The taxonomic status of the ‘sea trout’from the north Adriatic Sea, as revealed bymitochondrial and nuclear DNA analysisAles Snoj1,*, Bojan Marceta2, Simona Susnik3, Enver Melkic1, Vladimir Meglic3 and Peter

Dovc1 1University of Ljubljana, Biotechnical Faculty, Department of Animal Science,

Groblje, Domzale, Slovenia, 2National Institute of Biology, Vecna pot, Ljubljana, Slovenia

and 3Agricultural Institute of Slovenia, Hacquetova, Ljubljana, Slovenia

Abstract

Aim Unclassified salmonids, generally named ‘sea trout’, have been spotted on occasionin the north Adriatic Sea, although autochthonous salmonids have not been reported inthe Mediterranean Sea. On the basis of their phenotype, these fish were regarded as therainbow trout or salmon-like fish. The aim of the study was to determine the taxonomicstatus of the ‘sea trout’ and its origin.

Location The specimens originate from the coastal waters of the Gulf of Trieste,northern Adriatic Sea, and from hatchery-reared stock of brown trout (Salmo trutta),derived from Trentino fish-farm.

Methods Meristic measurements, nucleotide identity-test of mitochondrial DNA(mtDNA) (control region) and polymerase chain reaction-restriction fragment lengthpolymorphism (PCR-RFLP) analysis of nuclear DNA (lactate dehydrogenase C1* gene)were performed.

Results Morphological characters of the ‘sea trout’ specimens analysed, correspond bestwith those used for S. trutta and S. marmoratus. Genetic tests denoted explicit similaritybetween the ‘sea trout’ and hatchery-reared brown trout. Mitochondrial DNA analysisof the ‘sea trout’ revealed 100% nucleotide identity with brown trout of the Atlanticphylogeographical lineage. Results inferred from nuclear DNA analysis, confirmed theAtlantic descent of the ‘sea trout’ and demonstrated also a certain level of introgressionwith the brown trout of Danubian lineage.

Main conclusions Using mtDNA and nuclear DNA analysis it was concluded, that theAdriatic ‘sea trout’ belong to species S. trutta and is most likely derived from hatchery-reared brown trout population.

Keywords

Salmo trutta, sea trout, mitochondrial DNA, lactate dehydrogenase, morphology,Adriatic Sea.

INTRODUCTION

The Salmonidae family consists of many salt water tolerantspecies (Salmo sp., Salvelinus sp., Oncorhynchus sp.). Someof them are obligatory anadromous (majority of salmons),whereas the others [e.g. trout species (Salmo trutta) of the

Atlantic drainage] exhibit either sea-run migratory orfreshwater residential behaviour (Skala & Nævdal, 1989;Hindar et al., 1991; Northcote, 1992). This variation in lifehistory is primarily governed by crucial environmentalconditions, such as accessibility to sea, its temperature andsalinity, although a hereditary component may also beinvolved (Kottelat, 1997).

According to Tortonese (1970), salmonids are unknownin the Mediterranean Sea, most likely because of high saltconcentration (38&) and temperature which may rise toover 25 �C during the summer.

*Correspondence: University of Ljubljana, Biotechnical Faculty, Department

of Animal Science, Groblje 3, 1230 Domzale, Slovenia.

E-mail: ales.snoj@ bfro.uni-lj.si

Journal of Biogeography, 29, 1179–1185

� 2002 Blackwell Science Ltd

Nevertheless, few historical data exist, indicating a spor-adic occurrence of trout-like fish in the Adriatic Sea,generally referred to as S. cenerinus (Chiereghini, 1818) orTrutta adriatica (Kolombatovic, 1890; Ninni, 1912; Ninni,1930). However, original descriptions were very vague andcould apply to about any salmonid and both names are nowquestionably valid (Kottelat, 1997).

Marine fishermen do catch on occasion undefined salmo-nids in the north Adriatic Sea, generally called ‘sea trout’.The catches are very rare, limited to coastal waters andrestricted to springtime. These fish have been on the basis oftheir external appearance (e.g. silvery coloration), consid-ered as a rainbow trout (O. mykiss; Bussani, 1992; Zei,1996; Bettoso et al., 2000), sea-trout (S. truta f. trutta,Bettoso et al., 2000), or a ‘salmon-like fish’ (Medved S.,pers. comm.). These taxonomic assignments have beenreasoned by the fact, that at the beginning of the twentiethcentury many peri-Adriatic tributaries were stocked withnon-native Salmo and Oncorhynchus species (Chiappi,1927; Tortonese, 1935; Gridelli, 1936; Povz, 1995; Povzet al., 1996). It is believed that they have a potential tomigrate into the sea. Besides, in the Adriatic Sea, severalattempts have been made to rear some of non-nativesalmonid species in marine conditions (i.e. O. kisutch,Teskeredzic & Edwards, 1987; O. mykiss, Teskeredzicet al., 1989; O. masou, Teskeredzic & Teskeredzic, 1990).Rearing experiments were successful and the fish left in cagesduring the summer survived, showing no significant increaseof mortality. These facts along with previously mentionedphenotypic observations indicated that the ‘sea trout’ mayhave stemmed from stocked or reared fish of non-nativeorigin. However, classification based only on externalfeatures of the ‘sea trout’ has been due to phenoplasticity,which is characteristic for most salmonids, unreliable andcannot be decisive.

The purpose of this study was taxonomical classification ofthe ‘sea trout’, because no systematic investigation has beenperformed so far to determine its real taxonomic status.Taxonomic classification was performed on the basis ofmorphological measurements and genetic analysis. Nucleo-tide sequence of mitochondrial DNA (mtDNA) control regionwas determined and compared with the GenBank sequencedata of the brown trout, rainbow trout and Atlantic salmonfor genetic sequence based identification. In addition, taxo-nomic identification based on nuclear DNA markers wasperformed, using polymerase chain reaction-restriction frag-ment length polymorphism (PCR-RFLP) analysis of lactatedehydrogenase (LDH)-C1* gene that enables discriminationbetween phylogeographical lineages of S. trutta.

MATERIALS AND METHODS

Eleven specimens of the ‘sea trout’, caught by local fishermenin the coastal waters of the Bay of Piran and Koper (Gulf ofTrieste; Fig. 1) during the subsequent spring seasons from1998 to 2002, were collected and analysed. Additionally,fourteen hatchery-reared specimens from a fish-farm (Entetutela Pesca del Friuli-Venezia Giulia), representing the stock

destined for supportive stocking of the Rivers Soca andTagliamento, were also included in the molecular DNAanalysis.

Morphology

Total length, weight and several meristic measurements[number of the dorsal fin rays (D), anal fin rays (A), pelvic finrays (V), pectoral fin rays (P) and gill rakers (GR)] wereperformed on eight specimens (Table 1).

DNA isolation

Total DNA was obtained from fin tissue, according to theprotocol for DNA isolation from hair (Bowling et al., 2000).Fin tissue 1–2 mm2 was placed in 50 lL of 200 mM NaOHand heated at 97 �C for 10 min. The tissue lysis wasneutralized using 50 lL of 200 mM HCl and 100 mM Tris–HCl, pH 8.5, with thorough mixing.

Amplification and sequencing of mtDNA control region

Polymerase chain reaction amplification of c. 400 bpsegment of the 5¢-end of mtDNA control region wasperformed using primers 28r (5¢-CACCCTTAACTCCC-AAAGCTAAG-3¢), located in tRNAPro gene and HF(CCTGAAGTAGGAACCAGATG) in central conserved re-gion. A thermal profile with 53 �C annealing temperaturewas used. The amplified fragment of mtDNA was sequencedusing primer 28r and BigDye Terminator Ready ReactionMix (PE Applied Biosystems, Foster city, CA) according tomanufacturer’s recommendations. The amplified, fluores-cently labelled and terminated DNA was precipitated withsodium acetate and ethanol and analysed on the ABI Prism310 sequencer (PE Applied Biosystems).

Figure 1 Approximate locations, where the ‘sea trout’ specimenswere caught.

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

1180 A. Snoj et al.

The computer program ClustalX Multiple sequence Align-ment Program, Version 1.8 (Thompson et al., 1997) was usedto align DNA sequences. A phylogenetic tree was generatedfrom the aligned sequences using the quartet-puzzling, maxi-mum likelihood procedure in the PUZZLE program, version5.0 (Strimmer & von Haeseler, 1996). It was performed underthe HKY model of sequence evolution (Hasegawa et al.,1985). Support values for each internal branch were obtainedwith the construction of 1000 intermediate trees. For thegraphical representations of tree topologies the Treeviewprogram, version 1.6.5 (Page, 1996) was applied.

Amplification, digestion and sequencing of LDH-C1*gene

Polymerase chain reaction amplification of an c. 440 bp longfragment of LDH-C1* gene, comprised of 43 bp of exon 3,77 bp of exon 4 and intron 3 of variable length, wasperformed as described elsewhere (McMeel et al., 2001),using primers LDHxon4R and LDHxon4R.

From 5 to 10 lL of PCR product was digested with BslIrestriction enzyme (New England Biolabs Inc., Beverly, MA)in a total volume of 20 lL according to manufacturer’sinstructions. The resultant fragments were separated byelectrophoresis on a 2% agarose gel.

The DNA sequencing was performed as described inprevious paragraph, using primer LDHxon4R.

RESULTS

Morphological data

All the ‘sea trout’ specimens were equally coloured: theback was silvery-grey, becoming lighter and more silverytowards the flanks. The belly was almost white. The dorsal,adipose and caudal fins were grey, whereas the pelvic andanal fins were almost white. The specimens were heavilyspotted with irregularly shaped black spots, evenly distri-buted on the back and flanks both above and below thelateral line, on the gill cover and the dorsal fin. With anexception of one specimen, the adipose fin was spotless.One sample (ID 11997) lacked the pectoral fins. Meristiccharacteristics are summarized in Table 1. They exhibitedmoderate intrasample variability and the results consider-ably overlapped with data referred to four Salmo speciesand O. mykiss, showing no distinctive differences betweenthem. Nevertheless, morphological characters of the spec-imens analysed correspond best with those quoted forS. trutta and S. marmoratus.

Molecular data

Mitochondrial DNAFor all the specimens analysed, a 420-bp nucleotidesequence of the 5¢-end of mtDNA control region wasdetermined.

Table 1 Morphological data [total length (TL; mm), weight (W; g), number of dorsal fin rays (D), anal fin rays (A), pelvic fin rays (V), pectoralfin rays (P) and gill rakers (GR)] and molecular genetic data of the ‘sea trout’ specimens, designated with ID numbers. Available meristic dataof Salmo cenerinus*, S. marmoratus�, S. trutta�,§, S. salar�,§ and Oncorhynchus mykiss� are also listed

Morphology Genetics

ID/species TL W D A V P GR mtDNA LDH-C1* gene

M1 At 90/907619 226 86 12 10 9 12 14 At 90/907620 213 99 12 9 9 14 16 At 90/907621 202 77 12 10 9 13 14 At 90/9011995 232 113 12 9 9 13 15 At 90/9011996 212 91 13 11 9 13 17 At 90/9011997 197 65 13 11 9 / 16 At 90/10011998 504 1230 12 10 9 14 18 At 90/9018893 / / / / / / / At 100/10018894 / / / / / / / At 90/9018896 233 124 13 8 11 14 16 At 90/90

Range 12–13 8–11 9–11 12–14 14–18

S. cenerinus / / 13 9 9 16 /S. marmoratus / / 13–15 9–13 8–9 13–15 /S. trutta trutta / / 10–15 9–14 7–10 11–16 13–19S. salar / / 11–15 10–14 8–11 11–16 17–24O. mykiss / / 10–12 8–12 10 14–16 17–22

*Chiereghini (1818).�Povz et al. (1996).�FishBase (1997).§Svetovidov (1984).

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

‘Brown trout’ in the north Adriatic Sea 1181

By surveying nucleotide sequences from the samples of the‘sea trout’ and specimens, originating from the fish farm, nodifferences were found between them. A hundred percentnucleotide sequence identity was found between the haplo-type of analysed specimens and the haplotype of the browntrout, originating from the Atlantic basin. Nucleotideidentity between the ‘sea trout’ specimens and other phylo-geographical lineages of S. trutta (Danubian, Adriatic,Mediterranean and marmoratus) was c. 99%. Phylogeneticrelationship between the ‘sea trout’ and main S. truttalineages are depicted in Fig. 3. Alignment of the ‘sea trout’DNA sequence with the sequences from the GenBankdatabase revealed 90% and 93% identity between thesequence analysed and appropriate DNA fragments, derived

from the Atlantic salmon and the rainbow trout, respectively(Fig. 2).

LDH-C1* geneThe phylogeographical identity of analysed specimens wasdetermined by PCR-RFLP analysis of LDH-C1* codingregion, enabling discrimination between Atlantic (LDH-C1*90) and other phylogeographical lineages of S. trutta(i.e. *100 and *120) allozyme alleles. Among the ‘seatrout’ specimens, three different genotypes were detected:seven homozygotes indicating allele *90, one (ID 18893)carrying non-Atlantic alleles (*100 or *120), and oneheterozygote (ID 11997), carrying *90 and *100 or *120allele.

Figure 2 Nucleotide sequence alignment of 420 bp fragment of mtDNA control region of the ‘sea trout’, S. trutta (haplotype At1), O. mykissand S. salar (GenBank accession No. M97969, M81755 and U12143). The sequences correspond to the L-strand. Identity is denoted by anasterisk and deletions by a dash.

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

1182 A. Snoj et al.

The hatchery-reared samples were monomorphic for theallele 90, with an exception of one sample exhibitingheterozygous genotype (*90/*100 or *120).

The phylogeographical identity of non-Atlantic lineageswas determined according to diagnostic point mutations inthe intron 4, which enable discrimination between theDanubian, Adriatic and marmoratus phylogeographicallineages (Snoj, unpublished data). On the basis of thesemutations, non-Atlantic alleles found in the ‘sea trout’ andhatchery-reared brown trout specimens as well, were recog-nized as Danubian.

DISCUSSION

On the basis of mtDNA sequence identity, the analysedspecimens belong to the S. trutta rather than to either theS. salar or the Oncorhynchus sp. This is clearly demonstra-ted by the mtDNA nucleotide divergence data, nuclear DNAanalysis and supported also by morphological measure-ments. DNA sequence variation of the 5¢-mtDNA controlregion among geographically remote brown trout popula-tions has already been studied and revealed five majorphylogenetic assemblages (Danubian, Adriatic, Mediterra-nean, Atlantic and marmoratus), that exhibit diagnostichaplotypes, differing by mean sequence divergence estimatesfrom 0.96 to 1.44% (Bernatchez et al., 1992). All fivegroups showed a strong spatial pattern of distribution,significantly reflecting their geographical partitioning, andwere proposed to be recognized as the basic evolutionary

significant units within S. trutta (Bernatchez, 2001). On thebasis of these facts we demonstrated that the ‘sea trout’belong to the Atlantic lineage. In the Adriatic region onlymarmoratus, Adriatic and Mediterranean phylogenetic lin-eages of S. trutta are autochthonous (Giuffra et al., 1994;Apostolidis et al., 1997; Snoj et al., 2000) and the appear-ance of the Atlantic lineage is therefore exclusively theoutcome of stocking activities.

Atlantic descent of the ‘sea trout’ was confirmed also byLDH-C1* gene analysis. The LDH C1* has been, partic-ularly in brown trout, already proven as informative markerat the protein level (Allendorf et al., 1977) and the nucleo-tide sequence and PCR-RFLP routine screening for differen-tiation between *90 and other alleles (*100 and *120) hasbeen recently established (McMeel et al., 2001). The allele*100 is found throughout the brown trout range, allele *90is naturally restricted to the northwest Europe (Atlanticdrainage; Hamilton et al., 1989) and less abundant allele*120 has been so far detected only in marmoratus phylo-genetic lineage (Berrebi et al., 2000). Most of the hatcherystocks in Europe are fixed for *90 allele (McMeel et al.,2001). The marker for the allele *90 forms a convenient toolfor following the presence of brown trout of hatchery origin(the Atlantic lineage), particularly in areas where it does notoccur naturally. The result of PCR-RFLP analysis indicatedthe prevalence of the Atlantic lineage within the ‘sea trout’,although some introgression of the Da lineage was alsodetected. This lineage is also allochthonous in the Adriaticriver system, where it has been successfully introduced. Noaboriginal alleles were detected in the specimens analysed,which indicated non-native, hatchery origin of the ‘seatrout’. This view is additionally corroborated by the mor-phological observation, which revealed an absence of thepectoral fins in one specimen; this anatomical abnormality isoften observed among farmed fish, and can be explained as aconsequence of their territorial behaviour.

The ‘sea trout’ may originate from the tributaries of thenorth Adriatic Sea, from where it might run into the seaupon river swelling. This usually happens in the springtimeas a consequence of the snow melt in the mountains.Interestingly, this is as well the season when the brown troutis most frequently observed in the north Adriatic Sea. It isalso possible that the sea-run migratory behaviour, charac-teristic for many brown trout population originating fromthe Atlantic river basin, may contribute to the migration ofS. trutta into the Adriatic Sea. A dispersal would be the mostlikely explanation for the occurrence of the brown trout inthe north Adriatic Sea.

Therefore, the north Adriatic ‘sea trout’ may originatefrom a hatchery-reared population of the brown trout,migrating to the sea from the Rivers Rizana, Soca orTagliamento. The population genetic structure of S. truttafrom Rizana has been described as very heterogeneous,exhibiting almost one-half of autochthonous (Ma/Ad) mark-ers (Snoj, unpublished data) and therefore probably does notrepresent the origin of the ‘sea trout’. The Rivers Soca andTagliamento seem to be a more probable source of the ‘seatrout’. Both rivers have been massively stocked with brown

Figure 3 Maximum likelihood tree relating five major mtDNAevolutionary lineages of S. trutta (At – Atlantic, Da – Danubian, Me– Mediterranean, Ad – Adriatic and Ma – marmoratus) and the ‘seatrout’. Confidence statements (as a percentage) estimated from 1000puzzling steps are shown between the nodes.

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

‘Brown trout’ in the north Adriatic Sea 1183

trout originating from the fish farm (Associazione Troticol-tori Trentini; G. Magrini, pers. comm.), rearing brown troutof the Atlantic origin. The result of molecular analysis of thehatchery-reared specimens, destined for the Soca andTagliamente stocking (performed by Ente tutela Pesca delFriuli-Venezia Giulia fish farm) are consistent with those ofthe ‘sea trout’, corroborating its proposed origin.

With the present investigation we tried to explain recentoccurrence of the brown trout in the north Adriatic. On theother hand, we failed to explain the occurrence of the ‘seatrout’, already described in the nineteenth century (Chie-reghini, 1818; Kolombatovic, 1890), when fish-farming inthe peri-Adriatic region was minimal or null. It could beproposed that the existing ‘sea trout’ and the historical onedo not represent the same lineage.

It can be deduced from our study that translocatedallochthonous population can not only interfere with localpopulation but may also invade habitats previously unoccu-pied with incipient population. Furthermore, it was revealedthat it can develop even a new ecotype, representing abiological factor with an unpredictable impact on the newlysubsistent habitat.

ACKNOWLEDGMENTS

Authors are thankful to Matjaz Cervek, Srecko Medvedand Giulio Magrini for providing samples and valuableinformation, and also Patrick Berrebi and Peter Tronteljfor helpful comments on earlier version of this manu-script.

REFERENCES

Allendorf, F.W., Mitchell, N., Ryman, N. & Stahl, G. (1977)Isozyme loci in brown trout (Salmo trutta L.): detection andinterpretation from population data. Hereditas, 86, 179–190.

Apostolidis, A.P., Triantaphyllidis, C., Kouvatsi, A. &Economidis, P.S. (1997) Mitochondrial DNA sequence vari-ation and phylogeography among Salmo trutta L. (Greekbrown trout) populations. Molecular Ecology, 6, 531–542.

Bernatchez, L. (2001) The evolutionary history of brown trout(Salmo trutta L.) inferred from phylogeographic, nested cladeand mismatch analyses of mitochondrial DNA variation.Evolution, 55, 351–379.

Bernatchez, L., Guyomard, R. & Bonhomme, F. (1992) DNAsequence variation of the mitochondrial control region amonggeographically and morphologically remote European browntrout Salmo trutta populations. Molecular Ecology, 1,161–173.

Berrebi, P., Povz, M., Jesensek, D., Cattaneo-Berrebi, G. &Crivelli, A.J. (2000) The genetic diversity of native, stockedand hybrid populations of marble trout in the Soca river,Slovenia. Heredity, 3, 277–287.

Bettoso, N., Moro, G.A. & Cassetti, P. (2000) La fauna marinadel porticciolo di S. Croce (Golfo di Trieste). HydroresInformation, 16 (Annuario, 1999), 7–19.

Bowling, A.T., Del Valle, A. & Bowling, M. (2000) A pedigree-based study of mitochondrial D-loop DNA sequence vari-ation among Arabian horses. Animal Genetics, 31, 1–7.

Bussani, M. (1992) Ricomparsa nel Golfo di Trieste di alcunespecie ittiche. Hydrores Information, 9, 5–7.

Chiappi, T. (1927) La Trota marina in Adriatico. Bollettino DiPesca, Di Piscicoltura E Di Idrobiologia, 3, 10–12.

Chiereghini, Ab S. (1818) Descrizione de¢ crostacei, de¢ testaceie de’pesci che abitano le lagune e golfo Veneto. Op. ms.,p. 128.

FishBase (1997) FishBase. 97 CD-ROM. ICLARM, Manila.Giuffra, E., Bernatchez, L. & Guyomard, R. (1994) Mito-

chondrial control region and protein coding genes sequencevariation among phenotypic forms of brown trout Salmotrutta from northern Italy. Molecular Ecology, 3, 161–171.

Gridelli, E. (1936) I pesci d’acqua dolce della Venezia Giulia.Tipografia Domenico del Bianco e figlio, Udine.

Hamilton, K.E., Fergusson, A., Taggart, J.B., Tomason, T.,Walker, A. & Fahy, E. (1989) Post-glacial colonization ofbrown trout, Salmo trutta L. Ldh-5 as a phylogenetic markerlocus. Journal of Fish Biology, 35, 651–664.

Hasegawa, M., Kishino, H. & Yano, K. (1985) Dating of thehuman-ape splitting by a molecular clock of mitochondrialDNA. Journal of Molecular Evolution, 22, 160–174.

Hindar, K., Jonsson, B., Ryman, N. & Stahl, G. (1991) Geneticrelationship among landlocked, resident, and anadromousbrown trout, Salmo trutta L. Heredity, 66, 83–91.

Kolombatovic, J. (1890) Notizie ittiologiche. I. Seconda trottamarina pescata nel mare di Vranjic Trutta adriatica n. sp.Glasnik Hrvatskog Naravoslovnog Drustva Zagreb, 5,165–167.

Kottelat, M. (1997) European freshwater fishes. Biologia, 52(Suppl. 5), 1–237.

McMeel, O.M., Hoey, E.M. & Ferguson, A. (2001) Partialnucleotide sequences, and routine typing by polymerasechain reaction-restriction fragment length polymorphism,of the brown trout (Salmo trutta) lactate dehydrogenase,LDH-C1*90 and *100 alleles. Molecular Ecology, 10,29–34.

Ninni, E. (1912) Catalogo Dei Pesci Del Mare Adriatico.C. Bertotti, Venezia.

Ninni, E. (1930) Sopra la Trutta adriatica (Kolomb.). Bulletinde la Societe Zoologique de France, 55, 446–451.

Northcote, T.G. (1992) Migration and residency in streamSalmonids-some ecological considerations and evolutionaryconsequences. Nordic Journal of Freshwater Research, 67,5–17.

Page, R.D. (1996) TREEVIEW: an application to displayphylogenetic trees on personal computers. Computer Appli-cations in the Bioscience, 12, 357–358.

Povz, M. (1995) Status of freshwater fishes in the Adriaticcatchment of Slovenia. Biological Conservation, 72,171–177.

Povz, M., Jesensek, D., Berrebi, P. & Crivelli, A.J. (1996) TheMarble trout Salmo trutta marmoratus, Cuvier 1817, in theSoca River basin, Slovenia. Tour du Valat Publication, Arles.

Skala, Ø. & Nævdal, G. (1989) Genetic differentiation betweenfreshwater residentandanadromousbrowntrout,Salmotrutta,within watercourses. Journal of Fish Biology, 34, 597–605.

Snoj, A., Jug, T., Melkic, E., Susnik, S., Jesensek, D., Budihna,N., Pohar, J. & Dovc, P. (2000) Mitochondrial and micro-satellite DNA analysis of marble trout in Slovenia. Journal ofFreshwater Biology (Quaderni ETP), 29, 5–11.

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

1184 A. Snoj et al.

Strimmer, K. & von Haeseler, A. (1996) Quartet puzzling: aquartet maximum likelihood method for reconstructing treetopologies. Molecular Biology and Evolution, 13, 964–969.

Svetovidov, A.N. (1984) Salmonidae. Fishes of the north-easternAtlantic and the Mediterranean, Vol. 1 (eds P.J.P. Whitehead,M.L. Bauchot, J.C. Hureau, J. Nielsen and E. Tortonese),pp. 373–385. UNESCO, Paris.

Teskeredzic, E. & Edwards, D. (1987) Coho thrive in Adriatictrials. Fish Farmer, 10, 36–37.

Teskeredzic, E. & Teskeredzic, Z. (1990) A successful rearingexperiment with amago salmon (Oncorhynchus masourhodurus) in floating cages in the Adriatic Sea. Aquaculture,86, 201–208.

Teskeredzic, E., Teskeredzic, Z., Tomec, M. & Hacmanjek, M.(1989) Culture of coho salmon (Oncorhynchus kisutch) andrainbow trout (Salmo gairdneri) in the Adriatic Sea. WorldAquaculture, 20, 56–57.

Tortonese, E. (1935) Elenco dei pesci italiani con annotazionisistematiche. Bollettino Di Pesca, Di Piscicoltura E DiIdrobiologia, 11, 211–254.

Tortonese, E. (1970) Osteichthyes (Pesci ossei). Parte prima:Fauna D’italia, Vol. 10. Edizioni Calderini, Bologna, pp. 1–565.

Zei, M. (1996) Ribe severnega Jadrana. Narava Slovenije, stanjein perspektive. Zbornik prispevkov o naravni dedisciniSlovenije (ed. J. Gregori), pp. 356–361. Drustvo ekologovSlovenije, Ljubljana.

BIOSKETCHES

The paper is a part of research, in which geneticbackground and phylogeography of salmonids from theAdriatic river system are studied.

Ales Snoj is Research Associate at the University ofLjubljana, Department of Animal Science. He is partic-ularly engaged in phylogeography and conservationgenetics of endangered salmonids inhabiting the Adriaticdrainage of western Balkan Peninsula. His latest researchpublications are associated with genetic characterizationof two endemic salmonids in the north Adriatic drainagearea, marble trout and Adriatic grayling.

Bojan Marceta is a marine biologist at the NationalInstitute of Biology. He works on fishery biology andmarine fish ecology. He is a Slovene representative forInternational Bottom Trawl Survey programme (MED-ITS) and regional FAO-AdriaMed project. His latestresearch interest deals with monitoring of the fisheryresources in the Adriatic Sea. He is the author of the‘Determination Key’ for Slovene marine teleosts.

� 2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185

‘Brown trout’ in the north Adriatic Sea 1185