E-COOL-I

Tina Khoury Jeremy Gerbig

Derek BlanchardKerwin Dunham

Original Goals

Achieve◦ E. coli to fluoresce red at low temp (37°C) in

presence of Cl or Cl (ts). Find optimum temp where color change will be found.

~ 30-37°C Find optimum concentration of Cl.

◦ Gene originally from coral.

Backup Plan◦ Use high temp parts to make E. coli fluoresce at

high temp instead at low using a different gene.◦ Expressing high (green) and low (red) temp. genes

in one sequence.

Isolate plasmid Digest with appropriate enzymes. Confirm base pair length

Ligation of confirmed digested Biobrick parts Ligate final Biobrick arrangement Confirm arrangement and biobrick standards Grow under different environmental conditions

Project’s Original Protocol

Protocol

Isolate biobricks out of well Plates. BBa_I12007 – Promoter Created oligo - RBS BBa_E1010 - Gene BBa_B0015 - Double Terminator

Part 1◦ BBa_I12007

82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3

gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt

How It Was Suppose To Be Done?

Part 3 Gene ◦ Spring 2008 Distribution Source Plate 1002 1D pSB1A2◦ 3 BBa_E1010

681Bp Gene: highly engineered mutant of red fluorescent protein from

Discosoma striata (coral) 2010 Kit Plate 1 Well 18F, pSB2K3

atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

How It Was Suppose To Be Done?

Part 4 & 5 Super Part BBa_B0015◦ BBa_B0010 doubleT

129 Bp Stop, T1 from E. coli rrn B (Transcriptional Terminator) 2010 Kit Plate 1 Well 13D, pSB1A2

◦ BBa_B0012 Stop, TE from coliophage T7 (Transcriptional Terminator) Source Plate 1000 Well 1B, pSB1A2

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

How It Was Suppose To Be Done?

Part 2 RBS to small

Design & Construction of Oligo’s

Transform the bacteria.

Grow the transformed bacteria.

Isolate & check plasmids.◦ Gel Electrophoresis

Protocol Cont.

Ligation of Parts The complete complex Biobricks sequence!

◦ Combine 3 parts BBa_I12007 – Promoter Created Oligo- RBS BBa_E1010 - Gene BBa_B0015 - Double Terminator

Protocol cont… Combining biobrick parts by digestion & ligation.

BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator

S X & P X & P

Combining biobrick parts by digestion & ligation.

Protocol cont…

BBa_I12007 –Promoter + Created oligo- RBS BBa_B0015 - Double Terminator

S E & S X & P

BBa_E1010 Gene

Mini-Prep

H2O 5ul

10x FastBuffer

1.5 ul

Enzyme 1 .75ul

Enzyme 2 .75ul

Digestion & Gel Electrophoresis

MasterMix

Ligations

10x ligation Buffer 2ul T4DNA ligase 2ul Gene 1ul Double Terminator 5ul H2O 5ul

Incubate room temp. 1hour

Store at 4℃

BioBrick Part Promoter BBa_I12007 Double terminator BBa_B0015 Ribosome BBa_B0032

Resistance KAN A/K we used KAN AMP

Test tube

A 1ul Promoter part BBa_I12007 1ul DT part BBa_B0015 1ul Ribosome part BBa_B0032

B 5ul Promoter part BBa_I12007 5ul DT part BBa_B0015 5ul Ribosome part BBa_B0032

C 1ul pblue script 1ul pblue script 1ul pblue script

D 1ul H2O 1ul H2O

Bacterial Transformation Results

Test tubes Promoter RBS Double Terminator

A 75 colonies 52 colonies 43 colonies

B 212 colonies 292 colonies 216 colonies

C 1200 colonies

D 0 colonies

• Growth After Plating

Latter 13,12,11,10,9,8,7,6,5, 4, 3,2 1,latter

Isolating of Parts 1st Digestion & Gel

• Our digestion was successful a band of 681 was our target for the Gene

100bp250bp500bp750bp1000bp

100bp250bp500bp750bp1000bp

Gene BBa_E1010 Isolation

Expected Promoter –82bp Double terminator-

129bp

RBS was not ran due to size of only 13bp

Isolating of Parts 10/12

Double Terminator--Promoter

Ladder 1,2, 3,4 5,6,7

100bp250bp500bp750bp1000bp

Double Terminator Promoter

(BBa_B0015) (BBa_I12007)

Expected Gene 681 Bp

1st cut Spe1 Xbal

Redigested◦ Spe1 EcoR1

Redigestion of Gene 10/19

100bp250bp500bp750bp1000bp

1,2,3Gene

Ligation problem possibly low functioning EcoR1

Promoter & RBS – not sure if ligated correctly due to RBS small size 13bp. Difference can’t be seen on gel

Gene & DT – Believe only DT is showing up 129bp

Ligation Results 11/11

1000bp750bp500bp250bp100bp

15,14,13,12,11,10,9,8,7,6 5,4,3,2,1 ladder

(Promoter & RBS) (Gene & DT)

We Concluded that EcoR1 was not fully functional.

So our parts were not cut open properly to ligate the Gene to the double terminator.

Results 11/16

1000bp750bp500bp250bp100bp

9,8,7,6,5,4,3, 2 1 ladder

Attempted Gene & Double Terminator Ligation

No proper digestions around 810bp.

No Ligation?

Error Analysis: Still low

functioning enzymes & Resuspension fluid had been left out of 4C for undisclosed amount of time.

Final Disappointment New Religation of stored Gene & Double Terminator

100bp250bp500bp750bp1000bp

15,14,13,12,11,10,9,8,7,6,5,4,3,2,1 ladder

Attempted Gene & Double Terminator Ligation

We were successful in isolating and confirming 3 of our Biobrick parts. Gene Promoter Double terminator.

Given more time, fresh enzymes and other properly working materials ligating of our biobrick parts would have been successful.

Conclusion

Openwetware.org Partsregistry.org http://filebox.vt.edu/.../biol_4684/Methods/genes.html http://www.fasebj.org/content/vol20/issue14/images/large/

z386120661480003.jpeg http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?

book=mga&part=A1549 http://www.stat.berkeley.edu/users/terry/Classes/

s260.1998/Week8b/week8b/node3.html http://www.biotechlearn.org.nz/var/biotechlearn/storage/

images/themes/from_genes_to_genomes/images/bacterial_transformation/4063-1-eng-AU/bacterial_transformation_large.jpg

References