Proc. Nati. Acad. Sci. USAVol. 88, pp. 229-233, January 1991Biochemistry

Three adjacent binding sites for cAMP receptor protein areinvolved in the activation of the divergent malEp-malKp promoters

(maltose regulon/tranription regulation)

DOMINIQUE VIDAL-INGIGLIARDI AND OLIVIER RAIBAUDUnite de Gdn6tique Moleculaire, URA 1149 du Centre National de la Recherche Scientifique, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex15, France

Communicated by Howard Nash, October 1, 1990 (receivedfor review July 26, 1990)

ABSTRACT The divergent maLEFG and maK-lkmB-maIM operons in Escherichia coil are controfled by partiallyoverlapping promoters, whose activity depends on the presenceof two transcriptional activators, MalT and the cAMP receptorprotein (CRP). The 271-base-pair region separating the tran-scription start points of the promoters malEp and maLKpcomprises a compact array of binding sites for MalT and CRP.We report the characterization of the in vitro interactions ofCRP with its four adjacent binding sites and the analysis oftheir function in vivo. By using the DNase I footprintingtechnique, we showed that CRP binds with high affinity to thethree malEp-proximal sites and with a low affinity to the fourthsite. CRP binding to these sites is not cooperative, even thoughthey are adjacent and located on the same face of the DNAdouble helix. Each of these sites was destroyed by localizedmutagenesis and the residual activity of the promoters wasmeasured in vivo. Mutations in any of the three hig-affinitybinding sites reduced both nalEp and malKp activity. Theparticipation of several adjacent bound CRP molecules in theactivation of a promoter is an unprecedented observation andmight involve molecularmechanms quite different from thoseused in the other CRP-controiled promoters.

In Escherichia coli, catabolic repression is at least in partmediated by the cAMP receptor protein (CRP) (1). Themechanism of transcriptional activation by CRP seems to berelatively simple in a few systems, exemplified by the lacoperon, but it is quite complex in other catabolic systemssuch as the ara, deo, and mal regulons (2-5). The expressionof the mal regulon, which encodes a set of proteins involvedin the assimilation of maltose, maltodextrins, and starch bythe bacteria (6), has long been known to be regulated by CRP(7). The discovery ofa direct effect ofCRP on the expressionof malT, the gene coding for the specific positive regulator ofthe system, led to the hypothesis that, in contrast to the lacoperon, the target of CRP in the mal regulon might be themalT promoter rather than the promoters of the operonscontaining the structural genes. However, studies in a strainthat expressed MalT even in the absence of CRP (owing to amutation in the malTp promoter) later demonstrated thatCRP also acted directly at the promoters of the malEFG andmalK-4amB-malM operons (5).The malEFG and malK-lamB-malM operons, which en-

code the proteins required to transport maltodextrins, aretranscribed from two divergent promoters, malEp and malKp(8). These promoters, whose activity depends on the twoactivator proteins MalT and CRP, have their transcriptionstartpoints located 271 base pairs (bp) apart. We recentlyshowed by DNase I footprinting and deletion analysis thatthis intergenic region is unusually complex, comprising asmany as five binding sites for MalT and four binding sites for

CRP (Fig. 1). Most of the MalT binding sites are involved inthe activation of both promoters (ref. 9 and unpublishedresults). The role of the four CRP binding sites has hithertobeen only poorly defined (8, 9). In this article, we report aquantitative analysis of the interactions of CRP with thesesites and a characterization of the functional role of each ofthem.

MATERIALS AND METHODSOligonucleotide-Directed Mutagenesis of the CRP Binding

Sites. The 478-bp EcoRI-EcoRI fragment of plasmid pOM18,which contains the malEp and malKp promoters (9), wascloned into the EcoRI site of bacteriophage M13mpll. Sinceour goal was to obtain all possible combinations of themutated CRP binding sites, the M13 malEp-malKp single-stranded DNA was hybridized with a mixture containing thefour 23-nucleotide mutagenic oligonucleotides correspondingto the malEpKpJ-malEpKp4 mutations (see Fig. 3) togetherwith the universal -40 sequencing primer and treated by theprotocol of Zoller and Smith (10). The plaques were probedsuccessively with the four radiolabeled oligonucleotides,with a washing-out step at 70'C between each hybridization.The nucleotide sequence of the malEp-malKp fragment ofselected clones was then determined by using the dideoxymethod (11). Only a few double or triple mutants weremissing from the collection of clones thus obtained. Theywere constructed by mutagenizing single or double mutantsobtained in the first round of mutagenesis using the appro-priate oligonucleotide. In each case, the nucleotide sequenceof the mutated EcoRI-EcoRI fragment was determined tocheck that it did not contain other alterations.In Vivo Assay of Promoter Activity. The EcoRI-EcoRI

malEp-malKp fragments containing the mutated promoterswere excised from the replicative form of the M13 deriva-tives, cloned into the EcoRI site of pOM41, and transferredin front of the chromosomal malPQ operon as described (9).The cells were grown at 370C in M63B1 minimal medium (12)supplemented with 0.4% glycerol or with 0.4% glycerol plus0.4% maltose as indicated, and the level ofamylomaltase, theproduct of malQ, was assayed by measuring the conversionof maltose into glucose (13). All of the values given in thiswork represent the average of assays performed in duplicateon at least two independent cultures. The observed variationsdid not exceed 10o. Backgrounds of 15 units/mg and 4units/mg of soluble cellular proteins were substracted fromthe values obtained under inducing and noninducing growthconditions, respectively (9).DNase I Footprinting. The EcoRI-EcoRI malEp-malKp

fragments carrying the mutations were excised from thereplicative form of the M13 derivatives and cloned into theEcoRP site ofpSB118 (9). The EcoRI-BamHI fragments werepurified from these plasmids by polyacrylamide gel electro-

Abbreviation: CRP, cAMP receptor protein.

229

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

230 Biochemistry: Vidal-Ingigliardi and Raibaud

(a) malEp CRP binding sites

(b)GI~ v Cv~vCZ vT

v T

CGTCGCTTTGTGTGKTCTCT GTT CAGAATTGGCGGTAATGTGGAGATGCGCA ATAAAATCGC*-60 Z1 *-90 =2Ii A

GCAGCGAAACACACTAGAGACAATGTCTTAACCGCCATTACACCTCTACGCGAGTATTTTAGCG

V vvIlVVVVV V~VILVV VV V v VVVVV V VVVV VvVVVVV~VCACGATTTTTGCAAGCAACATCACGAATTCCTTACATGACCTCGGTTTAGTI RGAAGCCG-3-120 I3Z 1I*i-150 4 1-180GTGCTAAAAACGTTCGTTGTAGTGCTTTAAGGAATGTACTGGAGCCAAATCAAGTGTCTTCGGC-5'* AbAA A 11 11 AAAA A A A 11AA&AA A^a &A AA'& ^h AA,&,&AAA

FIG.1. The fourCRP binding sites ofthe malEp-malKp region. (a) The 271-bp region lying between the transcription startpoints ofthe malEpand malKp promoters (arrowheads) is represented to scale with the Pribnow boxes (hatched boxes), the MalT binding sites (arrowed blackboxes), and the four CRP binding sites (open rectangles). (b) Schematic representation ofCRP-induced changes in the DNase I digestion pattern.Only the nucleotide sequence spanning the four CRP binding sites is shown. Nucleotides are numbered from the malEp transcription startpoint.Enhancements and protections are represented by filled and open triangles, respectively. Open rectangles correspond to the 16-bp sequence

encompassing the two major grooves contacted by CRP, with the nucleotides corresponding to the conserved TGTGA motif marked in boldface. The positions in this 16-bp sequence that are not protected by CRP are indicated by pairs of vertical bars.

phoresis and specifically labeled at the BamHI end by fillingin with the DNA polymerase I Klenow fragment in thepresence of dATP and [a-32P]dGTP, followed by ethanolprecipitation. The EcoRI-Sal I DNA fragment containingmalTp was purified from pOM50 (14) and labeled at the SalI end with [a-32P]dGTP in the presence of the three otherunlabeled dNTPs. The labeled DNA fragments (final con-centrations, 0.1-0.4 nM) were incubated at 250C in 20 jd of40 mM Hepes/KOH buffer (pH 8.0) containing 0.1 M potas-sium acetate, 10 mM magnesium acetate, 1 mM CaCl2, 1 mMdithiothreitol, 50 pg of acetylated bovine serum albumin per

ml, 1 mM cAMP, and various concentrations of CRP. After10-20 min, 2 t4 of a DNase I solution (diluted to 0.8 pg/mlin the same buffer except that dithiothreitol, cAMP, andbovine serum albumin were omitted) was added and thereaction mixture was further incubated for 1 min at 25°C.Digestion was stopped by adding 11 Al of 0.9 M sodiumacetate containing 75 mM EDTA and 30 ug of sonicatedplasmid DNA per ml. The DNA was recovered by ethanolprecipitation and resuspended in 90% formamide containing10 mM EDTA and tracking dyes. The radioactivity in thesamples was measured and the same amount of radioactivematerial from each sample was loaded on an 8% (wt/vol)polyacrylamide sequencing gel (0.3 mm thick) containing 8.3M urea. The gel was fixed, dried, autoradiographed on KodakXAR-5 film without a screen and the autoradiograms werescanned using a Bio-Rad 620 densitometer. The affinity ofCRP for the various sites was determined as described byBrenowitz et al. (15) except that the peak areas were deter-mined by weighing. Briefly, the area ofa well-suited "block"(i.e., a series ofcontiguous bands) corresponding to a portionof each CRP binding site was plotted as a function of CRPconcentration, and the concentration corresponding to half-maximal protection was taken as the dissociation constant(KD). The KD values given represent the mean values of twoindependent determinations. DNase I footprinting assayscarried out after 10-30 min of preincubation showed thatequilibrium was reached under the experimental conditionsused in this work. Two different CRP preparations wereused. One (a gift of E. Richet, Institut Pasteur) was purifiedon a cAMP affinity column (16). The other (a gift of B. Blazy,Institut Pasteur) was purified by standard methods and was100o active as measured by gel retardation assay. Both CRPpreparations gave exactly the same results. The CRP con-centration was determined spectrophotometrically, usingA278 = 4.1 x 104 M-lcm-i per dimer (17).

Hydroxyl Radical Footprinting. The DNA fragments andCRP were preincubated under the same conditions as thoseused for DNase I footprinting except that the reaction volume

was increased to 40 /1. Hydroxyl radical footprinting was

performed essentially as described by Tullius et al. (18)except that the three 2-/4 drops containing 0.6% (vol/vol)H202, 2 mM (NH4)2Fe(SO4)2/4 mM EDTA, and 20 mMsodium ascorbate, respectively, were placed separately onthe wall of the Eppendorf tube. The reaction was theninitiated by Vortex mixing and, after 1 min at 25°C, stoppedby adding 26 of a solution containing 22 ofDNase I stopbuffer and 4 of 0.1 M thiourea. The samples were thenprocessed and analyzed as described above.

RESULTSCRP Binds with High Affinity to Three Sites in the Intergenic

maLEp-malKp Region. The common regulatory region of themalEp and malKp promoters consists of a compact array ofbinding sites for both activator proteins, MalT and CRP (9)(Fig. la). All four CRP binding sites were occupied at highCRP concentrations in vitro, and the CRP-induced changes inthe DNase I digestion pattern resembled those observed forthe other characterized CRP binding sites (Fig. lb and Fig. 2).In particular, the four sites exhibited enhanced reactivity inthe TGTGA motif, indicating an enlargment of the minorgroove due to the bending of the DNA by CRP. The locationof CRP on the DNA was also characterized by hydroxylradical footprinting. This technique gives a sharper definitionofprotein-DNA contacts than DNase I footprinting, owing tothe small size ofthe hydroxyl radical and the lack ofsequencespecificity in the cleavage of the DNA backbone. The hy-droxyl radical footprint ofCRP bound to the intergenic regionconsisted of a clearly-defined series of protected regionsextending over about 130 bp (Fig. 2b). Such a pattern fullyagreed with the hydroxyl radical footprint expected for thebinding of four adjacent CRP molecules, with each boundmolecule resulting in the appearance of three patches ofprotection as was observed in the lac and gal CRP bindingsites (19). Model building has suggested that the extendedprotected region of CRP bound to a single site is a conse-quence of the bending of the DNA toward the protein (20).Since the four sites are almost aligned on the same face of theDNA helix, it is tempting to speculate that the intergenicregion is tightly wrapped around a core of four CRP mole-cules.The binding ofCRP to its four sites was then analyzed more

quantitatively by using the approach described by Brenowitzet al. (15) in their studies ofthe interactions ofthe cI repressorof bacteriophage A with the three operators present in the PRpromoter. DNase I footprinting was carried out in the pres-ence of various concentrations of CRP (Fig. 2a) and the

ma lKp

Proc. Natl. Acad Sci. USA 88 (1991)

Proc. Natl. Acad. Sci. USA 88 (1991) 231

CRP 00nM)

n0CDCM0(nM) o co to _ cxtv co rm CO

0)CD

0Cu)

-60 _ = :U-i.-t]i-80.

- 8 0 am[|w[1

-1 20

- 1 4 0 *- 3 ' 3

-1 60.-

-180 ,_(a) .

4

(b)

CRP site 11 2 3 4

IK ( M) 3 1 8 7 36K0

FIG. 2. DNase I and hydroxyl radical footprints ofCRP bound tothe malEp-malKp region. DNase I (a) and hydroxyl radical (b)footprinting experiments were carried out in the presence ofthe CRPconcentrations indicated. Nucleotides were numbered from themalEp transcription startpoint. Note that the pattern of bands in thehydroxyl radical experiment performed in the absence of CRPalready exhibited periodic diminution patches, suggesting the pres-ence ofbends in the fragment. Quantitative analysis by densitometryshowed that the protection by CRP is real and not due to the smalldifference in the amount of radioactive material loaded in the twolanes (data not shown). The dissociation constants (KD) of CRP foreach binding site (table at bottom) are mean values determined fromtwo experiments.

occupancy of the individual sites was measured at eachconcentration. From the plot of occupancy versus proteinconcentration, we calculated the KD of CRP for each of thefour sites (Fig. 2). To compare all of the CRP binding sitesinvolved in the regulation of the maltose system, we alsodetermined the affinity ofCRP for the malTp promoter underthe same experimental conditions and found a KD of 7 nM.Taking into account the relative affinities of CRP for its sitesin other promoters (21), we inferred that sites 1-3 are ofrelatively high affinity, comparable to those in lacZp, galEp,and malTp, respectively. On the other hand, site 4, which has1/100th the affinity of site 1, is the equivalent of the lacZpCRP site containing the strong L8 mutation (21). Note thatthese affinities might be affected by the presence of the otherproteins present in the initiation complex (22). Nevertheless,these results strongly suggest that sites 1-3, but not site 4,might play a functional role in the activation of malEp andmalKp.

Mutagenesis of the CRP Binding Sites. The functionalimportance of the four CRP binding sites was next investi-

ma lEpKpl malEpKp3CGA AGC

5'-TGTGATCTCTGTTACA ACGTTCGTTGTAGTGC-5'

* 4

5 '-TGTGGAGATGCGCACA GAGCCAAATCAAGTGT-5'

malEpKp2 malEpKp5 mal EpKp4

FIG. 3. Mutagenesis of the CRP binding sites. The 16-bp centralregion of the CRP-binding sites is shown with the consensus nucle-otides marked in bold face. Sequences of sites 1 and 2 are those ofthe top strand, while sequences of sites 3 and 4 are those of thebottom strand of the nucleotide sequence shown in Fig. 1. MutationsmaIEpKpl-maIEpKp5 (a triple nucleotide change, 5'-GTG to 5'-CGA) are indicated above and below these sequences. Symbols areas in Fig. 1.

gated by site-directed mutagenesis. We chose to introduce atriple mutation in the most conserved motif, 5'-TGTGA, toensure that the CRP sites would be completely destroyed.The GTG sequence was replaced by CGA in each of the foursites, giving mutations malEpKpl to malEpKp4 (Fig. 3).Replacements of the first and second guanines by cytosineand adenine correspond to the strong down mutations galp35and L8, isolated in the galEp and lacZp promoters, respec-tively (23, 24). The residual affinities of CRP for the differentmutated sites were estimated by quantitative DNase I foot-printing experiments with malEp-malKp fragments contain-ing the mutations (Fig. 4). The malEpKpl and malEpKp3mutations decreased the affinity of CRP for the correspond-ing binding sites by a factor of 100. The interpretation of theeffect of the malEpKp2 mutation was complicated by theunmasking of a new CRP binding site (KD = 300 nM) twonucleotides toward site 3. This new site was detected by bothDNase I and hydroxyl radical footprinting (Fig. 4b and datanot shown). Strikingly, this site did not exhibit any homologyto the consensus sequence for CRP binding site. Further-more, analysis of the interactions of CRP with the fragmentcontaining mutations in each site showed that CRP binding tothis new site was not stabilized by protein-protein interac-tions with the CRP molecules already bound to sites 1 and 3.In any event, we concluded that the CRP affinity for site 2

CRP o C-CV LsO coCO u s rLO sC N V) O CD(nM) o _CD 0a - N t a) C: ca:Nt a) )

___ . * ti~f And ys

- l 1 0C

.._I....1

-3_-an-11~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~...___....._.____._

(a)...b).... . .(a) (b) (c) {d)

FIG. 4. DNase I footprints ofCRP bound to the mutated malEp-malKp regions. DNase I footprinting was carried out on DNAfragments carrying the malEpKpl (a), malEpKp2 (b), malEpKp3 (c),or malEpKpl, -2, -3, and -4 (d) mutations at the indicated CRPconcentrations. Note that the mutations caused local alterations ofthe DNase I digestion pattern observed in the absence of CRP. Theintense band visible below site 3 was caused by a nick introduced byEcoRI at an EcoRI* site during the preparation of the fragment.

Biochemistry: Vidal-Ingigliardi and Raibaud

232 Biochemistry: Vidal-Ingigliardi and Raibaud

was decreased by a factor of at least 10 and that the new siteprobably did not play any role in vivo because of its lowaffinity for CRP. The titration experiments shown in Fig. 4also allowed us to estimate the effects of a mutation affectingone site on the affinity of CRP for the remaining ones. Wefound that CRP binding to sites 1 and 3 or to sites 2 and 3 wasnot cooperative but that binding to sites 1 and 2 was slightlycooperative. Indeed, the affinity of CRP for site 2 was 2-foldlower when CRP binding to site 1 was abolished. Thus,except for site 2, the KD values presented in Fig. 2 correspondto intrinsic KD values.The Three High-Affinity Binding Sites Are Required for the

Activation of Both malEp and maLKp Promoters. To determinethe effect of the various mutations on the activity of malEpand malKp, we transferred the fragment containing themutated malEp-malKp promoters in both orientations infront of the chromosomal malPQ operon and measured theamount of amylomaltase (the malQ product) synthesized asan indicator of promoter activity. The results are presented

N

0

.rU)

a:

1 2 3 4

co

.Fcacr

3 3,2 3.4

CRP sites mutated

FIG. 5. Residual activity of the mutated malEp and malKppromoters. malEp-malKp fragments containing single (a and b) ormultiple (c) CRP binding-site mutations were transferred in bothorientations in front ofthe chromosomal malPQ operon and the levelof amylomaltase was measured. Results are given as a percentage ofthe level obtained with the wild-type malEp-malKp fragment. Cellswere grown in minimal medium containing glycerol (b) or glycerolplus maltose (a and c) as the sole carbon source. The inducedactivities ofthe wild-type malEp and malKp promoters correspondedto 505 and 360 units of amylomaltase per mg of soluble cellularprotein, respectively, and the uninduced activities to 46 and 29units/mg.

in Fig. S as a percentage of the wild-type activity. When cellswere grown in the presence of maltose (i.e., under inducingconditions), only mutations in sites 1 and 3 resulted in amarked decrease in the activity of malEp and malKp. Aspreviously observed for down mutations located in the in-tergenic region, all of the mutations that affected one pro-moter also affected the other, although the effect on malKpwas systematically more pronounced than that on malEp. Toeliminate the possibility that the malEpKp2 mutation did nottotally destroy site 2, we introduced a second mutation intothis site (malEpKpS; Fig. 3). The residual activity of promot-ers bearing the malEpKp2 malEpKpS double mutation wasthe same as for the malEpKp2 mutation alone (data notshown).The activities of the promoters carrying several mutated

CRP sites were also measured (Fig. Sc). First, it was clearthat mutations in sites 2 and 4 not only had no effect bythemselves but also did not increase the effect of mutationsin sites 1 and 3. Second, the additive effects of the mutationsin sites 1 and 3 indicated that CRP binding to either site wasdirectly involved in the activation, rather than indirectly aswould be the case if the sole role of one site were to enhancethe action of the other. Finally, it should be noted that thepromoters carrying the quadruple mutation retained signifi-cant activity. A similar result was previously observed bymeasuring the activities of malEp and malKp in strainscarrying a deletion of the crp gene and producing highamounts of the MalT protein (5, 9).When the growth medium did not contain maltose (i.e.,

under noninducing conditions), malEp and malKp still re-tained about 10%o of their induced level of activity. Thesebasal activities were totally MalT-dependent (25) and prob-ably resulted from the presence ofan internal inducer or froma weak activity of MalT without inducer. The consequentresidual synthesis of the permeases is certainly very impor-tant for the cells, since the appearance of maltose or malto-dextrins in the growth medium can induce the expression ofthe maltose regulon only if they can enter the cell, evenslowly. It was thus of interest to examine the effects of theCRP binding-site mutations under these growth conditions.As shown in Fig. 5b, the uninduced activity of both promot-ers was more strongly affected by mutations in sites 1 and 3than the induced activity. Furthermore, the mutation in site2 now resulted in a 2- and 3-fold reduction in malEp andmalKp activities, respectively. However, and as expectedfrom its low affinity for CRP, site 4 was still dispensable. Thestronger effect of mutations in sites 1, 2, and 3 undernoninducing conditions may be due either to the lowerconcentration of active MalT molecules or to an increase inthe intracellular concentration of cAMP resulting from theabsence of maltose in the growth medium. Indeed, ifthe CRPbinding sites are only partially occupied in vivo, their de-struction is expected to have greater consequences undergrowth conditions in which the cAMP concentration is highand which consequently favor the occupancy of the sites.

DISCUSSIONCRP plays an important role in the regulation of the maltosesystem, as it does in most catabolic systems. However, theprecise targets of CRP in the mal regulon as well as theirquantitative importance have been relatively difficult todetermine, since one of these targets is the promoter of theregulator gene itself. Even when the defect in MalT synthesisin the absence of CRP was counteracted by the presence ofa mutation in the malTp promoter that renders its activityCRP-independent, some problems persisted that impededany quantitative assessment of the role played by CRP in theactivation ofthe promoters ofthe three mal operons, malPQ,malEFG, and malK-lamB-malM (5). Site-directed mutagen-

Proc. Natl. Acad. Sci. USA 88 (1991)

Proc. Nati. Acad. Sci. USA 88 (1991) 233

esis of the four CRP binding sites of the malEp and malKppromoters allowed us to overcome these difficulties, sincethe exact contribution of each site was determined by usingstrains in which the levels of both MalT and maltodextrinpermease should have been identical to those ofthe wild-typestrain. The conclusion is that the divergent malEp and malKppromoters are controlled by several CRP binding sites lo-cated in their common regulatory region: namely, sites 1 and3 when the expression of the system is induced by thepresence of maltose in the growth medium and sites 1, 2, and3 when it is uninduced. A fourth, low-affinity site for CRPwas shown to be totally dispensable under both growthconditions. It is interesting that the affinities of CRP for itssite in malTp and for sites 1 and 3 in malEp-malKp are verysimilar (KD = 7, 3, and 7 nM, respectively). This may lead toa highly cooperative response of the expression of thecomponents of the maltodextrin permease (the products ofthe malEFG and malK-lamB-malM operons) to increasingintracellular cAMP. That the expression of this very efficientpermease is so tightly regulated by the cAMP-CRP complex,especially in the absence of induction, makes sense. Whencatabolic repression is high and the substrate of the system isabsent, the synthesis of the permease is doubly useless andindeed the malEp and malKp promoters are inactive owing tothe low level of cAMP-CRP complex and the absence ofinduction. However, when catabolic repression is relieved, aminimum level of permease is required in order to transportany substrate that may be available and thus to begin toinduce the whole regulon without an excessive lag. Thisincrease in the uninduced level ofpermease results both fromthe stimulation of malTp and from the large direct activationof malEp and malKp by the increased intracellular concen-tration of the cAMP-CRP complex.The cAMP-CRP complex is involved in the transcriptional

activation of many promoters in E. coli. For most of them, itacts by binding to a single site, located slightly upstream ofthe RNA polymerase binding site (22). In a few others,several adjacent CRP binding sites have been observed, butproof of their involvement in the activation of these promot-ers is poorly documented (4, 26-29). Thus, our observationthat three adjacent CRP binding sites clearly play a role in theactivation of malEp and malKp is unprecedented. Twoadditional observations are, at first sight, surprising: thesesites are located far upstream of the transcription start site(centered at positions -76.5, -105.5, and -139.5 and atpositions -132.5, -166.5, -195.5 with respect to malEp andmalKp start sites, respectively) and all CRP-site mutationsthat affect one of the promoters also affect the other. Bothobservations are best explained by the model that we havepreviously proposed for the preinitiation complex formed atmalEp and malKp: about 210 bp of the intergenic regionwould be wrapped around a protein core built up of fivemolecules of MalT and several contiguous molecules of CRP(9). What might be the role of CRP in this complex? Twoproperties of CRP that were observed in studies of otherpromoters are probably relevant to this question: (i) bio-chemical and genetic experiments have suggested that CRPcan specifically interact with other proteins (22, 30, 31) and(ii) the binding ofCRP to its specific recognition site inducesa large bend in the DNA (20, 32). One can thus imagine thatCRP contributes to the construction of the nucleoproteincomplex either by specifically interacting with some of theMalT molecules or by bending the DNA. Should the latterhypothesis prove correct, then the role of CRP would besimilar to that of the integration host factor (ITF) in thebuilding of the "intasome" of bacteriophage A (33).

We are grateful to B. Blazy for the gift ofCRP and to E. Richet foruseful discussions. We thank M. Dreyfus, E. Richet, and A. Pugsleyfor help in the redaction of the manuscript and M. Schwartz for hisconstant interest in this work. This work was financed by the InstitutPasteur and the Centre National de la Recherche Scientifique (URA1149).

1. Ullmann, A. & Danchin, A. (1983) Adv. Cyclic Nucleotide Res.15, 1-53.

2. Hahn, S., Hendrickson, W. & Schleif, R. (1986) J. Mol. Biol.188, 355-367.

3. Lichenstein, H. S., Hamilton, E. P. & Lee, N. (1987) J.Bacteriol. 169, 811-822.

4. Valentin-Hansen, P., Holst, B., Josephsen, J., Hammer, K. &Albrechtsen, B. (1989) Mol. Microbiol. 3, 1385-1390.

5. Chapon, C. (1982) J. Bacteriol. 150, 722-729.6. Schwartz, M. (1987) in Escherichia Coli and Salmonella Ty-

phimurium, eds.' Neidhardt, F. C., Ingraham, J. L., Low,K. B., Magasanik, B., Schaechter, M. & Umbarger, H. E.(Am. Soc. Microbiol., Washington), pp. 1482-1502.

7. Schwartz, D. & Beckwith, J. R. (1970) in The Lactose Operon,eds. Beckwith, J. R. & Zipser, D. (Cold Spring Harbor Lab.,Cold Spring Harbor, NY), pp. 417-422.

8. Bedouelle, H., Schmeissner, U., Hofnung, M. & Rosenberg,M. (1982) J. Mol. Biol. 161, 519-531

9. Raibaud, O., Vidal-Ingigliardi, D. & Richet, E. (1989) J. Mol.Biol. 205, 471-485.

10. Zoller, M. J. & Smith, M. (1984) DNA 3, 479-488.11. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. NatI.

Acad. Sci. USA 74, 5463-5467.12. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold

Spring Harbor Lab., Cold Spring Harbor, NY).13. Raibaud, O., Gutierrez, C. & Schwartz, M. (1985) J. Bacteriol.

161, 1201-1208.14. Chapon, C. & Kolb, A. (1983) J. Bacteriol. 156, 1135-1143.15. Brenowitz, M., Senear, D. F., Shea, M. A. & Ackers, G. K.

(1986) Proc. Natl. Acad. Sci. USA 83, 8462-8466.16. Ghosaini, L. R., Brown, A. M. & Sturtevant, J. M. (1988)

Biochemistry 27, 5257-5261.17. Takahashi, M., Blazy, B. & Baudras, A. (1980) Biochemistry

19, 5124-5130.18. Tullius, T. D., Dombroski, B. A., Churchill, M. E. A. & Kam,

L. (1987) Methods Enzymol. 155, 537-558.19. Shanblatt, S. H. & Revzin, A. (1987) J. Biol. Chem. 262,

11422-11427.20. Warwicker, J., Engelman, B. P, & Steitz, T. A. (1987) Proteins

2, 283-289.21. Kolb, A., Spassky, A., Chapon, C., Blazy, B. & Buc, H. (1983)

Nucleic Acids Res. 11, 7833-7852.22. de Crombrugghe, B., Busby, S. & Buc, H. (1984) Science 224,

831-838.,23. Busby, S., Aiba, H. & de Crombrugghe, B. (1982) J. Mol. Biol.

154, 211-227.24. Beckwith, J. R., Grodzicker, T. & Arditti, R. (1972) J. Mol.

Biol. 69, 155-160.25. Bedouelle, H. (1983) J. Mol. Biol. 170, 861-882.26. Chen, Y.-M., Lu, Z. & Lin, E. C. C. (1989) J. Bacteriol. 171,

6097-6105.27. Legrice, S., Matzura, H., Marcoli, R., lida, S. & Bickle, T.

(1982) J. Bacteriol. 150, 312-318.28. Ogden, S., Haggerty, D., Stoner, C. M., Kolodrubetz, D. &

Schleif, R. (1980) Proc. Natl. Acad. Sci. USA 77, 3346-3350.29. Shirabe, K., Ebina, Y., Miki, T., Nakazawa, T. & Nakazawa,

A. (1985) Nucleic Acids Res. 13, 4687-4698.30. Irwin,;N. & Ptashne, M. (1987) Proc. Natl. Acad. Sci. USA 84,

8315-8319.31. Ren, Y. L., Garges, S., Adhya, S. & Krakow, J. S. (1988) Proc.

Natl. Acad. Sci. USA 85, 4138-4142.32. Liu-Johnson, H.-N., Gartenberg, M. R. & Crothers, D. M.

(1986) Cell 47, 995-1005.33. Goodman, S. D. & Nash, H. A. (1989) Nature (London) 341,

251-254.

Biochemistry: Vidal-Ingigliardi and Raibaud