correlate with the evolutionary stage of the organism. 3. Aphids and water-fleas as well as some protozoa have the 18S rRNA with mol. wt of 0.9 x 10(6) against an overwhelming pressure of evolution to conserve the rRNA molecule of 0.7 x 10(6) daltons. 4. All the Deuterostomes examined were distinguished from Protostomes by having the 28S rRNA's void of the hidden break at the central point. 5. Aphids and nematodes are exceptional Protostomes in that they have the 28S rRNA's without the hidden break. This was discussed in the light of the evolutionary stage of these organisms. 6. Molecular properties of chloroplast rRNA seem to evidence for endosymbiotic origin of this organelle. Mitochondrial rRNA differs considerably from prokaryotic rRNA with respect to molecular size and base composition. PMID: [PubMed - indexed for MEDLINE] Non-covalent bonds Experimental treatment (denaturation) Gel electrophoresis, all fragments resolve as one HIDDEN BREAK PROTOSTOME rRNA 18S 28S DNA RNA Deuterostomes Most protostomes 15min.ppt Bioinformatics Phylogenetic analysis COI sequence >PS1COI GGTCANCNNAATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGATTGGTCGGTA CTGGTTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTTGTACTGTTGGATGAACATTTTTATAA TGTAATTGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGGTTT GGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGATTTCCTCGAATAAATAATATAAGTT TTTGACTTTTACCGCCTTCATTTATCTTATTATTATGTAGGTCTATAGTTGAGGGTGGAGTTGGAACTGG GTGAACTGTTTACCCCCCTCTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTTGCTATTTTC TCATTACACTTAGCTGGGTTATCATCTATTCTAGGTGCTATTAATTTTATCACTACCATTTTTAATATAC GTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCGGTGTTAATTACTGCATTTTTATT ATTATTGTCATTGCCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGATCGAAATTTTAATACTAGG TTCTTTGATCCAAGAGGAGGGGGAGACCCTATTCTATATCAGCATCTATATCTGANNATTGGTCANCANN NANNT >PS2COI ANTTGGTCNNNNNATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGCTTGGTC GGTACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTGGTACTATTGGATGAACATTTT TATAATGTAATCGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGA GGCTTTGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGCTTTCCTCGAATAAATAAT ATAAGATTTTGACTATTACCCCCTTCATTTATCTTATTATTATGCAGGTCTATAGTTGAGGGTGGGGTT GGAACTGGGTGAACTGTTTATCCCCCACTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTG GCTATTTTCTCATTACACTTAGCTGGGTTATCATCTATTTTAGGTGCTATTAATTTTATTACTACAATT TTTAATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCAGTGTTAATTACT GCATTTTTACTATTATTGTCATTGCCTGTTTTAGCGGGGGCTATNNCCNTACTATTAACTGATCGAAAT TTTAATACTAGGTTCTTTGATCCAAGAGGAGGGGGAGATC >PS4COI GGTCAACCAATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGATTGGTCGGTA CTGGTTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTTGTACTGTTGGATGAACATTTTTATA ATGTAATTGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGGT TTGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGATTTCCTCGAATAAATAATATAA GTTTTTGACTTTTACCGCCTTCATTTATCTTATTATTATGTAGGTCTATAGTTGAGGGTGGAGTTGGAA CTGGGTGAACTGTTTACCCCCCTCTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTTGCTA TTTTCTCATTACACTTAGCTGGGTTATCATCTATTCTAGGTGCTATTAATTTTATCACTACCATTTTTA ATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCGGTGTTAATTACTGCAT TTTTATTATTATTGTCATTGCCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGATCGAAATTTTA ATACTAGGTTCTTTGATCCAAGAGGAGGGGGAGACCCTATTCTATATCAGCATCTATATCTGATATTAT TGGTCACACCANNNNTTTAA >SS1COI TTGGTCAACCAATCATAAAGATATNGGAACATTATATTTAATTTTTGGGATCTGGTGTGGCTTGGTCGGT ACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTGGTACTATTGGATGAACATTTTTATA ATGTAATCGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGCTT TGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGCTTTCCTCGAATAAATAATATAAGA TTTTGACTATTACCCCCTTCATTTATCTTATTATTATGCAGGTCTATAGTTGAGGGTGGGGTTGGAACTG GGTGAACTGTTTATCCCCCACTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTGGCTATTTT CTCATTACACTTAGCTGGGTTATCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTTTTAATATA CGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCAGTGTTAATTACTGCATTTTTAT TATTATTGTCATTGCCTGTTTTAGCGGGGGCTANNNNCNTNCTATTAACTGATCGAAATTTTAATACTAG GTTCTTTGATCC >SS2COI NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNCGGTACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAG GANNNNNNNNNNNANTATTGGATGAACATTTTTATAATGTAATCGTTACAGCACATGCTTTTGTAATGAT TTTTTTTATAGTTATACCTATAATAATTGGAGGCTTTGGGAATTGAATAGTACCTATATTAATTGGTGCT CCCGATATAAGCTTTCCTCGAATAAATAATATAAGATTTTGACTATTACCCCCTTCATTTATCTTATTAT TATGCAGGTCTATAGTTGAGGGTGGGGTTGGAACTGGGTGAACTGTTTATCCCCCACTATCAGGACCTGT AGCTCACTCTGGTTCATCAGTAGATCTGGCTATTTTCTCATTACACTTAGCTGGGTTATCATCTATTTTA GGTGCTATTAATTTTATTACTACAATTTTTAATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCT TATTTGTTTGATCAGTGTTAATTACNGNANNNNTNTTATTATTGTCATTGCCTGTTTTNNNNNNNNNNNN NNNNNNNNNTTAACTGATCGAAATTTTANT Physid snails (Radix sp, Lymnaeid?) What species acuta, anatina, virgata ? Includes: Physids anatomical + sequence ID Outgroups: Planorbids and Lymnaeids Add sequences to the dataset: Physella acuta A and B COI sequence (from complete genomes), include the Radix swinhoei COI sequence (complete genome NC_ ), Radix sp. COI MOTU5 mitochondrion, complete genome (KP ) Popsetplus.txt Align, Trim to remove primers, close relatives and achieve equal sequence length New dataset for phylogenetic analysis snailCOI.txt Root tree with outgroup Stagnicola or Planorbella What species group do our physids belong to? The mitochondrial gene order of P. acuta compared to other sequenced Pulmonate. Phylogeny arranged on molecular designed tree using 18S, 16S and CO1 genes as done by Dayrat, et. al., Protein-coding and rRNA genes were color coded to emphasize gene patterns and rearrangements. Negative stand genes are underlined and remain consistent throughout Pulmonates. Dark lines indicate conserved gene regions found in P. acuta compared to B. glabrata, as considered to have a conserved mitochondrial gene arrangement. sinistral dextral LymnaeidPhysidPlanorbid For shells with spire, check aperture right (dextral) or left (sinistral) Planorbids have a sinistral shell, coiled in one plane, sunken spire New Mexico has several species each of Lymnaeids and Physids Shell length: Lymnaeids 2.5 cm, Physids 1 cm Planorbids include Gyraulus spp. (adults < 5 mm shell diameter) and Planorbella (Helisoma) duryi, P. (H) trivolvis (large shells) Freshwater pulmonate snail family-level identification based on shell morphology Gyraulus sp. Planorbella sp. For additional info see: