The Sodium Pump Regulates Sperm and Sertoli Cell Function
Transcript of The Sodium Pump Regulates Sperm and Sertoli Cell Function
![Page 1: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/1.jpg)
University of Calgary
PRISM: University of Calgary's Digital Repository
Graduate Studies The Vault: Electronic Theses and Dissertations
2016
The Sodium Pump Regulates Sperm and Sertoli Cell
Function
Rajamanickam, Gayathri Devi
Rajamanickam, G. D. (2016). The Sodium Pump Regulates Sperm and Sertoli Cell Function
(Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/28384
http://hdl.handle.net/11023/3237
doctoral thesis
University of Calgary graduate students retain copyright ownership and moral rights for their
thesis. You may use this material in any way that is permitted by the Copyright Act or through
licensing that has been assigned to the document. For uses that are not allowable under
copyright legislation or licensing, you are required to seek permission.
Downloaded from PRISM: https://prism.ucalgary.ca
![Page 2: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/2.jpg)
UNIVERSITY OF CALGARY
The Sodium Pump Regulates Sperm and Sertoli Cell Function
by
Gayathri Devi Rajamanickam
A THESIS
SUBMITTED TO THE FACULTY OF GRADUATE STUDIES
IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE
DEGREE OF DOCTOR OF PHILOSOPHY
GRADUATE PROGRAM IN VETERINARY MEDICAL SCIENCES
CALGARY, ALBERTA
AUGUST, 2016
© Gayathri Devi Rajamanickam 2016
![Page 3: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/3.jpg)
ii
Abstract
Abnormalities in sperm function at the submicroscopic level (not detectable during
routine semen evaluation) influence bull fertility and therefore the efficiency of cattle
production. New knowledge regarding the molecular basis of spermatogenesis and sperm
function will enable us to develop evidence-based approaches for improving fertility. The overall
aim of this thesis was to investigate role of Na/K-ATPase (the sodium pump) isoforms in sperm
function, Sertoli cell function and male fertility. In fresh bovine sperm, I identified two distinct
pools (raft and non-raft) of the testis-specific isoform of Na/K-ATPase (ATP1A4) in the plasma
membrane. The raft pool of ATP1A4 interacted with caveolin-1 and EGFR, whereas the non-raft
pool of ATP1A4 interacted with EGFR, Src and ERK1/2 in capacitated sperm. In addition, a
comprehensive analysis revealed that the ATP1A4 interactome differed between raft and non-
raft fractions of capacitated sperm. Specifically, ATP1A4 interacted and co-localised with
plakoglobin (member of β-catenin family of proteins involved in cell adhesion) in the equatorial
segment of capacitated sperm; this suggests a potential role for these proteins in sperm-oolemma
fusion. During investigation of ATP1A4 involvement in lipid rafts, I determined that ATP1A4
content and activity were increased during capacitation, perhaps due to translation of ATP1A4
mRNA in mitochondrial or mitochondrial-type ribosomes. In frozen-thawed sperm, content and
activity of ATP1A4 was greater in high- versus low-fertility bulls and significantly correlated
with fertility. Additionally, ATP1A4-induced ROS, calcium, actin polymerization and tyrosine
phosphorylation were also involved in regulating post-thaw sperm function in these bulls. My
results also demonstrated that prepubertal rat Sertoli cells expressed ATP1A1 (the ubiquitous
isoform of Na/K-ATPase) and that ATP1A1-ouabain interaction regulated formation
(modulation of claudin 11 and connexin 43 expression) and function (transepithelial electric
![Page 4: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/4.jpg)
iii
resistance) of Sertoli cell junctional complexes through Src-EGFR-ERK1/2- CREB pathway in a
dose-dependent manner. Overall, results demonstrated that isoforms of Na/K-ATPase have
unique roles in controlling several aspects of sperm and Sertoli cell physiology, acting through
its well-established enzyme activity and signaling functions. Consequently, isoforms of Na/K-
ATPase are potential candidates for reversible male contraception and a biomarker for male
fertility.
![Page 5: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/5.jpg)
iv
Acknowledgements
I thank my supervisor Dr. Jacob Thundathil for giving me the opportunity to work on this project
and for his guidance, support and mentorship throughout my doctoral degree. The belief that he
had in me and in my bench skills helped me to learn a lot as a researcher over the past years. I
really appreciate his open-door policy and to the endless paper/thesis editing sessions.
I sincerely thank my supervisory committee members Drs. Frans van der Hoorn, Ina
Dobrinski and John Kastelic for their valuable guidance and critical insights on the project.
Special thanks to Dr. Claudia Klein for use of her laboratory for Sertoli cell culture experiments
and for troubleshooting tips with PCR.
I thank UCVM for their entrance scholarship, Alberta Children’s Hospital Research
Institute for their graduate student trainee scholarship and also UCVM and University of Calgary
for numerous travel awards. I thank the financial support of Natural Sciences and Engineering
Research Council and Alberta Livestock and Meat Agency for funding my project.
I acknowledge the technical support of Laurent Brechenmacher for mass spectrometry
data analysis. I am also thankful to Tom Kroetsch for his advice on fertility evaluation of dairy
bulls, Grace Kwong for her help with statistics and Laurie Kennedy for her expertise with flow
cytometry.
I thank Alta Genetics Inc. for providing fresh semen samples for the entire duration of my
study and Semex Alliance Inc. for their contribution of frozen-thawed semen samples from dairy
bulls. I thank current members of Dr. Thundathil lab (Alysha Dance, Mina Ojaghi, Chinju
Johnson and Guilherme Rizzoto) for their support and friendship. If not for these people,
working in the lab wouldn’t have been easy. I thank Mr. Doug Nickel for helping me procure to
semen samples from Alta Genetics and for his advice on laboratory techniques. I appreciate all
![Page 6: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/6.jpg)
v
the help that I got from the Reproduction and Regenerative Medicine group for their generous
contribution of antibodies and use of their microscopes. Finally, I would like to thank all of my
friends in Calgary and the rest of my family in India for being there in my ups and downs.
![Page 7: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/7.jpg)
vi
Dedication
To my boys
Rio – Nothing in this world can be compared to the toothless smile of yours
Vijay – For your patience and acceptance, for all the calls and coffees
To my parents
Late Dad – I know you are still watching me
Mum – For sending me back to pursue my goals and for coming to Canada
![Page 8: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/8.jpg)
vii
Table of Contents
Abstract ......................................................................................................................................... ii Acknowledgements ...................................................................................................................... iv Dedication .................................................................................................................................... vi
Table of Contents ........................................................................................................................ vii List of Tables .............................................................................................................................. xii List of Figures and Illustrations ................................................................................................. xiii
CHAPTER ONE: INTRODUCTION ....................................................................................... 1 1.1 Review of literature ............................................................................................................ 2
1.1.1 Bull breeding soundness evaluation and current challenges in sire selection: ........... 2 1.1.2 Sperm capacitation ..................................................................................................... 4
1.1.3 Comparative physiology of mammalian sperm capacitation ..................................... 5 1.1.4 Sperm proteomics – the key to identify biomarkers of fertility ................................. 6
1.1.5 Na/K-ATPase structure and isoforms ......................................................................... 8 1.1.6 Ouabain – inhibitor of Na/K-ATPase enzyme activity .............................................. 8
1.1.7 Expression and localisation of Na/K-ATPase subunits in the male reproductive
tract ............................................................................................................................. 9 1.1.8 Ion transport-dependent functions of Na/K-ATPase in sperm ................................. 10
1.1.9 Signaling function of Na/K-ATPase in somatic cells ............................................... 11 1.1.10 Signaling function of Na/K-ATPase in sperm ........................................................ 12
1.1.11 Role of lipid rafts in somatic cell signaling events ................................................. 14
1.1.12 Role of lipid rafts during sperm capacitation ......................................................... 15
1.1.13 Na/K-ATPase and regulation of post-thaw sperm function ................................... 16 1.1.14 Role of Na/K-ATPase in formation and function of epithelial cell tight
junctions (TJs) ........................................................................................................... 19 1.2 Aims, hypotheses, objectives and outcomes ..................................................................... 21
CHAPTER TWO: TESTIS-SPECIFIC ISOFORM OF NA/K-ATPASE (ATP1A4)
REGULATES BOVINE SPERM CAPACITATION THROUGH RAFT AND
NON-RAFT MEDIATED SIGNALING........................................................................ 26
2.1 Abstract ............................................................................................................................. 26 2.2 Introduction ....................................................................................................................... 27 2.3 Materials and methods ...................................................................................................... 29
2.3.1 Semen processing and capacitation .......................................................................... 29 2.3.2 Isolation of raft and non-raft membrane fractions .................................................... 30 2.3.3 ATP1A4 content, distribution of raft and non-raft markers, fatty acid profiles,
and morphology of membrane vesicles in raft- and non-raft membrane fractions
prepared from uncapacitated sperm .......................................................................... 31 2.3.3.1 ATP1A4 content and distribution of raft and non-raft markers in the
membrane fractions .......................................................................................... 31 2.3.3.2 Fatty acid analysis ........................................................................................... 31 2.3.3.3 Transmission electron microscopy ................................................................. 32
![Page 9: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/9.jpg)
viii
2.3.4 Confirmation of capacitation status of sperm based on sperm motility patterns
and phosphoprotein content ...................................................................................... 32 2.3.5 Capacitation associated changes in the total protein and cholesterol content in
raft and non-raft sperm membrane fractions ............................................................. 32 2.3.6 Immunoprecipitation ................................................................................................ 33
2.3.7 Immunoblotting ........................................................................................................ 34 2.3.8 Statistical analyses .................................................................................................... 34
2.4 Results ............................................................................................................................... 35 2.4.1 ATP1A4 content, distribution of raft and non-raft markers, fatty acid profile,
and morphology of membrane vesicles in the raft- and non-raft membrane
fractions prepared from uncapacitated sperm ........................................................... 35
2.4.2 Characterization of capacitation status of sperm based on sperm motility
patterns and phosphoprotein content ........................................................................ 37
2.4.3 Capacitation associated changes in the content of total protein, cholesterol in
raft and non-raft sperm membrane fractions ............................................................. 39 2.4.4 Signaling function of ATP1A4 under ouabain-induced capacitating conditions ..... 41
2.4.5 Interaction of ATP1A4 with signaling molecules in the raft and non-raft
membrane fractions during capacitation ................................................................... 46 2.5 Discussion ......................................................................................................................... 47
CHAPTER THREE: CHARACTERIZATION OF THE TESTIS-SPECIFIC
ISOFORM OF NA/K-ATPASE (ATP1A4) INTERACTOME IN RAFT AND
NON-RAFT MEMBRANE FRACTIONS FROM CAPACITATED BOVINE
SPERM.............................................................................................................................. 55
3.1 Abstract ............................................................................................................................. 55 3.2 Introduction ....................................................................................................................... 56
3.3 Materials and methods ...................................................................................................... 57 3.3.1 Semen collection, preparation of reagents, preparation of raft and non-raft
fractions from uncapacitated and capacitated sperm ................................................ 57
3.3.2 Immunoprecipitation and SDS-PAGE ..................................................................... 57 3.3.3 Protein digestion ....................................................................................................... 58
3.3.4 LC-MS/MS analysis ................................................................................................. 59 3.3.5 Database search ........................................................................................................ 60 3.3.6 Criteria for protein identification .............................................................................. 60 3.3.7 Western blotting ....................................................................................................... 61
3.3.8 Colocalisation of plakoglobin and PLCζ with ATP1A4 in capacitated sperm ........ 61 3.3.9 Flow cytometric analysis of F-actin in sperm .......................................................... 62 3.3.10 Statistical analysis .................................................................................................. 62
3.4 Results ............................................................................................................................... 63 3.4.1 Identification of ATP1A4 interacting partners by mass spectrometry ..................... 63 3.4.2 Validation of mass spectrometry data for selected candidate proteins ..................... 72
3.5 Discussion ......................................................................................................................... 76
![Page 10: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/10.jpg)
ix
CHAPTER FOUR: CONTENT OF TESTIS-SPECIFIC ISOFORM OF NA/K-
ATPASE (ATP1A4) IS INCREASED DURING BOVINE SPERM
CAPACITATION THROUGH TRANSLATION IN MITOCHONDRIAL
RIBOSOMES ................................................................................................................... 85 4.1 Preamble ........................................................................................................................... 85
4.2 Abstract ....................................................................................................................... .. 85 4.3 Introduction ....................................................................................................................... 86 4.4 Materials and methods ...................................................................................................... 87
4.4.1 Semen collection and preparation of reagents .......................................................... 87 4.4.2 Sperm preparations for in vitro capacitation and assessment of motility and
tyrosine phosphorylation ........................................................................................... 88
4.4.3 Isolation of raft and non-raft fractions from bovine sperm ...................................... 88 4.4.4 Immunoblotting ........................................................................................................ 89
4.4.5 Flow cytometry ......................................................................................................... 89
4.4.6 Na/K-ATPase enzyme activity ................................................................................. 90 4.4.7 Isolation of sperm RNA and real-time PCR ............................................................. 91
4.4.8 Detection of protein synthesis by fluorescent amino acid incorporation during capacitation ............................................................................................................... 94 4.4.9 Statistical analyses .................................................................................................... 94
4.5 Results ............................................................................................................................... 95 4.5.1 Content of ATP1A4 increased in raft and non-raft membrane fractions during
capacitation ............................................................................................................... 95 4.5.2 Content and activity of ATP1A4 is increased during capacitation in detergent
soluble sperm protein extracts .................................................................................. 96 4.5.3 Capacitation-associated increase in content of ATP1A4 was not due to
translocation of ATP1A4 from subcellular compartments ....................................... 98 4.5.4 Confirmation of capacitation-associated increase in content of ATP1A4 by
flow cytometry .......................................................................................................... 99
4.5.5 Capacitation of bull sperm in presence of actinomycin D did not prevent
capacitation associated increase in ATP1A4 content ............................................. 101
4.5.6 Capacitation of bull sperm in presence of chloramphenicol inhibited
capacitation associated increase in ATP1A4 content ............................................. 102 4.5.7 Detection of protein synthesis by fluorescent amino acid incorporation during capacitation ............................................................................................................. 106
4.6 Discussion ....................................................................................................................... 107
CHAPTER FIVE: DEVELOPMENT AND VALIDATION OF LABORATORY
ASSAYS TO DETERMINE CONTENT AND ACTIVITY OF TESTIS-SPECIFIC
ISOFORM OF NA/K-ATPASE (ATP1A4) IN BULL SPERM ................................. 117 5.1 Abstract ........................................................................................................................... 117 5.2 Introduction ..................................................................................................................... 118 5.3 Materials and methods .................................................................................................... 120
5.3.1 Validation of Na/K-ATPase activity assay ............................................................. 120 5.3.1.1 Processing of frozen-thawed sperm bull sperm ............................................ 120 5.3.1.2 Preparation of sperm membrane protein extracts ......................................... 120
![Page 11: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/11.jpg)
x
5.3.1.3 Determination of ATP1A4 activity in sperm ................................................ 120 5.3.1.4 Validation parameters for ATP1A4 activity assay ....................................... 121
5.3.2 Flow cytometric evaluation of ATP1A4 content in fresh sperm ............................ 121 5.3.3 Immunolocalization of ATP1A4 in sperm ............................................................. 122 5.3.4 Statistical analyses .................................................................................................. 122
5.4 Results ............................................................................................................................. 122 5.4.1 Validation of ATP1A4 enzyme activity ................................................................. 122 5.4.2 Validation of ATP1A4 content in frozen-thawed bovine sperm by flow
cytometry………………………………………………………………………… 126 5.5 Discussion ....................................................................................................................... 128
CHAPTER SIX: TESTIS-SPECIFIC ISOFORM OF NA/K-ATPASE (ATP1A4)
REGULATES SPERM FUNCTION AND FERTILITY IN DAIRY BULLS
THROUGH MECHANISMS INVOLVING REACTIVE OXYGEN SPECIES,
INTRACELLULAR CALCIUM AND ACTIN POLYMERIZATION ................... 131
6.1 Abstract ........................................................................................................................... 131 6.2 Introduction ..................................................................................................................... 132
6.3 Materials and methods .................................................................................................... 134 6.3.1 Frozen semen production ....................................................................................... 134 6.3.2 Processing of frozen-thawed sperm from HF and LF bulls ................................... 135
6.3.3 Preparation of sperm crude membrane extracts ..................................................... 136 6.3.4 Enzyme activity and flow cytometric evaluation of ATP1A4 content in frozen
thawed sperm of HF and LF bulls........................................................................... 136
6.3.5 Measurement of intracellular ROS in HF and LF bull sperm ................................ 136
6.3.6 Measurement of intracellular calcium in HF and LF bull sperm ........................... 137 6.3.7 Flow cytometric evaluation of F-actin content in HF and LF bull sperm .............. 137
6.3.8 Flow cytometry settings for fluoroprobes used in the study .................................. 137 6.3.9 Assessment of sperm tyrosine phosphorylation ..................................................... 138 6.3.10 Statistical analyses ................................................................................................ 139
6.4 Results ............................................................................................................................. 139 6.4.1 ATP1A4 content and activity in HF and LF bull sperm ........................................ 139
6.4.2 Post-thaw sperm functional parameters in HF and LF bull sperm ......................... 141 6.4.3 ATP1A4 induced changes in sperm functional parameters in HF and LF
bull sperm ............................................................................................................... 144 6.4.4 Relationship between ATP1A4 content, activity, sperm functional
parameters and fertility ........................................................................................... 146 6.5 Discussion ....................................................................................................................... 150
CHAPTER SEVEN: THE UBIQUITOUS ISOFORM OF NA/K-ATPASE
(ATP1A1) REGULATES JUNCTIONAL PROTEINS, CONNEXIN 43
AND CLAUDIN 11 VIA SRC-EGFR-ERK1/2-CREB PATHWAY IN
PREPUBERTAL RAT SERTOLI CELLS ................................................................. 156 7.1 Preamble ......................................................................................................................... 156 7.2 Abstract ........................................................................................................................... 156 7.3 Introduction ..................................................................................................................... 157
![Page 12: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/12.jpg)
xi
7.4 Materials and methods .................................................................................................... 160 7.4.1 Animals ................................................................................................................... 160 7.4.2 Chemicals and antibodies ....................................................................................... 160 7.4.3 Isolation and culture of prepubertal rat Sertoli cells .............................................. 161 7.4.4 Mass spectrometry on Sertoli cell extracts ............................................................. 162
7.4.5 Measurement of transepithelial electrical resistance (TER) of Sertoli cells .......... 163 7.4.6 Isolation of Sertoli cell RNA and quantification of junctional molecules by RT-qPCR ........................................................................................................... 164 7.4.7 Immunofluorescence .............................................................................................. 166 7.4.8 Preparation of Sertoli cell lysates and immunoblotting ......................................... 166
7.4.9 Statistical analysis .................................................................................................. 167
7.5 Results ............................................................................................................................. 168 7.5.1 Characterisation of Sertoli cells from prepubertal rat testis ................................... 168
7.5.2 Increase in claudin 11 expression indicates the formation of Sertoli cell
TJs ........................................................................................................................... 169 7.5.3 Detection of α1 and β3 subunits of Na/K-ATPase in Sertoli cells ......................... 172
7.5.4 Dose-dependent regulation of ouabain on claudin 11 and connexin 43
expression and its effect on TER ............................................................................ 176 7.5.5 Involvement of Src-EGFR-ERK1/2-CREB pathway in ouabain mediated
regulation of claudin 11 and connexin 43 and its effect on TER ............................ 180 7.6 Discussion ....................................................................................................................... 187
CHAPTER EIGHT: GENERAL DISCUSSION AND FUTURE DIRECTIONS ............ 196
REFERENCES ........................................................................................................................ 205
APPENDIX: COPYRIGHT PERMISSIONS……………………………………………...233
![Page 13: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/13.jpg)
xii
List of Tables
Table 3.1: Data from Mascot showing the identity of proteins, their probability scores
(protein score and expect score) and peptide sequences (>95% confidence) in the raft
fraction. ................................................................................................................................. 64
Table 3.2: Data from Mascot showing the identity of proteins, their probability scores
(protein score and expect score) and peptide sequences (>95 % confidence) in the non-
raft fraction. ........................................................................................................................... 67
Table 3.3: Spectral counts of differentially interacted proteins (control vs ouabain-capacitated
sperm) in raft and non-raft membrane fractions ................................................................... 71
Table 4.1: Primer sequences used for detecting ATP1A4 mRNA in bovine sperm ..................... 93
Table 4.2: Primer sequences used for detecting full-length ATP1A4 mRNA in bovine sperm ... 93
Table 4.3: Relative median fluorescence intensity (flow cytometry) values from
uncapacitated and capacitated sperm immunostained with ATP1A4 antibody .................. 101
Table 5.1: Precision of the enzyme assay evaluated by inter-assay CV. .................................... 124
Table 5.2: Precision of the enzyme assay evaluated by inter-assay CV ..................................... 124
Table 5.3: Accuracy of the enzyme assay evaluated through spike recovery ............................ 125
Table 5.4: Accuracy of the enzyme assay evaluated through dilutional linearity ...................... 125
Table 6.1: Correlation of ATP1A4 content (semi-quantitative densitometry and flow
cytometry values), enzyme activity, ROS, calcium and F-actin with fertility in HF and
LF bulls ............................................................................................................................... 149
Table 7.1: Primer sequences used for detecting transcripts of TJ and GJ molecules, and
isoforms of Na/K-ATPase in prepubertal Sertoli cells ....................................................... 165
Table 7.2: Mass spectrometric detection of Na/K-ATPase isoforms in prepubertal rat Sertoli
cells ..................................................................................................................................... 175
![Page 14: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/14.jpg)
xiii
List of Figures and Illustrations
Figure 1.1 A proposed model for bovine sperm capacitation mediated by the
interaction of ATP1A4 with its ligand ouabain (adapted from Thundathil et al.
2012) ................................................................................................................................... 14
Figure 2.1 ATP1A4 content, distribution of raft and non-raft markers, fatty acid
profiles, and morphology of membrane vesicles in raft- and non-raft membrane
fractions prepared from uncapacitated sperm ..................................................................... 36
Figure 2.2. Characterization of sperm capacitation status based on sperm motility
patterns and phosphoprotein content. ................................................................................. 39
Figure 2.3. Quantification of total protein and cholesterol content from raft and non-
raft membrane fractions obtained from uncapacitated and capacitated bovine
sperm. .................................................................................................................................. 40
Figure 2.4. Effect of capacitating conditions on caveolin-1 phosphorylation in raft
and non-raft membrane fractions. ....................................................................................... 42
Figure 2.5 Effect of capacitating conditions on ERK1/2 phosphorylation in non-raft
membrane fractions ............................................................................................................. 43
Figure 2.6 Effect of capacitating conditions on EGFR phosphorylation in non-raft
membrane fractions. ............................................................................................................ 44
Figure 2.7 Effect of capacitating conditions on Src phosphorylation in raft and non-
raft membrane fractions. ..................................................................................................... 45
Figure 2.8 Interaction of ATP1A4 with signaling molecules in raft and non-raft
membrane fractions during capacitation ............................................................................. 47
Figure 2.9 A hypothetical model for ATP1A4-mediated raft- and non-raft signaling
pathways during bovine sperm capacitation ....................................................................... 54
Figure 3.1 Potential functions of differentially interacted proteins (control vs
ouabain-capacitated sperm) in raft and non-raft membrane fractions ................................ 74
Figure 3.2 Validation of selected ATP1A4 interactomes and ATP1A4-plakoglobin
interaction during sperm capacitation ................................................................................. 76
Figure 3.3 Colocalisation of ATP1A4-PLCζ during sperm capacitation ................................... 83
Figure 3.4 A hypothetical model depicting the involvement of plakoglobin, α and β
subunits of ATP1A4, E-cadherin and PLCζ during sperm-oocyte fusion .......................... 84
![Page 15: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/15.jpg)
xiv
Figure 4.1. ATP1A4 content in membrane fractions under ouabain- or heparin-
induced capacitating conditions. ......................................................................................... 96
Figure 4.2. Content of ATP1A4 and activity in detergent-soluble sperm protein
extracts prepared from ouabain or heparin capacitated sperm. ........................................... 97
Figure 4.3 Analysis of ATP1A4 levels in detergent-insoluble extracts from ouabain
and heparin capacitated sperm. ........................................................................................... 98
Figure 4.4 Analysis of ATP1A4 content in fixed sperm (flow cytometry) under
ouabain- or heparin-induced capacitating conditions. ...................................................... 100
Figure 4.5. Effects of actinomycin D on ATP1A4 transcription during capacitation of
bovine sperm. .................................................................................................................... 102
Figure 4.6 Effects of chloramphenicol on ATP1A4 translation during capacitation of
bovine sperm. .................................................................................................................... 104
Figure 4.7 Screenshots of NCBI blast corresponding to the sequenced PCR products
obtained from ATP1A4 mRNA in bull sperm .................................................................. 105
Figure 4.8. Inhibition of ATP1A4 synthesis in the presence of chloramphenicol (CP)
during capacitation. ........................................................................................................... 107
Figure 4.9 Hypothetical schematic view of the possible mechanisms involved in
translation of sperm mRNA during capacitation. ............................................................. 116
Figure 5.1. Validation of ATP1A4 enzyme activity in frozen-thawed bull sperm. .................. 123
Figure 5.2 Validation of flow cytometry to determine ATP1A4 content in frozen-
thawed bull sperm. ............................................................................................................ 127
Figure 6.1. Post-thaw content and activity of ATP1A4 from HF and LF bulls ........................ 141
Figure 6.2. Post-thaw sperm functional parameters in HF and LF bulls .................................. 143
Figure 6.3. Assessment of ATP1A4-induced changes in sperm functional parameters
in HF and LF bulls ............................................................................................................ 146
Figure 6.4 Correlations of various predictor variables to fertility in Holstein bulls ................. 148
Figure 6.5 Regression analysis for prediction of fertility in Holstein bulls .............................. 148
Figure 7.1 Characterisation of Sertoli cells from prepubertal rat testis. ................................... 169
Figure 7.2 Formation of Sertoli cell junctional complexes in vitro. ......................................... 171
![Page 16: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/16.jpg)
xv
Figure 7.3 Monitoring the formation of Sertoli cell junctional complexes in vitro by
claudin 11 staining ............................................................................................................ 172
Figure 7.4. Characterisation of Na/K-ATPase isoforms in rat Sertoli cells. ............................. 174
Figure 7.5 Dose-dependent regulation of ouabain on expression of TJ and GJ proteins. ........ 178
Figure 7.6 Dose-dependent regulation of ouabain on localisation patterns of claudin 11 in
Sertoli cells ........................................................................................................................ 179
Figure 7.7. Involvement of Src-EGFR-ERK1/2-CREB pathway in ouabain-mediated
regulation of TJ and GJ proteins ....................................................................................... 182
Figure 7.8 Dose-dependent regulation of ouabain on p-CREB staining in Sertoli cells .......... 183
Figure 7.9 Effect of Src inhibition on phosphorylation of signaling molecules, claudin 11
and connexin 43 expression and its effects on TER. ........................................................ 185
Figure 7.10 Effect of ERK1/2 inhibition on CREB phosphorylation and its effects on TER. . 186
Figure 7.11. Schematic representation of signaling pathway mediated by ATP1A1-ouabain
(non-inhibitory dose) in prepubertal Sertoli cells. ............................................................ 195
![Page 17: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/17.jpg)
xvi
List of Abbreviations
ADAM A disintegrin and metalloprotease domain
AI Artificial insemination
AKAP A kinase anchoring protein
Akt/PKB Protein kinase B
ATP1A4 α subunit of testis-specific isoform of Na/K-ATPase
ALH Amplitude of lateral head displacement
ATP1B3 β subunit of Na/K-ATPase
ATP1A1 α subunit of ubiquitous isoform of Na/K-ATPase
AMH Anti-Mullerian hormone
AK1 Adenylate kinase 1
ATP Adenosine triphosphate
BBSE Bull Breeding Soundness Evaluation
BSP Binder of sperm protein
BS3 Bissulfosuccinimidyl suberate
BTB Blood-testis barrier
CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate
CREB cAMP response element binding protein
CID Collision induced dissociation
cAMP Cyclic adenosine monophosphate
CASA Computer assisted sperm analyser
![Page 18: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/18.jpg)
xvii
CBM Caveolin binding motif
CCT5 and 8 T-complex protein 1 subunits ϵ and θ
CP Chloramphenicol
CV Coefficient of variation
CSD Caveolin scaffolding domain
CCT/TRiC Chaperonin containing TCPI-ring complex
DAPI 4',6-diamidino-2-phenylindole
DAG Diacyl glycerol
dbcAMP Dibutyryl cAMP
DCFDA 2’,7’ –dichlorofluorescin diacetate
DPSS Diode pumped solid state laser
DMEM Dulbecco’s modified eagle medium
DRM Detergent resistant membrane
DS Desmosomes
EGF and EGFR Epidermal growth factor and receptor
ERK1/2 Extracellular signal-regulated protein kinases 1 and 2
EDTA Ethylene diamine tetraacetic acid
ECM Extracellular matrix
ELSPBP1 Epididymal sperm-binding protein E12
ES Ectoplasmic specialization
ER Endoplasmic reticulum
ES Equatorial segment
![Page 19: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/19.jpg)
xviii
FAA Fertility associated antigen
FSC Forward scatter
F-actin Filamentous actin
FITC Fluorescein isothiocyanate
GJ Gap junctions
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
Grb2 Growth factor receptor bound protein 2
GM-1 monosialotetrahexosylganglioside 1
G-actin Globular actin
GTP Guanosine triphosphate
GP β-Glycerophosphate
GATA4 GATA (consensus sequence) binding protein 4
H2O2 Hydrogen peroxide
HRP Horse radish peroxidase
HSP Heat shock proteins
HF High-fertility bulls
IP3 Inositol triphosphate
IP3R IP3 receptor
ID-1 Inhibitor of DNA binding protein 1
IBMX 3-isobutyl-1-methylxanthine
JAM Junctional adhesion molecule
KH2Po4 Potassium dihydrogen phosphate
![Page 20: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/20.jpg)
xix
KLF17b Kruppel like factor 17 member b
KO Knock out
LIN Linearity
LC Liquid chromatography
LF Low-fertility bulls
LDH Lactate dehydrogenase
MES 2-(N-morpholino)ethanesulfonic acid
MBS MES buffered saline
MFI Median fluorescence intensity
MDCK Madin-Darby canine kidney
mtIF2 and IF3 Mitochondria initiation factor 2 and 3
MSY Mouse Y box protein
MTS Mitochondria targeting sequence
MIF Macrophage migration inhibitory factor
MAPK Mitogen activated protein kinases
Na2Co3 Sodium carbonate
NaHCO3- Sodium bicarbonate
Na3Vo4 Sodium vanadate
NCBI National Center for Biotechnology Information
NCX Sodium calcium exchanger
NaF Sodium fluoride
NHE Sodium hydrogen exchanger
![Page 21: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/21.jpg)
xx
NRR Non-return rates
Na3PO4 Sodium phosphate
OK Opposum kidney
OPN Osteopontin
P25b PH-20/Sperm adhesion molecule 1
PEBP1 Phosphatidylethanolamine-binding protein 1
PGD Lipocalin type D-prostaglandin synthase
PDGF Platelet derived growth factor
PMCA Plasma membrane Ca2+
ATPase
PP2A Protein phosphatase 2
PTK Protein tyrosine kinase
PI3K Phosphatidyl inositol 3-kinase
PA phosphatidic acid
PC phosphatidyl choline
PI Propidium iodide
PFA Paraformaldehyde
PCNA Proliferating cell nuclear antigen
PBS Phosphate buffered saline
PLCζ Phospholipase zeta
PH-20 Sperm adhesion molecule 1
PLD Phospholipase D
PIP2 Phosphatidylinositol 4,5-bisphosphate
![Page 22: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/22.jpg)
xxi
PIP3 Phosphatidlyinositol 3,4,5-triphosphate
Pi Inorganic phosphate
PKC Protein kinase C
PKA Protein kinase A
PP2A Protein phosphatase 2
PS Posterior acrosome
PAWP Postacrosomal WW binding protein
PG Plakoglobin
PV Perivitelline space
PT Perinuclear theca
Q-TOF Quadrupole-time of flight
Rho A Ras homolog gene family member A
RPE Retinal pigment epithelium
RNP Ribonucleo protein particles
RBP RNA binding proteins
RIPA Radioimmunoprecipitation buffer
Ras Rat sarcoma protein
Raf Rapidly accelerated fibrosarcoma
RTK Receptor tyrosine kinase
ROS Reactive oxygen species
Sp-TALP Tyrode Albumin Lactate Pyruvate medium for sperm capacitation
Sos Son of sevenless
![Page 23: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/23.jpg)
xxii
STI Soybean trypsin inhibitor
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Src Sarcoma
StAR Steroidogenic acute regulatory protein
SSC Side scatter
SNPs Single nucleotide polymorphisms
tRNAMet
Methionine loaded tRNA
TALPH Tyrode Albumin Lactate Pyruvate Hepes medium
TJ Tight junctions
TER Transepithelial electrical resistance
TIMP2 Type-2 tissue inhibitor of metalloproteinases
TM Transmembrane domain
tACE Testis-specific isoform of angiotensin converting enzyme
TTBS Tween-20 Tris buffered saline
VCL Curvilinear velocity
VASA/DDX4 DEAD-box helicase 4
WT-1 Wilms tumour protein 1
WT` Wild type
YWHA 14-3-3 phospho-serine/phospho-threonine binding proteins
ZO-1 Zona occludens 1
ZP Zona pellucida
2D Two dimension
![Page 24: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/24.jpg)
xxiii
3D Three dimension
3β-HSD 3 beta-hydroxysteroid dehydrogenase
![Page 25: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/25.jpg)
1
Chapter One: Introduction
World population is expected to reach nearly ~10 billion by 2050, necessitating increased
efficiency of global food production. With ~35 million beef cows in American beef herds, a
modest 3% increase in reproductive rate would yield ~1 million more beef calves annually
(Senger PL 2012). Similarly, a 3% increase in pregnancy rates in American dairy herds would
yield an additional 15 million litres of milk per year. Therefore, improving reproductive
efficiency of beef and dairy cattle is of utmost importance for meeting increasing global demand
for animal proteins. In that regard, bull fertility is particularly critical, as one bull can breed
thousands of females by artificial insemination (AI) or 20 to 30 females via natural service per
breeding season. Bull breeding soundness evaluation (BBSE) identifies bulls with semen that is
grossly abnormal. Notwithstanding, semen samples classified as satisfactory based on these
traditional approaches differ in fertility; therefore, perhaps there are submicroscopic differences
in sperm characteristics affecting fertility. Therefore, a better understanding on the molecular
regulation of sperm and testis function promotes development of novel, evidence-based
approaches to managing male fertility.
The overall aim of this project was to understand the role of Na/K-ATPase in regulation
of sperm function, Sertoli cell function and male fertility. Recently the α4 isoform of Na/K-
ATPase (ATP1A4) has received considerable attention due to its testis-specific expression in
post-meiotic germ cells and mature sperm and its regulation of sperm motility and capacitation.
We previously demonstrated that incubation of bovine sperm with ouabain (a specific ligand for
Na/K-ATPase) induced capacitation through signaling involving kinases. However, mechanisms
by which Na/K-ATPase orchestrates and activates various signaling molecules in this process
![Page 26: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/26.jpg)
2
remain unknown. In somatic cells, Na/K-ATPase signaling involves lipid rafts; furthermore, the
importance of lipid rafts in regulation of sperm function was also reported (Thaler et al. 2006,
Bou Khalil et al. 2006, Gadella et al. 2008). Perhaps Na/K-ATPase orchestrates and activates
several molecules in lipid rafts of the sperm plasma membrane during capacitation. In addition,
downstream events associated with Na/K-ATPase signaling (including increases in ROS,
intracellular calcium, protein tyrosine phosphorylation and actin polymerisation) have been
linked to fertility of frozen-thawed sperm. Therefore, it is likely that ATP1A4 content and
activity are related to post-thaw sperm function and fertility. Apart from sperm, ATP1A1, the
ubiquitous isoform of Na/K-ATPase, has been involved in regulation of epithelial cell tight
junctions. Since Sertoli cells are the only epithelial cells responsible for germ cell development
and maturation in the testis, perhaps ATP1A1 is involved in formation and function of the blood
testis barrier (BTB) and thus male fertility. Therefore, the thesis project was undertaken to
investigate the role of Na/K-ATPase isoforms in events leading to sperm capacitation, male
fertility and Sertoli cell junctional complexes. A review of literature relevant for this research is
provided in this chapter.
1.1 Review of literature
1.1.1 Bull breeding soundness evaluation and current challenges in sire selection:
Dairy and beef industries strive to achieve high pregnancy rates from genetically superior bulls.
Therefore, fertility is more important than production traits; in that regard, estimated relative
importance of reproductive traits to growth and carcass traits are in the ratio of 4:2:1,
respectively (Schiefelbein 1998). Bull fertility is particularly critical, with ~80% of bulls deemed
satisfactory based on a traditional BBSE. The standards for BBSE established by the Society for
![Page 27: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/27.jpg)
3
Theriogenology (www.therio.org) are intended to assess the likelihood of a bull establishing
pregnancy in >25 healthy, cycling females in a 65-70 d breeding season. A bull that is healthy
and sound, with adequate scrotal circumference, >30% progressive motile sperm, >70%
morphologically normal sperm, and <20% sperm head defects, is designated as a satisfactory
potential breeder. Despite being classified as satisfactory, there is typically 10-20% variation in
fertility among bulls (natural mating or AI), due to submicroscopic/molecular differences in their
sperm (Larson & Miller 2000). Bulls with reduced sperm fertility can cause substantial economic
losses due to delayed conception, prolonged calving seasons, reduced calf weaning weights, and
increased number of breeding females that are culled due to failure to become pregnant or
delayed pregnancy establishment. Although subfertility of bulls may not be evident when used in
a multiple-sire or low breeding pressure system, such bulls typically result in reduced fertility
when they are used for single-sire mating or AI (Kastelic & Thundathil 2008, Kasimanickam et
al. 2012). Therefore, bull effects are paramount. For example, a modest 1% increase in the
reproductive rate would generate up to three times more return on investments (Hansen 2006).
BBSE eliminates bulls that are grossly abnormal (due to general health, physical characteristics
or semen characteristics) and conventional frozen semen analysis eliminates semen samples that
do not meet criteria established by the Society of Theriogenology (Barth 1993). Regardless, the
subjective nature and lack of precision in conventional semen analysis suggests that acceptable
semen may be erroneously rejected, and concurrently, semen of unacceptable quality may be
used for inseminations (Christensen et al. 2005). Therefore, bull or semen selection could be
aided by complementing traditional BBSE and frozen semen evaluation using novel laboratory
assays focused on molecular sperm function (sperm capacitation; see below), which may
improve bull fertility predictions.
![Page 28: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/28.jpg)
4
1.1.2 Sperm capacitation
Ejaculated sperm must undergo changes in the female reproductive tract to achieve fertilizing
ability; this includes a series of physiological and biochemical modifications termed capacitation.
Biochemical changes include an efflux of cholesterol from the plasma membrane leading to an
increase in membrane fluidity, hyperpolarization of the plasma membrane (Hernandez-Gonzalez
et al. 2006), changes in protein phosphorylation and protein kinase activity (Baldi et al. 2000,
Visconti 2009), increase in bicarbonate (HCO3−), Ca
2+ and cyclic adenosine monophosphate
(cAMP) concentration and intracellular pH. Several molecules are required for successful
capacitation to occur; these include HCO3−, serum albumin (BSA) and Ca
2+. The co-transporter
Na+/HCO3
− facilitates entry of HCO3
− into sperm (Demarco et al. 2003) and physiological
increase in HCO3− concentration activate scramblase enzyme, leading to a rapid collapse of the
asymmetry of the sperm plasma membrane (Gadella & Harrison 2000), thereby increasing
availability of cholesterol to external acceptors (Salicioni et al. 2007). This increase in the
HCO3− concentration also increases intracellular pH, activates a unique soluble adenylyl cyclase
which in turn increases cAMP and cAMP-dependent PKA activation during capacitation.
Bicarbonate, in combination with BSA, also increases membrane hyperpolarization due to
enhanced K+ permeability (Martinez-Lopez et al. 2009). Downstream of bicarbonate, PKA
activation modulates the response of calcium channels such as CatSper, which changes
intracellular Ca2+
concentrations. Furthermore, PKA phosphorylates several proteins on serine
and threonine residues, thereby activating (directly or indirectly) several protein kinases and/or
inhibiting protein phosphatases, which culminate in increased phosphorylation of tyrosine
residues (Bajpai et al. 2003, Visconti et al. 2011). Due to capacitation-associated changes
![Page 29: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/29.jpg)
5
mentioned above, motility pattern of sperm changes from a linear progressive motion (swimming
in a relatively straight line) to a localised, non-progressive motion (hyperactivation) that
facilitates sperm-oocyte contact. Binding of sperm to an oocyte initiates fusion of the sperm
plasma membrane and outer acrosome membrane that allows release of acrosomal enzymes from
sperm (acrosome reaction) which digest the zona pellucida of the oocyte. Sperm now enters the
perivitelline space (between the zona pellucida and oocyte plasma membrane/oolemma) and
fuses with the oolemma, leading to successful fertilization. Since sperm DNA is generally
considered transcriptionally inactive, sperm functions (motility, capacitation and sperm-oocyte
interaction) are regulated by sperm proteins and their post-translational modifications without
additional protein synthesis. In that regard, sperm proteomics has received considerable attention
for identification of markers for submicroscopic differences in sperm function.
1.1.3 Comparative physiology of mammalian sperm capacitation
In mammals, regulators of capacitation such as calcium, bicarbonate and BSA have different
effects among species. For example, HCO3−, BSA and Ca
2+ are necessary for the capacitation of
mouse sperm (Visconti et al. 1995) while BSA is not necessary for the capacitation of boar
(Tardif et al. 2003) and ram sperm (Patricia Grasa et al. 2006). Visconti & Kopf (1998)
suggested a cooperative effect of Ca2+
and HCO3- by an increase in cAMP levels and subsequent
phosphorylation of different proteins. Increasing amounts of extracellular Ca2+
alone increases
tyrosine phosphorylation in mouse (Visconti et al. 1995) and human sperm (Lecerc et al. 1998).
When exposed to a variety of substrates, mouse, human and bovine sperm capacitation correlate
with an increase in protein tyrosine phosphorylation (Viscontil et al. 1995, Galantino-Homer
![Page 30: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/30.jpg)
6
et al. 1997, Carrera et al. 1996). Glucose inhibits heparin-induced bovine capacitation in vitro by
a mechanism involving cAMP metabolism and a reduction of intracellular pH (Parrish et al.
1994). Paradoxically, glucose is beneficial for capacitation in other species. BSA, present in the
capacitation media (e.g., mouse, hamster, cattle, and human), is believed to function during in
vitro capacitation as a sink for the removal of cholesterol from the sperm plasma membrane. In
vitro, the average time required to complete the capacitation process, judged by the acquisition of
fertilizing potential varies among species, for example, 2 h in mouse, 4 – 5 h in bovine and
rabbit, 1 h in human (Austin 1985) which correlate with sperm cholesterol/phospholipid ratios.
Lesser the cholesterol/phospholipid ratio is associated with lesser time to complete capacitation
(Davis 1981). Essential role of ROS as modulators of capacitation is recognised in human
(Herrero et al. 2006), mouse (Herrero et al. 2003), bovine (O’Flaherty et al. 2006) and boar
(Funahashi 2002) sperm.
1.1.4 Sperm proteomics – the key to identify biomarkers of fertility
Many sperm components, including lipids (Brinsko et al. 2007), ions such as calcium (Collin et
al. 2000), proteins (Bellin et al. 1998, Parent et al. 1999), and nucleic acids (Lalancette et al.
2008) were upregulated or downregulated (depending on fertility status) in various mammalian
species. Since sperm functions are regulated by proteins present in mature sperm, understanding
the role of individual sperm proteins could lead to identification of novel biomarkers of fertility.
For example, content of P25b, a bovine sperm membrane antigen, was lower in semen from
subfertile bulls than in high fertility bulls (Parent et al. 1999). A 30-kDa heparin-binding protein
(fertility-associated antigen, FAA), was differentially expressed in sperm membranes of beef
bulls with varying fertility (Bellin et al. 1998a). Furthermore, Sutovsky (Sutvosky et al. 2015)
![Page 31: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/31.jpg)
7
described positive and negative protein biomarkers of fertility. Negative fertility markers
included proteins exclusively associated with certain types of sperm defects, whereas positive
biomarkers were more abundant in morphologically and functionally normal sperm, except that
they may either be upregulated or downregulated. One of the negative protein biomarkers of
sperm quality is ubiquitin, which has been assessed in numerous species including humans
(Sutovsky et al. 2001), horses (Sutovsky et al. 2003), cattle (Sutovsky et al. 2002), and pigs
(Kuster et al. 2004), and is correlated with infertility and indications of poor sperm quality,
including primary and total morphological defects (Purdy 2008). Since the bovine AI industry
uses elite bulls, such as high- (HF) and low-fertility (LF) bulls (that are 3% above and below the
breed average for fertility, respectively), upregulation or downregulation of specific proteins may
contribute to differences in fertility among these bulls and enable identification of biomarkers of
fertility. Using a 2D-gel electrophoresis-mass spectrometry approach, D’Amours (D'Amours et
al. 2010) reported that T-complex protein 1 subunits ϵ and θ (CCT5 and CCT8), epididymal
sperm-binding protein E12 (ELSPBP1), proteasome subunit α type-6, and binder of sperm 1
(BSP1) were highly expressed in the LF group, whereas adenylate kinase isoenzyme 1 (AK1)
and phosphatidylethanolamine-binding protein 1 (PEBP1) were highly expressed in the HF
group. In a similar approach (Peddinti et al. 2008), HF bull sperm had upregulated expression of
pyruvate kinase, COX3, ATP5B, casein kinase, AKAP4, EGF and PDGF signaling pathways,
whereas integrin and DNA damage check point regulation pathways were significant hits
identified in LF bull sperm. Comparing normal versus abnormal sperm induced by elevated
testicular temperature, Newton (Newton et al. 2009) demonstrated differential expression of
several sperm proteins in morphologically abnormal sperm, including ATP1A4, as the molecular
basis for impaired function.
![Page 32: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/32.jpg)
8
1.1.5 Na/K-ATPase structure and isoforms
It is well established that Na/K-ATPase is a plasma membrane protein with two fundamental
roles in regulation of cell function. First, it is responsible for maintaining Na+
and K+
gradients
across the plasma membrane of most mammalian cells. In that regard, this enzyme contributes to
maintenance of cell volume and pH, resting membrane potential, osmotic balance, and
generation of a Na+ gradient for coupled transmembrane ion transport (Skou and Esmann 1992;
Sweadner 1989). Secondly, it is the receptor for cardiotonic steroids such as ouabain (specific
inhibitor of Na/K-ATPase); in that regard, interaction of ouabain with Na/K-ATPase initiates
signaling critical for regulation of various cell functions. The functional Na/K-ATPase consists
of two subunits, the α subunit (110 kDa) and the β subunit (35-60 kDa, depending on
glycosylation; (Blanco & Mercer 1998). The α polypeptide is the catalytic unit responsible for
ionic translocation as well as ouabain-dependent signaling events (Jorgensen et al. 2003),
whereas the β subunit is essential for the enzyme’s activity, as well as folding and localisation in
the membrane (Geering 1991). There are four α isoforms (α1, α2, α3, and α4) and three β
isoforms (β1, β2, and β3) in mammalian tissues (Blanco & Mercer 1998, Mobasheri et al. 2000).
The α1 and β1 isoforms are expressed in almost every cell (function as housekeeping Na/K-
ATPase), whereas other α polypeptides have a more restricted expression, with specific roles
(Mobasheri et al. 2000).
1.1.6 Ouabain – inhibitor of Na/K-ATPase enzyme activity
Digitalis extract, whose principle component is ouabain, have been used for treatment of cardiac
diseases for centuries. A similar endogeneous compound with digitalis like reactivity was
identified from the adrenal gland (Laredo et al. 1994) and hypothalamus (Dorell et al. 2005).
![Page 33: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/33.jpg)
9
This endogeneous hormone has a specific binding site on the extracellular loops (TM1-TM2,
TM5-TM6, and TM7-TM8) of α subunit of Na/K-ATPase, facilitating a conformational change
in the enzyme which prevents K+ ion binding and its transport (Burns et al. 1996). Dissimilarities
in the amino acid sequences between different species and isoforms underlie the different
sensitivity of Na/K-ATPase to cardiotonic steroids (Blanco et al. 1999, Geering 2005). As an
example, aminoacids 111 to 122 in the extracellular loop between TM1-TM2 form the most
important part of the putative ouabain binding site. In rodents, α1 isoform has a low affinity for
ouabain due to presence of charged amino acids between TM1-TM2 which is not present in the
highly sensitive α2 and α3 isoforms. However in case of humans, little difference exists among
the highly sensitive α1, α2, and α3 isoforms in terms of their ouabain affinity. With regard to the
α4 isoform in rats and mouse, ouabain affinity is in the nM range (Woo et al. 1999) and this
isoform is well conserved among species (Li and Langhans 2015). In the reproductive tract,
ouabain like reactivity was detected in bovine vaginal fluid (Daniel et al. 2010) and therefore we
inferred that the interaction of ouabain with Na/K-ATPase may be involved in regulation of
sperm functions.
1.1.7 Expression and localisation of Na/K-ATPase subunits in the male reproductive tract
ATP1A4 has received considerable attention in recent years due to its sperm-specific expression
along with the ubiquitous α1 isoform (ATP1A1; Blanco et al. 2000). The α1 and α4 subunits are
co-expressed in sperm with the β1 and β3 isoforms; the α4 isoform associates with both β
subunits equally, with similar kinetic properties (Arystarkhova & Sweadner 1997). In addition to
α1, α4, β1, and β3 isoforms, the α3 and β2 subunits were also present in bovine sperm (Hickey &
Buhr 2011). The α4 isoform has high affinity for Na+ but low affinity for K
+, and very high
![Page 34: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/34.jpg)
10
sensitivity to ouabain, in contrast to other isoforms (Woo et al. 1999), with two-thirds of total
Na/K-ATPase activity of sperm attributed to ATP1A4 (Wagoner et al. 2005). Expression of α4
isoform peaked in mature testes in rats (Woo et al. 2000, Wagoner et al. 2005) and humans
(Hlivko et al. 2006), whereas expression of the α1 isoform was constant throughout
spermatogenesis. Within the flagellum, α4 expression was restricted to the mid-piece (rat) and
principal piece (human; (Woo et al. 2000, Hlivko et al. 2006), whereas α1 was present
throughout the flagellum (Wagoner et al. 2005). In our studies with fresh bovine sperm, α4 was
restricted to the head (Thundathil et al. 2006). In the Sertoli cell line 93RS2, isolated from 15-d-
old rats, α4 mRNA was detected, although no evidence of the α4 protein was reported (Konrad et
al. 2011). However, there is contradictory evidence regarding this observation in Sertoli cells. In
that regard, Lucas (Lucas et al. 2012) did not detect ATP1A4 protein from primary Sertoli cell
cultures obtained from 16-d-old rats, whereas McDermott (McDermott et al. 2012) used GFP
instead of the ATP1A4 gene, downstream of the ATP1A4 promoter, and reported that α4
expression was not detected in Sertoli cells from 7- or 18-d-old or adult mice.
1.1.8 Ion transport-dependent functions of Na/K-ATPase in sperm
An isoform of Na/K-ATPase (ATP1A4) dedicated to sperm function suggests that this protein
has a specific role in sperm physiology. Consequently, it was no surprise that sperm from
ATP1A4 KO mice displayed sever reduction of total motility due to a characteristic bend in the
sperm tail and cell membrane depolarization (Jimenez et al. 2011a). Simultaneously, over-
expression of ATP1A4 resulted in plasma membrane hyperpolarization, higher progressive
motility and enhanced hyperactivation, implicating the role of ATP1A4 in sperm motility under
both noncapacitating and capacitating conditions (Jimenez et al. 2011b). In addition, Jimenez
![Page 35: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/35.jpg)
11
(Jimenez et al. 2012) also reported that ATP1A4 activity was upregulated at the plasma
membrane during sperm capacitation. The enzyme activity of ATP1A4 influences sperm motility
due to its indirect role in regulation of pH, membrane potential and intracellular calcium release.
ATP1A4 is not primarily responsible for controlling membrane potential; presumably this
protein is linked to other K+ channels which are involved in depolarization and
hyperpolarization. Consequently, ouabain inhibition of ATP1A4 caused sperm membrane
depolarization (Jimenez et al. 2010). In addition to its role in Na+ and K
+ transport, ATP1A4
indirectly regulates sperm pH by coupling to Na/H-exchanger (NHE), a flagellar protein, that
uses the Na+ gradient established by the Na/K-ATPase to remove H
+ from the cell in exchange
for Na+ (Counillon & Pouyssegur 2000). Therefore, inhibition of Na/K-ATPase eliminates the
Na+ gradient used by the Na/H-exchanger to move H
+ out of the cell. Loss of NHE activity may
lead to acidification of the intracellular compartment, which suppresses movement of dynein and
reduces flagellar movement (Woo et al. 2002). Furthermore, ATP1A4 is also functionally linked
to sperm calcium regulation via a Na/Ca-exchanger (NCX), which uses the secondary Na+ influx
generated by Na/K-ATPase for calcium efflux. Inhibition of Na/K-ATPase increases intracellular
Na+
concentration which disrupts calcium efflux by NCX, thereby increasing intracellular
calcium concentrations (Jimenez et al. 2010a). Accordingly, sperm expresses NCX in the mid-
piece of the flagellum (Krasznai et al. 2006, Bedu-Addo et al. 2008), where ATP1A4 is most
abundant in rat sperm (Woo et al. 2000, Wagoner et al. 2005, Sanchez et al. 2006).
1.1.9 Signaling function of Na/K-ATPase in somatic cells
In addition to pumping ions, Na/K-ATPase functions as a classical receptor, inducing ouabain-
mediated signaling pathways involved in regulation of various physiological processes (Xie
![Page 36: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/36.jpg)
12
2003). Binding of ouabain to Na/K-ATPase causes conformational changes in the enzyme and
allows interactions with neighbouring membrane proteins resulting in activation of Src and
transactivation of the epidermal growth factor receptor (EGFR). Transactivation of EGFR has a
central role in relaying Na/K-ATPase-ouabain signaling to downstream pathways, including
activation of the mitogen activated protein kinase (MAPK) cascade, phospholipase C (PLC) and
protein kinase C (PKC) isozymes, generation of second messengers (e.g. Ca2+
) from intracellular
stores and reactive oxygen species (ROS) from mitochondria (Ullrich & Schlessinger 1990, Haas
et al. 2000, Liu et al. 2000). After ouabain interaction, a signalplex is formed involving Na/K-
ATPase, Src and PLC leading to activation of PLC and increased hydrolysis of
phosphatidylinositol-4, 5-bisphosphate (PIP2), generating inositol 1, 4, 5-triphosphate (IP3) and
diacylglycerol (DAG). In addition, IP3 can activate IP3R, which in turn releases intracellular Ca2+
(Yuan et al. 2005). Furthermore, DAG activates protein kinase C (PKC) and PKC in turn cross
talks with Raf in promoting phosphorylation of ERK1/2 (Mohammadi et al. 2001).
1.1.10 Signaling function of Na/K-ATPase in sperm
Based on known signaling roles of Na/K-ATPase in somatic cells, it is clear that sequelae of
Na/K-ATPase signaling events in somatic cells resemble some events associated with sperm
capacitation, namely increase in intracellular Na+ and Ca
2+ concentrations, generation of ROS,
and activation of ERK1/2. Therefore, we hypothesized that Na/K-ATPase is involved as a
signaling molecule during sperm capacitation and demonstrated that PKA, RTK and Src kinases
were involved in this process (Newton et al. 2010). Under capacitating conditions, ouabain
induced tyrosine phosphorylation and an acrosome reaction in a dose-dependent manner in fresh
bovine sperm (Thundathil et al. 2006). In addition, a recent study implicated the ERK pathway in
![Page 37: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/37.jpg)
13
this process (Anpalakan 2010). Our previous study demonstrated that pre-incubation of bovine
sperm with a PKA inhibitor (H89) inhibited ouabain-induced tyrosine phosphorylation. Perhaps
generation of ROS and increase in intracellular calcium during ouabain signaling activates PKA,
leading to tyrosine phosphorylation. In addition, activated PKA interacts with PKC and activates
phospholipase D (PLD), which subsequently hydrolyses phosphatidyl choline (PC) to
phosphatidic acid (PA), mediating polymerisation of globular (G)-actin to filamentous (F)-actin.
Actin polymerisation is involved in capacitation and acrosome reaction in bovine sperm (Yagi &
Paranko 1995, Cohen et al. 2004). Based on our knowledge of Na/K-ATPase-ouabain interaction
in sperm and in somatic cells, we proposed a model depicting downstream pathways potentially
regulated by ouabain (Figure 1.1; (Thundathil et al. 2012). An intriguing question that remains to
be answered from all of these studies is: How is Na/K-ATPase able to activate several signaling
pathways? Perhaps the receptor could be preassembled with its signaling partners in specific
domains of the plasma membrane known as lipid rafts.
![Page 38: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/38.jpg)
14
Figure 1.1 A proposed model for bovine sperm capacitation mediated by the interaction of
ATP1A4 with its ligand ouabain (adapted from (Thundathil et al. 2012)
1.1.11 Role of lipid rafts in somatic cell signaling events
Membrane lipids are not homogenously distributed in the membrane bilayer; this lipid
heterogeneity gives rise to formation of lipid rafts which are defined as highly dynamic, sterol
and sphingolipid-enriched domains that maintain a certain degree of rigidity and are less fluid
than the surrounding bilayer. Due to their particular composition, lipid rafts are characterised by
their resistance to extraction with non-ionic detergents (e.g. Triton X-100) at low temperature (4
ºC); therefore, they are often termed detergent-resistant membranes (DRM). Subsets of lipid rafts
are designated caveolae, flask-shaped membrane invaginations marked by the protein caveolin.
![Page 39: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/39.jpg)
15
Lipid rafts also concentrate certain signaling molecules while concurrently excluding others
(Helms & Zurzolo 2004, Brown 2006), which facilitates protein-protein interactions, resulting in
activation of downstream signaling cascades (Simons & Toomre 2000, Brown & London 2000).
Studies in somatic cells identified three possible mechanisms by which receptors initiate
signal transduction in rafts (Simons & Toomre 2000). First, receptors that are associated at
steady state with lipid rafts could be activated through ligand binding. Second, receptors with
weak raft affinity could oligomerize on ligand binding, leading to increased residency time in
rafts. Finally, activated receptors could recruit additional proteins that bind to proteins in
neighbouring rafts, leading to raft coalescence. Since cholesterol is a major component of lipid
rafts and sterol efflux is one of the events during capacitation, studies so far have examined
effects of cholesterol efflux on stability (dissociation/coalescence) and distribution of lipid rafts
during sperm capacitation. However, none of the studies were able to attribute signal initiation
arising in rafts leading to capacitation. Taken together, it is likely that a steady pool of ATP1A4
resides in rafts and is activated in response to ouabain, leading to signal transduction that
culminates in sperm capacitation.
1.1.12 Role of lipid rafts during sperm capacitation
Ejaculated bovine sperm plasma membrane display significantly reduced cholesterol and raft
localisation of proteins compared to epididymal sperm. For example, bull cauda epididymal
sperm have proteins associated to rafts (P25b and AK1) and nonrafts domains (aldose reductase
and MIF; Giruouard et al. 2008). When the localization of these proteins is evaluated in post-
ejacuated sperm, P25b and AK1 proteins were excluded from the raft domains. Whereas AK1 is
displaced to nonrafts domains as early as 15 minutes after ejaculation, P25b completes its
![Page 40: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/40.jpg)
16
migration after 30 minutes. These changes were accompanied by a decrease in the cholesterol
content in ejaculated compared with cauda epididymal sperm (Caballero et al. 2011).
Nonetheless, membrane domains analogous to lipid rafts observed in somatic cells have also
been detected in sperm of all mammalian species (Cross 2004, Shadan et al. 2004, Sleight et al.
2005, Bou Khalil et al. 2006, Nixon & Aitken 2009). Furthermore, there seems to be various raft
subtypes in sperm (Asano et al. 2009). Uniform localisation of rafts was identified in non-
capacitated sperm, but rafts were restricted to the anterior acrosome in capacitated sperm,
suggesting that lipid rafts serve as platforms for spatial constraint of molecules involved in zona-
pellucida binding (Shadan et al. 2004, Bou Khalil et al. 2006, Nixon & Aitken 2009).
Additionally, isolated pig sperm rafts were able to bind with high affinity and specificity to
oocytes of homologous species, similar to mechanisms employed by intact sperm and anterior
head plasma membranes (van Gestel et al. 2007). In subsequent proteomic studies, sperm-egg
receptors (IZUMO, ADAM, basigin, ACE, hexokinase, sperm adhesion molecule 1, ZP3
receptor, arylsulfatase A) and chaperones were identified in lipid rafts. Although these studies
demonstrated a role for lipid raft proteins in sperm-oocyte interactions, involvement of raft
proteins in signaling events leading to sperm capacitation has not been reported.
1.1.13 Na/K-ATPase and regulation of post-thaw sperm function
Since ATP1A4 regulates various sperm functions, including motility and capacitation, content
and activity of this protein or its association with lipids in the plasma membrane influence sperm
function and fertility of frozen-thawed sperm. In the bovine artificial insemination (AI) industry,
semen is collected from bulls that are deemed satisfactory breeders (passed a standard BBSE)
and subsequently their frozen-thawed semen is used to impregnate females. It is well known that
![Page 41: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/41.jpg)
17
semen cryopreservation procedures (including dilution, cooling, freezing, and thawing) affect
several sperm structures and functions. One of the primary sites of cryopreservation-induced
damage is the sperm plasma membrane (Bailey et al. 2000). Sperm head and tail membrane
contain several ATPases that tightly regulate movement of several ions responsible for motility
and capacitation in sperm (Zhao & Buhr 1996). There is increasing evidence that there is
reordering of membrane lipids during cooling and rewarming, thereby disturbing the lipid-lipid
and lipid-protein interactions in the membrane (Hammerstedt et al. 1990). Furthermore, ATP1A4
is localised on the bovine sperm head and is extremely sensitive to its lipid environment;
therefore, enzyme function is reduced in sperm that have undergone cryopreservation (Zhao &
Buhr 1996). As mentioned in Section 1.1.7, some of the downstream effectors of Na/K-ATPase
signaling (e.g., ROS generation, intracellular calcium release, and phosphorylation of ERK1/2)
are involved in regulating several sperm functions leading to successful fertilization. Therefore it
is reasonable to assume that ATP1A4 regulates post-thaw sperm function and fertility through
these effectors of ATP1A4 signaling.
In sperm, controlled production of ROS is a physiological process and functions as an
important second messenger in signaling during sperm capacitation. Despite the beneficial role
of ROS in sperm functions, an imbalance between ROS production and antioxidant defense is
detrimental to sperm physiology and can damage all cellular components including lipids,
proteins and DNA (Bansal & Bilaspuri 2010). Sperm are highly susceptible to oxidative attack
due to their high content of PUFA (polyunsaturated fatty acids; mainly localised to
phospholipids of the sperm plasma membrane) and low levels of antioxidant defense systems
(Bansal & Bilaspuri 2010). An attack by ROS usually initiates a lipid peroxidation cascade
leading to a loss of membrane fluidity and integrity, which are responsible for subsequent fusion
![Page 42: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/42.jpg)
18
events leading to successful fertilization (Lovercamp 2009). Apart from membrane effects, ROS
also decreases mitochondrial membrane potential (Lopes et al. 1998, Sanocka & Kurpisz 2004),
and increases chromatin fragmentation by causing single and double DNA breaks (Hughes et al.
1996, Kodama et al. 1997), thereby interfering with sperm fertilizing ability and embryo
development (Aitken & Krausz 2001). Cryopreservation also increases sperm sensitivity to ROS
attack by decreasing superoxide dismutase and glutathione peroxidase activity, two major
enzymes involved in antioxidant defense in bovine sperm (Bilodeau et al. 2000). Presumably due
to these adverse effects, increased production of ROS was linked to poor fertility of frozen-
thawed semen (Simoes et al. 2013, Del Olmo et al. 2014).
Apart from ROS production, yet another downstream process that occurs due to Na/K-
ATPase-ouabain interaction is polymerisation of G-actin to F-actin. Cryopreservation causes
extreme temperature fluctuations and osmotic stress in sperm, resulting in sublethal and lethal
damage to cells. In sperm, the major cytoskeletal network is present in the sperm head, especially
surrounding the nucleus (perinuclear theca) and an intact cytoskeleton is required for maintaining
normal cell shape, coordinated motility (Hall 1998) and appropriate cell volume regulation after
freezing and thawing. However, in response to osmotic stress, the actin network undergoes
reorganization via rapid activation of MAPK cascade, a phenomenon described from yeast to
mammals (de Nadal et al. 2002). Furthermore, β-dystrobrevin, a perinuclear protein, was
reduced in cryopreserved sperm due to depolymerization of F-actin network (Felipe-Perez et al.
2012) compared to fresh sperm. Aside from cell volume regulation, actin polymerisation
(conversion to G-actin to F-actin) and depolymerisation (conversion of F-actin back to G-actin)
are crucial for capacitation and acrosome reaction, respectively (Brener et al. 2003, Breitbart et
al. 2005).
![Page 43: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/43.jpg)
19
Apart from ultra-low temperatures that occur during freezing, events such as increase in
intracellular calcium concentration could depolymerise actin filaments (Hall et al. 1993).
Cryopreserved sperm had greater intracellular calcium concentration compared to fresh sperm
(Bailey & Buhr 1993). Restructured membranes and distorted lipid-protein associations were
believed to favour calcium ion influx (Lemma 2011) and frozen-thawed sperm fail to regulate
normal internal calcium concentration (Plummer & Watson 1985). Such abnormal
concentrations of calcium would disrupt normal capacitation and/or the acrosome reaction and
consequently viability of sperm in the female reproductive tract, which would severely
compromise fertilizing potential of post-thaw sperm (Valcarcel et al. 1994). Accordingly, frozen-
thawed sperm from HF bulls contain lower Ca2+
concentrations than their LF counterparts
(Collin et al. 2000, Peris 2008). However, the molecular basis of generation/differential
regulation of these molecules (ROS, F-actin and calcium) remains unknown. Consequently
comparing sperm from bulls with varying levels of fertility, such as HF and LF bulls, may
identify these submicroscopic differences (for example, up- or down-regulation of specific
proteins, specifically ATP1A4 content and activity) and yield molecular markers of fertility.
1.1.14 Role of Na/K-ATPase in formation and function of epithelial cell tight junctions (TJs)
Tight junctions are unique structures, present in polarised epithelial and endothelial cells that
regulate flows of ions and solutes and whose functions are regulated by several signaling and
molecular mechanisms. Several studies reported that the ubiquitous isoform of Na/K-ATPase (α1
isoform, ATP1A1) modulates TJ development, permeability and polarity in mammals,
drosophila and zebrafish. Pumping activity of various subunits of Na/K-ATPase has a role in
organization and permeability of TJs. Exogenous expression of the β subunit of Na/K-ATPase
![Page 44: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/44.jpg)
20
and E-cadherin allowed MSV-MDCK cells to display epithelial phenotype with functional TJs,
suggesting that these two proteins function synergistically in TJ assembly and function
(Rajasekaran et al. 2001). Following Na/K-ATPase inhibition, RhoA GTPase, which has been
implicated in regulation of TJs through actin formation, was also inhibited, whereas
overexpression of RhoA GTPase significantly reduced the effect of Na/K-ATPase inhibition on
TJ assembly, thereby indicating that RhoA is a key molecule functionally coupled with Na/K-
ATPase (Rajasekaran et al. 2001). Therefore, function of Na/K-ATPase is necessary, not only
for formation of TJs, but also to maintain their function and structure. Inhibition of Na/K-
ATPase function in retinal pigment and in pancreatic polarised cell lines demonstrated that
membrane contact points were reduced between cells and increased permeability to both ionic
and non-ionic molecules (Rajasekaran & Rajasekaran 2003, Rajasekaran et al. 2007). In
addition, inhibition of Na/K-ATPase reduced protein phosphatase 2 (PP2A) activity, which
increased phosphorylation of occludin and TJ permeability (Rajasekaran et al. 2007).
Since Sertoli cells, the supporting cells of the testis, form junctional complexes during
puberty, it is likely that Na/K-ATPase isoforms are involved in a role similar to that detected in
non-testicular epithelial cells. However, unlike in somatic epithelial cells where the α1 isoform is
present, Sertoli cell line 93RS2 has α4, the sperm-specific isoform. Three independent studies
led by Scheiner-Bobis demonstrated that low doses of ouabain activated c-Src-Ras-ERK1/2-
CREB pathway similar to non-classical testosterone signaling (Konrad et al. 2011). Furthermore,
this pathway increased expression of steroidogenic acute regulator protein (StAR), a key enzyme
involved in steroidogenesis (Dietze et al. 2013) and claudin 1 and 11 which are involved in BTB
maintenance (Dietze et al. 2015). In all these studies, only the mRNA corresponding to ATP1A4
was detected, but there was no conclusive demonstration of ATP1A4 protein in Sertoli cell lines.
![Page 45: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/45.jpg)
21
Furthermore, there was no consensus among studies regarding the existence of this isoform in
Sertoli cells. Therefore, the final objective of my thesis was to resolve controversies regarding
the existence of Na/K-ATPase isoforms in Sertoli cells and subsequently to investigate the role
of these isoforms in formation and function of Sertoli cell junctions.
1.2 Aims, hypotheses, objectives and outcomes
The overall goal of this thesis was to investigate roles of ATP1A4 and ATP1A1 isoforms of
Na/K-ATPase in sperm and Sertoli cell function, respectively. Specific hypotheses, objectives
and key outcomes of these studies are summarised below:
In Chapter 2, I used a candidate protein approach to investigate relative distribution of a cohort
of known signaling molecules (Src, EGFR, ERK1/2, and caveolin-1) in raft and non-raft
membrane fractions and their activation during ouabain induced sperm capacitation.
Hypothesis: Studies described under Chapters 2 and 3 are based on the hypothesis that raft and
non-raft pools of ATP1A4 exist in sperm membrane, which activate specific signaling pathways
involved in bovine sperm capacitation.
Objectives:
a) To determine relative content of ATP1A4, and total and phosphorylated forms of a cohort
of signaling molecules (Src, EGFR, ERK1/2, and caveolin-1) in raft and non-raft
membrane fractions prepared from uncapacitated and capacitated sperm.
b) To identify ATP1A4 interaction with caveolin-1, Src, EGFR, and ERK1/2 in rafts and
non-raft membrane fractions during sperm capacitation.
![Page 46: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/46.jpg)
22
Outcomes:
a) I identified raft- and non-raft pools of ATP1A4 in bovine sperm plasma membrane.
b) The ATP1A4-caveolin-1-EGFR pathway was restricted to rafts, whereas the ATP1A4-
Src-EGFR-ERK1/2 pathway occurred in non-rafts, indicating that these two distinct
pools of ATP1A4 were involved in activation of specific signaling pathways leading to
bovine sperm capacitation.
In Chapter 3, I used a discovery-based approach to identify novel signaling partners for
ATP1A4 in raft and non-raft membrane fractions.
Objectives:
a) To identify novel signaling partners for ATP1A4 in rafts and non-raft membrane
fractions during capacitation by immunoprecipitation mass spectrometry approach.
Outcomes:
a) Comprehensive proteomic analysis revealed that each of the interacting partners of
ATP1A4 were distributed in the non-raft, raft- or both membrane fractions (64, 18 and
18%, respectively) of capacitated sperm.
b) Gene ontology revealed that the ATP1A4 interactome comprised of proteins involved in
sperm-oocyte interactions, metabolism, chaperones, proteases, and functioned as
cytoskeletal and adaptor proteins.
c) ATP1A4 co-localised with plakoglobin in the equatorial segment of the sperm head
during capacitation.
![Page 47: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/47.jpg)
23
Studies described under Chapter 2 consistently demonstrated a capacitation-associated increase
in content of raft- and non-raft pools of ATP1A4. Therefore, in Chapter 4, I investigated
mechanisms leading to capacitation-associated increase in ATP1A4 content.
Hypothesis: ATP1A4 synthesis during sperm capacitation occurs through translation of mRNA
in mitochondrial or mitochondrial-type ribosomes.
Objectives:
a) To demonstrate the increase in the content of functionally active ATP1A4 molecules
during sperm capacitation.
b) To evaluate roles of transcription and translation in ATP1A4 synthesis during
capacitation.
Outcomes:
a) Increase in ATP1A4 content during capacitation was attributed to mitochondrial
translation of ATP1A4 mRNA present in ejaculated sperm, rather than due to gene
transcription or protein translocation.
Manuscript: Cell and Tissue Research (CTR-16-0178) – under peer review
In Chapter 5, I developed a flow cytometry-based assay for quantification of ATP1A4 content
and validated a colorimetric assay for quantification of ATP1A4 enzyme activity in bull sperm.
In Chapter 6, I investgated the relationship between ATP1A4 content and enzyme activity to
field fertility of dairy bulls.
Hypothesis: Dairy bulls designated as satisfactory based on a standard BBSE differ in their
content and activity of ATP1A4, modulating sperm function and fertility.
![Page 48: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/48.jpg)
24
Objectives:
a) To compare ATP1A4 content, activity and measure sperm functional parameters such as
ROS, calcium, actin polymerization (indicated by F-actin content) and tyrosine
phosphorylation in low-fertility (LF) vs high-fertility (HF) bull sperm.
b) To compare ATP1A4-mediated regulation of ROS, calcium, actin polymerization and
tyrosine phosphorylation in LF and HF bull sperm.
c) To determine associations among fertility, ATP1A4 content, activity, and ATP1A4
induced ROS, calcium, and actin polymerization in LF and HF bulls.
Outcomes:
a) Frozen-thawed sperm from HF bulls had increased ATP1A4 content and activity
compared to LF bulls.
b) Exposure of sperm to ouabain augmented the post-thaw increase in tyrosine
phosphorylation, ROS production, and F-actin content in HF bulls, whereas the increase
in intracellular calcium was low compared to LF bull sperm.
c) Content and activity of ATP1A4, ATP1A4 induced ROS production, and contents of F-
actin and calcium were significantly correlated with fertility.
In Chapter 7, I evaluated prepubertal rat Sertoli cell primary cultures for expression of Na/K-
ATPase isoforms and Na/K-ATPase-mediated regulation of junctional proteins
Hypothesis: Na/K-ATPase regulates formation and function of junctional complexes between
Sertoli cells.
![Page 49: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/49.jpg)
25
Objectives:
a) To establish Sertoli cell cultures in Matrigel-coated bicameral units and measure
transepithelial electric resistance (TER).
b) To characterise Na/K-ATPase isoforms in prepubertal rat Sertoli cell cultures.
c) To assess dose-dependent effects of ouabain on TER and the content and localisation
patterns of junctional proteins.
d) To identify ouabain-mediated signaling pathways involved in regulation of junctional
molecules in Sertoli cells.
Outcomes:
a) Prepubertal Sertoli cell cultures predominantly expressed the ubiquitous isoform
(α1) of Na/K-ATPase (ATP1A1).
b) A non-inhibitory dose (50 nM) of ouabain (specific inhibitor/ligand of ATP1A1)
increased TER, claudin 11 and connexin 43 expression, whereas an inhibitory dose (1
mM) decreased TER and expression of junctional molecules.
c) Na/K-ATPase-ouabain interaction regulated formation and function of Sertoli cell tight
and gap junctions through the Src-EGFR-ERK1/2-CREB pathway.
Manuscript: Biology of Reproduction (BIOLREPROD/2016/141267) – under peer review
![Page 50: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/50.jpg)
26
Chapter Two: Testis-specific isoform of Na/K-ATPase (ATP1A4) regulates bovine sperm
capacitation through raft and non-raft mediated signaling
2.1 Abstract
Sperm plasma membrane consists of highly dynamic lipid microdomains (rafts), which harbour a
cohort of signaling proteins involved in the regulation of sperm capacitation. Testis-specific
isoform of Na/K-ATPase (ATP1A4) is a highly abundant protein present in the plasma
membrane of bovine sperm head. We previously demonstrated that incubation of bovine sperm
with ouabain induces tyrosine phosphorylation of several sperm proteins and capacitation. The
aim of this study was to investigate the role of membrane rafts in ATP1A4 signaling during
bovine sperm capacitation. Rafts and non-raft fractions were prepared from uncapacitated and
capacitated sperm and assessed for signaling functions of ATP1A4. There was a comparative
increase in phosphorylation of signaling molecules both in rafts (caveolin-1) and non-rafts
(EGFR and ERK1/2) during capacitation. Although Src was activated in both membrane
fractions, the non-raft fraction had higher content of p-Src. Subsequent immunoprecipitation
studies suggested that interaction of ATP1A4 with Src, EGFR and ERK1/2 occurred in the non-
raft fraction whereas interaction with caveolin-1 and EGFR were evident in the raft fraction of
ouabain-capacitated sperm. Overall, we inferred that the ATP1A4-caveolin-1-EGFR pathway
was restricted to rafts, whereas the ATP1A4-Src-EGFR-ERK1/2 pathway occurred in non-rafts,
indicating that these two distinct pools of ATP1A4 were involved in specific signaling events
leading to bovine sperm capacitation.
![Page 51: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/51.jpg)
27
2.2 Introduction
Ejaculated sperm must remain in the female reproductive tract for a species-dependent interval to
attain fertilizing ability; these maturational changes are collectively known as sperm capacitation
(Yanagimachi 1994). Numerous physiological events have been implicated in capacitation,
including a sterol efflux and a subsequent increase in membrane fluidity, membrane
hyperpolarization, generation of reactive oxygen species (ROS), increased concentrations of
calcium and cAMP, protein tyrosine phosphorylation, elevated intracellular pH, remodelling of
actin, and hyperactivated motility (Salicioni et al. 2007). These capacitation-associated changes
were attributed to changes in the intracellular ionic environment and initiation of several
signaling cascades. However, specific roles of individual sperm proteins in regulation of sperm
capacitation are not well characterized. Although ATP1A4, is involved in regulation of sperm
motility (Jimenez et al. 2011a, Jimenez et al. 2011b) and capacitation (Thundathil et al. 2006,
Newton et al. 2010), underlying molecular mechanisms have not been clearly elucidated.
Functional Na/K-ATPase, a heterodimer of α and β subunits, is responsible for
maintenance of Na+ and K
+ gradients between the cell and its environment. In mammalian cells,
Na/K-ATPase is expressed as various isozymes, depending on the association of the four
isoforms of the α subunit (α1, α2, α3, and α4) and three β isoforms (β1, β2, and β3) which are
specific to various cell types and appear to regulate specific functions, depending on the
physiological needs of the cell (Blanco & Mercer 1998, Mobasheri et al. 2000). In sperm, α1 and
α4 subunits are co-expressed with the β1 and β3 isoforms, although the α4 isoform associates
with both β subunits equally, with similar kinetic properties (Arystarkhova & Sweadner 1997).
Moreover, 75% of total Na/K-ATPase activity of sperm is attributed to the α4 isoform
(ATP1A4), whereas the remainder (25%) is contributed by the ubiquitous α1 isoform (Wagoner
![Page 52: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/52.jpg)
28
et al. 2005). Testis-specific expression of ATP1A4 suggests this protein is critical for regulation
of sperm function. In that regard, knockout of ATP1A4 severely reduced total sperm motility,
due to a characteristic bend in the sperm tail and cell membrane depolarization (Jimenez et al.
2011a). Furthermore, over-expression of ATP1A4 resulted in plasma membrane
hyperpolarization, higher progressive motility and hyperactivation, implicating the ATP1A4
isoform in sperm motility (Jimenez et al. 2011).
In addition to its role as an ion transporter, Na/K-ATPase binds cardiac glycosides such
as ouabain, which inhibits its enzyme activity (Schwartz et al. 1988, Aperia 2007) and induces
conformational changes in this protein, leading to initiation of several downstream signaling
pathways critical for various cellular functions (Li & Xie 2009). Majority of Na/K-ATPase
resides in specialized microdomains of membrane phospholipid bilayer called lipid rafts or
caveolae, which may facilitate its signaling function, due to proximity to other signaling
molecules within these microdomains (Liu et al. 2003, Liang et al. 2007). Caveolae are a
subpopulation of rafts made up of ~25 kDa protein named caveolin (Patel & Insel 2009, Lajoie
& Nabi 2010). Rafts and caveolae are enriched in cholesterol and sphingolipids, which maintain
a certain degree of rigidity and are less fluidic compared to the remainder (non-raft) of the
plasma membrane. Domains analogous to membrane rafts in somatic cells have been detected in
mammalian sperm (Cross 2004, Shadan et al. 2004, Sleight et al. 2005, Bou Khalil et al. 2006,
Nixon & Aitken 2009); apparently, there are several raft subtypes in sperm (Asano et al. 2009) .
Although previous studies demonstrated a role for lipid raft proteins in sperm-oocyte interaction
(van Gestel et al. 2005, Bou Khalil et al. 2006, van Gestel et al. 2007), involvement of raft
proteins in signaling events leading to sperm capacitation has apparently not been reported.
![Page 53: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/53.jpg)
29
We previously reported that incubation of bovine sperm with ouabain induced tyrosine
phosphorylation and capacitation through a mechanism involving receptor tyrosine kinases, non-
receptor tyrosine kinases, protein kinases A and C (PKA and PKC; (Newton et al. 2010). In
addition, another study in bovine sperm implicated the ERK1/2 pathway in this process
(Anpalakan 2010). However, mechanisms by which Na/K-ATPase orchestrates these signaling
pathways remain unknown. We hypothesized that raft and non-raft pools of ATP1A4 exist in
sperm membrane, which activate specific signaling pathways involved in bovine sperm
capacitation. The overall objective of this study was to investigate involvement of lipid rafts in
ATP1A4 signaling during bovine sperm capacitation.
2.3 Materials and methods
2.3.1 Semen processing and capacitation
Fresh semen was collected (artificial vagina), from mature Holstein bulls, immediately diluted
1:1 with TALPH (Galantino Homer et al.1997) and maintained at 35 °C (in a thermos) during
transportation to the laboratory. Semen was subjected to a percoll wash on a two-layer percoll
gradient (45% – 90%) by centrifugation (700 × g, 30 min, 25 °C). The resulting sperm pellet was
re-suspended in Sp-TALP and washed to remove percoll (380 × g, 10 min, 25 °C). Concentration
of the resulting sperm pellet was determined using a hemocytometer and adjusted to 200 × 106
sperm/ml with Sp-TALP. Stock solutions of ouabain (100 µM) and heparin (1 mg/ml) were
prepared in Sp-TALP and stored at 4 °C. Working solutions of ouabain (50 nM) and heparin (10
µg/ml) were prepared in complete Sp-TALP medium (Sp-TALP containing 1 mM pyruvate, 25
mM NaHCO3, 2 mM Ca2+
) on the day of use. A combination of heparin, IBMX and dbcAMP
was included as one of the study groups, as it is a known combination of agents that induces
![Page 54: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/54.jpg)
30
capacitation in bovine sperm. This group served as the positive control of capacitation and also
helped to detect similarities or differences with regard to the ATP1A4 signaling function under
various capacitating conditions. Stock solutions of IBMX (10 mM in dimethyl sulfoxide) and
dbcAMP (100 mM in Milli-Q water) were prepared and stored at – 20 °C. This experimental
design included two incubation controls: fresh uncapacitated sperm (designated as control 0 h)
and sperm incubated in Sp-TALP for 4 h (control 4 h). The ouabain and heparin (combination of
heparin + IBMX + dbcAMP) groups were also incubated in the Sp-TALP medium for 4 h at 39
°C under high humidity. After confirming capacitation status by evaluating changes in sperm
motility patterns and phosphotyrosine content (described below), these sperm preparations were
used for isolation of raft and non-raft membrane fractions (described below).
2.3.2 Isolation of raft and non-raft membrane fractions
Nondetergent-based lysis buffer was used for preparation of raft and non-raft membrane
fractions from uncapacitated and capacitated samples, as described (Liu & Askari 2006).
Nondetergent lysis buffer consisted of 0.5 M Na2CO3 (pH 11), 1 mM EDTA, 1 mM Na3VO4, 1
mM NaF, and a cocktail of protease inhibitors (Roche, Laval, QC, Canada). Sperm (1 x 109)
were lysed in pre-chilled (4 °C) lysis buffer followed by homogenization using a sonicator, and
sperm preparations were maintained on ice for 30 min. After pelleting by centrifugation (1000 x
g, 5 min), the supernatant was mixed with an equal volume of 80% sucrose (w/v) in MBS buffer
(25 mM MES, 150 mM NaCl, pH 6.5). This suspension was placed at the bottom of the tube and
overlaid with 35% sucrose, with 5% sucrose added on the top. Thereafter, samples were
centrifuged at 110,000 x g for 12 h at 4 °C (SW 41 Ti rotor, Beckman Coulter Inc., Brea, CA,
USA). The raft fraction was floating as an opalescent band at the 30% – 5% sucrose interface,
![Page 55: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/55.jpg)
31
whereas non-raft fraction sedimented at the bottom of the tube. Both raft and non-raft fractions
were ultra-centrifuged again in a TLA 100.3 rotor (Beckman Coulter Inc.) for 1 h at 189,000 x g
to remove the contaminating sucrose and the pelleted fractions were used for subsequent
analyses.
2.3.3 ATP1A4 content, distribution of raft and non-raft markers, fatty acid profiles, and
morphology of membrane vesicles in raft- and non-raft membrane fractions prepared from
uncapacitated sperm
2.3.3.1 ATP1A4 content and distribution of raft and non-raft markers in the membrane
fractions
Raft and non-raft protein preparations were electrophoresced on SDS-PAGE gels and
immunoblotted with ATP1A4, caveolin-1, GM-1 and α-tubulin antibodies (detailed in Section
2.3.7 of this chapter).
2.3.3.2 Fatty acid analysis
Fatty acid analysis of raft and non-raft fractions was performed at Lipid Analytical Laboratories,
University of Guelph, Guelph, ON, Canada. Total lipids were extracted from both raft and non-
raft fractions using the Bligh and Dyer method, with diheptadecanoyl phosphatidyl choline as the
internal standard (BLIGH & DYER 1959). Fatty acid methyl esters were prepared using boron
trichloride in methanol and heating the methylation tubes in a boiling water bath. The resulting
fatty acid methyl esters were analyzed on a Varian 3400 gas-liquid chromatograph (Varian, Palo
Alto, CA, USA) with a 60-m DB-23 capillary column (0.32 mm internal diameter).
![Page 56: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/56.jpg)
32
2.3.3.3 Transmission electron microscopy
Pellets from raft and non-raft fractions were resuspended in PBS on ice and aliquots from both
fractions were placed on a dish and formvar/carbon coated 300-mesh copper grids were allowed
to float on the droplets for 5 min. Subsequently, grids were stained with 1% phosphotungstic
acid for 5 min and then examined with a transmission electron microscopy (Tecnai F20, FEI,
Hillsboro, OR, USA; Microscopy and Imaging Facility, University of Calgary).
2.3.4 Confirmation of capacitation status of sperm based on sperm motility patterns and
phosphoprotein content
Sperm motility was evaluated with a computer assisted sperm analyzer (CASA; Sperm Vision,
Minitube, Ingersoll, ON, Canada). An aliquot of the sample was loaded into a prewarmed (37
°C) Leija slide and seven fields per sample was analysed using the bovine sperm motility
program. Hyperactivation during capacitation was defined by the following kinematic
parameters: Amplitude of lateral head displacement (ALH) > 7 µm, linearity (LIN) < 0.65 and
curvilinear velocity (VCL) > 80 µm. For evaluation of tyrosine phosphorylation, sperm were
concentrated (10,000 × g, 3 min, RT) and the pellet washed (10,000 × g, 5 min) in 1 ml of PBS
containing 0.2 mM Na2VO3. The pellet was boiled in sample buffer for 5 min at 100 °C and the
supernatant used for SDS-PAGE and immunoblotting (explained in Section 2.3.7).
2.3.5 Capacitation associated changes in the total protein and cholesterol content in raft and
non-raft sperm membrane fractions
Total protein concentration in both fractions were quantified using a DC protein assay
![Page 57: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/57.jpg)
33
(Bio-Rad, Mississauga, ON, Canada) and cholesterol was estimated using an Amplex Red
cholesterol kit (Invitrogen, Burlington, ON, Canada) as per the manufacturer’s instructions.
Briefly, cholesterol and its esters present in the raft and non-raft fractions were hydrolysed by
cholesterol esterase and subsequently oxidised by cholesterol oxidase to yield H2O2. In the
presence of horseradish peroxidase, the amplex red reagent reacts with H2O2 to form resorufin
which was detected spectroflourometrically at excitation and emission wavelengths of 585 and
571 nm, respectively.
2.3.6 Immunoprecipitation
Pelleted raft and non-raft fractions isolated from uncapacitated and capacitated sperm were lysed
with ice-cold lysis buffer containing 150 mM NaCl, 10 mM Tris·HCl (pH 8.0), 1% Triton X-
100, 60 mM octylglucoside, 1X protease inhibitor cocktail, 1 mM NaF, 1 mM Na3Vo4 for 30 min
on ice. The supernatant obtained by high-speed centrifugation (16,000 g for 15 min at 4 °C) was
precleared with protein A beads for 30 min at 4 °C on a rocker. Precleared supernatants from raft
and non-raft fractions of uncapacitated and capacitated groups were incubated with protein-A
beads conjugated with ATP1A4 antibody (3 µg/ml) for 12 h at 4 °C on a rocker. After
incubation, beads containing the antibody-antigen and its interacting partners of interest were
pelleted by slow speed centrifugation (500 g for 1 min at 4°C). Beads were washed 3X with PBS
containing 0.1% Tween-20 and proteins bound to the collected beads were eluted by boiling in
sample buffer at 95 °C for 5 min. The eluted supernatant was subjected to SDS-PAGE and
probed with appropriate antibodies (as indicated in Section 2.3.7).
![Page 58: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/58.jpg)
34
2.3.7 Immunoblotting
Sperm proteins were separated on 10% SDS-PAGE gels and electrotransferred to nitrocellulose
membranes. After blocking with 5% (w/v) skim milk in Tris buffered saline containing Tween-
20 (TTBS) for 1 h, membranes were incubated with the respective antibodies overnight at 4 °C.
We used the following antibodies: GM-1 (1:500); phosphotyrosine (1:10,000; Millipore,
Billerica, MA, USA); p-caveolin-1 (1:500; Santa Cruz Biotechnology, Santa Cruz, CA, USA); p-
Src (1:2500; Abcam, Toronto, ON, Canada); p-ERK1/2 (1:500; Cell Signaling Technology,
Boston, MA, USA); p-EGFR (1:500; Cell Signaling Technology); affinity-purified ATP1A4
(1:10,000; custom made at the University of Calgary); caveolin-1 (1:1000; Cell Signaling
Technology); Src (1:2500; Millipore); ERK1/2 (1:2500; Sigma Aldrich, Oakville, ON, Canada)
and EGFR (1:1000; Santa Cruz Biotechnology). Membranes were washed three times in TTBS
for 10 min and subsequently incubated with either HRP conjugated goat anti-rabbit or anti-
mouse IgG for 1 h at RT. For immunoprecipitation studies, protein A HRP secondary antibody
(1:10,000; Millipore), which binds to the intact IgG molecule and not to the denatured heavy and
light chains of the antibody was used. Following washing, immunoreactive bands were detected
using chemiluminescence. Membranes were stripped and probed with antibodies corresponding
to total proteins or β-tubulin to ensure equal protein loading.
2.3.8 Statistical analyses
Data were analyzed with GraphPad software (GraphPad Software Inc, La Jolla, CA, USA).
Results are shown as mean ± SEM of the number of samples indicated in each case. Results from
the raft and non-raft fatty acid analysis (uncapacitated sperm), total protein, total cholesterol
(uncapacitated and capacitated sperm), and phosphorylation of signaling molecules from raft and
![Page 59: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/59.jpg)
35
non-raft fractions were analysed using repeated-measures ANOVA, followed by Tukey’s
multiple comparison post-hoc test. Differences in sperm kinematic parameters among the control
and capacitated groups were analysed by one-way ANOVA, followed by Tukey’s post-hoc test.
For all analyses, P < 0.05 was considered significant.
2.4 Results
2.4.1 ATP1A4 content, distribution of raft and non-raft markers, fatty acid profile, and
morphology of membrane vesicles in the raft- and non-raft membrane fractions prepared from
uncapacitated sperm
Using a non-detergent method, we determined that both ATP1A4 and caveolin-1 (Figure 2.1A;
upper and bottom panels, respectively) were distributed in both raft and non-raft fractions.
Caveolin-1 was traditionally considered a raft marker, but due to its presence in the non-raft
fraction, another raft marker, ganglioside M1 (GM-1; Figure 2.1B) was used to confirm purity of
the fractions. Results demonstrated that this protein was predominantly present in the raft
fraction; multiple bands indicated the presence of several GM-1 binding proteins in sperm. A
non-raft marker (α-tubulin; Figure 2.1C) was detected mostly in the non-raft fraction, thereby
confirming effective separation of raft and non-raft membrane fractions. Consistent with
properties of lipid rafts (Simons & Toomre 2000), the content of saturated fatty acids was higher
in the raft fraction, in contrast to the content of polyunsaturated fatty acids, which was higher in
non-raft fractions (Figure 2.1D). Morphologically, the raft fraction had significantly larger
vesicles with a mean diameter of 68.40 ± 21.41 nm (range: 10 – 110) in comparison to the non-
raft fraction, which had smaller vesicles (mean diameter 23.89 ± 12.46 nm; range: 9 - 66). In
![Page 60: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/60.jpg)
36
addition, vesicle morphology appeared to be relatively homogeneous in the raft fraction
compared to the non-raft fraction, which had vesicles of varying sizes (Figure 2.1E and F).
Figure 2.1 ATP1A4 content, distribution of raft and non-raft markers, fatty acid profiles,
and morphology of membrane vesicles in raft- and non-raft membrane fractions prepared
from uncapacitated sperm. (A) Exposure of sperm to a non-detergent (sodium bicarbonate)
![Page 61: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/61.jpg)
37
extraction buffer and subsequent immunoblotting of raft and non-raft fractions with anti-
caveolin-1 (lower panel) and anti-ATP1A4 antibody (upper panel). The image was consolidated
by removing the middle lane of the western blot (indicated by dividing line). (B) Distribution of
GM1 (raft marker) binding proteins (indicated by black solid arrows) in raft and non-raft
membrane fractions of uncapacitated bovine sperm. (C) Distribution of α-tubulin (non-raft
marker) in raft and non-raft fractions of uncapacitated bovine sperm. (D) Fatty acid profile was
characterised using gas liquid chromatography and results were shown as percentage fatty acids.
(E) Raft and (F) non-raft fractions were negatively stained and visualised using transmission
electron microscopy. All data were expressed as mean ± SEM (n = 5). SFA and PUFA denote
saturated fatty acids and polyunsaturated fatty acids, respectively. a-c
Values without a common
letter differed (P < 0.05).
2.4.2 Characterization of capacitation status of sperm based on sperm motility patterns and
phosphoprotein content
The percentage of total or progressively motile sperm was not different between ouabain- and
heparin-capacitated groups. However, percentage of sperm undergoing hyperactivation, as
evidenced by increased ALH and VCL and decreased linearity (Figure 2.2A) were higher in
these groups compared to the incubation control at 4 h. A cohort of sperm proteins were also
tyrosine phosphorylated in these capacitated groups compared to the incubation control 4 h
(Figure 2.2B).
![Page 62: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/62.jpg)
38
![Page 63: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/63.jpg)
39
Figure 2.2. Characterization of sperm capacitation status based on sperm motility patterns
and phosphoprotein content. (A) Motility parameters (total and progressive motility) were
recorded using CASA and hyperactivation was monitored by three kinematic values including
ALH, VCL, and LIN under control and capacitating conditions (ouabain, heparin) for 4 h. (B)
For evaluation of tyrosine phosphorylation, total sperm homogenates were immunoblotted with
anti-phosphotyrosine antibody (upper panel; indicated by black solid arrows) and reprobed with
β-tubulin (lower panel) for equal protein loading. Data shown were expressed as mean ± SEM (n
= 5). a,b
Values without a common letter differed (P < 0.05).
2.4.3 Capacitation associated changes in the content of total protein, cholesterol in raft and
non-raft sperm membrane fractions
Overall, cholesterol content of raft membrane fractions from all the groups were higher than that
of non-raft membrane fractions. Although treatments did not affect cholesterol content of raft
![Page 64: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/64.jpg)
40
fractions, cholesterol content of non-raft fractions from control 4 h and capacitated groups were
lower than that of control 0 h (uncapacitated group; Figure 2.3A). Total protein content of raft
fractions was lower than that of corresponding non-raft fractions among the groups (Figure
2.3B). Overall, there was no effect of capacitation on total protein content in these fractions.
Figure 2.3. Quantification of total protein and cholesterol content from raft and non-raft
membrane fractions obtained from uncapacitated and capacitated bovine sperm. (A) Total
cholesterol and (B) total protein were quantified using commercial kits and expressed as
units/109 sperm from uncapacitated and various capacitated groups. All data were expressed as
mean ± SEM (n = 5). a-b
Values without a common letter differed (P < 0.05).
![Page 65: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/65.jpg)
41
2.4.4 Signaling function of ATP1A4 under ouabain-induced capacitating conditions
Content of phosphorylated caveolin-1 (p-cav-1) was significantly higher in the raft fraction
compared to the non-raft fractions of capacitated sperm (Figure 2.4). In contrast, content of p-
ERK1/2 and p-EGFR were higher in non-rafts in comparison to raft membrane fractions of
capacitated sperm (Figure 2.5 and Figure 2.6). Moreover, phosphorylated forms of these
molecules were higher in ouabain- versus heparin-capacitated sperm. Although p-Src was
detected in raft and non-raft fractions, ouabain-capacitated sperm had higher p-Src content in
relation to its heparin counterpart in the raft fraction. However, content of p-Src was higher in
non-raft fractions prepared from these capacitated groups compared to raft fraction (Figure 2.7).
Although raft-and non-raft preparations from control 4 h sperm had phosphorylated signaling
molecules, their content was lower than that of ouabain- and heparin-capacitated sperm. Since
there was differences in the content of unphosphorylated forms of signaling molecules across the
treatment groups, content of each phosphorylated signaling molecules were normalized to its
total (unphosphorylated) protein content.
![Page 66: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/66.jpg)
42
Figure 2.4. Effect of capacitating conditions on caveolin-1 phosphorylation in raft and non-
raft membrane fractions. (A) Representative western blot showing activation (phosphorylation)
of caveolin-1 under ouabain- or heparin-induced capacitating conditions (consolidated images
indicated by dividing lines; left panel). Membranes were stripped and probed with their
respective antibodies for total protein to normalise the data (right panel). (B) Relative pixel
intensity was calculated by normalising pixel intensity of phosphorylated protein to the pixel
value of their corresponding total protein. Data shown were expressed as mean ± SEM (n = 3). a-
fValues without a common letter differed (P < 0.05).
![Page 67: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/67.jpg)
43
Figure 2.5 Effect of capacitating conditions on ERK1/2 phosphorylation in non-raft
membrane fractions. (A) Representative western blot showing activation (phosphorylation) of
ERK1/2 under ouabain- or heparin-induced capacitating conditions (consolidated images
indicated by dividing lines; left panel). Membranes were stripped and probed with their
respective antibodies for total protein to normalise the data (right panel). (B) The relative pixel
intensity was calculated by normalising the pixel intensity of phosphorylated protein to the pixel
value of their corresponding total protein. Average pixel intensity of the three replicates from the
raft fraction of all the groups were represented by 0. Mean pixel intensity of the non-raft fraction
from control 0 h, control 4 h, ouabain 4 h and heparin 4 h were indicated by 0.7, 1.5, 2.3 and 1.8,
![Page 68: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/68.jpg)
44
respectively. Data shown were expressed as mean ± SEM (n = 3). a-e
Values without a common
superscript differed (P < 0.05).
Figure 2.6 Effect of capacitating conditions on EGFR phosphorylation in non-raft
membrane fractions. (A) Representative western blot showing activation (phosphorylation) of
EGFR under ouabain- or heparin-induced capacitating conditions (consolidated images indicated
by dividing lines; left panel). Membranes were stripped and probed with their respective
antibodies for total protein to normalise the data (right panel). (B) Relative pixel intensity was
calculated by normalising pixel intensity of phosphorylated protein to the pixel value of their
corresponding total protein. Average pixel intensity of the three replicates from the raft and non-
raft fractions of control groups, raft fraction of ouabain 4 h and heparin 4 h were represented by
![Page 69: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/69.jpg)
45
0. Mean pixel intensity of the non-raft fraction of ouabain 4 h and heparin 4 h groups were 1.9
and 1.4, respectively. Data shown were expressed as mean ± SEM (n = 3). a-c
Values without a
common superscript differed (P < 0.05).
Figure 2.7 Effect of capacitating conditions on Src phosphorylation in raft and non-raft
membrane fractions. (A) Representative western blot showing activation (phosphorylation) of
Src under ouabain- or heparin-induced capacitating conditions (consolidated images indicated by
dividing lines; left panel). Membranes were stripped and probed with their respective antibodies
for total protein to normalise data (right panel). (B) Relative pixel intensity was calculated by
normalising pixel intensity of phosphorylated protein to the pixel value of their corresponding
![Page 70: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/70.jpg)
46
total protein. Data shown were expressed as mean ± SEM (n = 3). a-g
Values without a common
letter differed (P < 0.05).
2.4.5 Interaction of ATP1A4 with signaling molecules in the raft and non-raft membrane
fractions during capacitation
Using immunoprecipitation, we identified that ATP1A4 interacted with caveolin-1 only in the
raft fraction. Moreover, caveolin-1 content in the immunoprecipitate from the raft fraction of
ouabain-capacitated sperm was higher compared to the rest of the groups [heparin 4 h and
controls (0 h and 4 h)]. Interaction of EGFR with ATP1A4 was detected in both membrane
fractions of ouabain capacitated sperm, with minimal interaction in other groups. In contrast,
interaction of ATP1A4 with Src and ERK1/2 was evident only in the non-raft fraction of ouabain
capacitated group. Although ATP1A4 interacted with ERK 1/2 in the non-raft fraction, the
content of this protein was higher in the immunoprecipitate from the 4 h incubation control and
capacitated groups compared to control 0 h (Figure 2.8).
![Page 71: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/71.jpg)
47
Figure 2.8 Interaction of ATP1A4 with signaling molecules in raft and non-raft membrane
fractions during capacitation. Raft and non-raft fractions were solubilized and
immunoprecipitated with the ATP1A4 antibody-protein A bead slurry for 12 h and
immunoblotted with the antibodies against unphosphorylated forms of caveolin-1, EGFR, Src
and ERK1/2, as described.
2.5 Discussion
Involvement of Na/K-ATPase in regulation of signaling molecules in somatic cells has been well
documented. However no information is available on raft and non-raft localisation of ATP1A4
in sperm and its consequences for initiation of downstream signaling pathways leading to
capacitation. In this study, using a combination of membrane fractionation and
immunoprecipitation techniques, we demonstrated that interaction of ouabain with ATP1A4
![Page 72: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/72.jpg)
48
regulated signaling pathways localised to the raft and non-raft sperm membrane fractions. In that
regard, caveolin-1 phosphorylation was higher in the raft fraction, whereas ERK1/2 and EGFR
phosphorylation were higher in the non-raft fraction of sperm capacitated with ouabain. A minor
Src population was activated in the raft fraction, whereas the majority was in the non-raft
fraction of ouabain capacitated sperm. Subsequent immunoprecipitation studies demonstrated
that ATP1A4 interacted with caveolin-1 in the raft fraction. However, an interaction of ATP1A4
with Src, EGFR and ERK1/2 was more evident in the non-raft fraction. Overall, we inferred that
ATP1A4 regulated sperm capacitation through both raft- and non-raft mediated signaling.
To investigate raft-mediated ATP1A4 signaling, the first step was to extract raft and non-
raft sperm membrane fractions. Since Na/K-ATPase in sperm and in other cell types was soluble
in ice-cold Triton X-100 (Wang et al. 2004, Cross 2004), we used a non-detergent (sodium
carbonate) based approach to separate the raft and non-raft domains and their biochemical profile
was characterised as reported (Asano et al. 2009). Quite surprisingly, caveolin-1 was detected in
the non-raft fraction, even though it is a traditional resident protein of caveolae. In addition, to
serve as a structural protein for caveolae formation, caveolin-1 participates in a multitude of
signaling processes through its scaffolding domain, facilitating movement of other proteins to
and from the membrane (Collins et al. 2012, Byrne et al. 2012). Therefore, localization of this
protein outside of lipid rafts suggested a potential role for this protein in cell signaling outside of
lipid rafts (Head & Insel 2007, Boscher & Nabi 2012). Due to uncertainty of caveolin-1
localisation in both fractions, GM-1 (raft marker) and α-tubulin (non-raft marker) were
additionally used to confirm purity of the membrane fractions, as they are classical markers of
sperm raft and non-raft membrane fractions, respectively (Cross et al. 2004, Asano et al. 2009).
![Page 73: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/73.jpg)
49
The greater content of SFA in the raft fractions was consistent with a more rigid raft
fraction, whereas higher content of PUFA in non-raft fractions was consistent with a more fluid
lipid environment (non-raft) in the plasma membrane. Subsequent ultrastructural analysis
demonstrated that rafts had bigger membrane vesicles and that migration in a sucrose gradient
was based on their typical lipid composition, and not on their size or morphology (Asano et al.
2009). In fresh uncapacitated sperm (control 0 h), the cholesterol content varied significantly,
with greater amounts in the raft fraction and comparatively lower amounts in the non-raft
fraction. In capacitated sperm, the decrease in the cholesterol content was more pronounced in
the non-raft fraction, consistent with the global cholesterol efflux that occurs during capacitation.
The primary function of rafts is signal transduction; therefore, they contain only a very limited
subset of proteins (Simons & Toomre 2000), consistent with the lower protein content in these
fractions in comparison to non-raft fractions of uncapacitated and capacitated sperm.
During capacitation, sperm undergo numerous biochemical changes, including initiation
of signaling pathways before participating in fertilization. Studies have localised p-Src to various
regions of capacitated sperm (human; Mitchell et al. 2008; Varano et al. 2008; mouse: Baker et
al. 2006; bull: Etkovitz et al. 2009). Likewise, EGFR is involved in acrosomal exocytosis and
actin remodelling in bovine sperm (Lax et al. 1994, Etkovitz et al. 2009) and MAPK pathway is
involved in regulation of sperm capacitation (pig: Awda & Buhr 2010; mouse: Nixon et al. 2010;
human: de Lamirande and Gagnon 2002; Thundathil et al. 2003). Lipid rafts act as a signaling
hub in sperm and in other cell types, as co-localization of multiple proteins within a restricted
space is more conducive to initiate a specific signaling process than random distribution of
molecules in the plasma membrane (Liu et al. 2003). However, non-raft domains also contain
multiple proteins that could have critical roles in signal transduction upon interaction with
![Page 74: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/74.jpg)
50
receptors, signaling molecules and ligands through protein-protein interactions (Simons &
Ikonen 1997). For example, in cardiac myocytes and smooth muscle cells, Na/K-ATPase
signaling was not only limited to the raft pool but also occurred in the non-raft portion of the
plasma membrane (Liu et al. 2011). Likewise, differential distribution of molecules have been
reported for GliPr1L1 (Glioma pathogenesis-related 1-like protein 1 (Caballero et al. 2012) and
adenylate kinase 1 (Girouard et al. 2008) among raft and non-raft domains in bovine epididymal
sperm.
We detected differences in the distribution of phosphorylated signaling molecules in raft
and non-raft fractions during ouabain-mediated sperm capacitation through immunoblotting
studies. In somatic cells where ATP1A1 predominates, there was a time-dependent increase in
phosphorylation of signaling molecules that was noticed in the raft fraction after 5 to 15 min of
ouabain exposure, suggesting that rafts act as a signaling centre for ATP1A1-ouabain signaling.
Consistent with this, caveolin-1 and a minor Src population were phosphorylated in the raft
fraction of ouabain capacitated sperm, whereas the remainder of molecules (EGFR, ERK1/2)
including Src were predominantly phosphorylated in the non-raft fraction. Overall, ATP1A4
signaling in sperm had some similarities to ATP1A1 signaling in somatic cells (raft signaling).
However, the majority of signaling events that occurred during sperm capacitation were
mediated through non-rafts, suggesting that ATP1A4 may exhibit different roles depending on
the cell type and neighbouring proteins in the cell. Protein tyrosine phosphorylation is a crucial
event during capacitation, which is maintained by a balanced act between kinases and
phosphatases in sperm (Signorelli et al. 2012). Since capacitation in bovine sperm occurs over a
4 h interval, it is possible that active phosphorylation and dephosphorylation events could change
involvement of downstream signaling molecules that was recorded at the end of the capacitation
![Page 75: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/75.jpg)
51
period. Furthermore, signaling molecules could move out of the rafts and be recruited into rafts
from other regions of the plasma membrane, as in the case of EGF receptors which rapidly move
out of rafts (Mineo et al. 1999), whereas insulin receptors are recruited into rafts upon ligand
binding (Vainio et al. 2002). This dynamic movement of molecules between various
compartments of the plasma membrane could add to the complexity of interpreting raft and non-
raft signaling pathways mediated by ATP1A4 during capacitation.
Protein recruitment to caveolae/rafts and subsequent interaction with caveolin is believed
to be mediated via a ∼20 amino acid N-terminal region on the caveolin molecule known as the
caveolin scaffolding domain (CSD) and an aromatic-rich caveolin binding motif (CBM) on the
associated protein. The ubiquitous ATP1A1 isoform directly interacts with caveolin-1 mediated
through putative CBM located at the N- and C-terminus (Cai et al. 2008, Byrne et al. 2012).
Although ATP1A4 shares only 80% homology with the ATP1A1 subunit, perhaps this sperm
specific isoform could interact directly with caveolin-1 through its CBM domain in the same
manner as ATP1A1-caveolin-1 interaction, or through regions independent of a typical CBM.
Studies have highlighted that atypical CBM could also facilitate caveolin interactions, for
example, binding of the DNA-binding protein inhibitor, ID-1, to caveolin-1 occurs via a helix-
loop-helix domain, a region devoid of CBM (Zhang et al. 2007). Additionally, the kinase domain
of EGFR has a CBM, which mediates its interaction with caveolin-1 (Couet et al. 1997)
consistent with EGFR interaction in the raft fraction.
The interaction between ATP1A4 and caveolin-1 could recruit and activate other CBM
containing molecules such as PLC and PKC which are involved in calcium release and F-actin
formation, respectively. In somatic cells, PLC increases hydrolysis of PIP2, generating IP3 which
can activate IP3R, and release intracellular Ca2+
(Yuan et al. 2005). In addition, activation of
![Page 76: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/76.jpg)
52
PLC also generates DAG, which activates PKC. PKC subsequently hydrolyses phosphatidyl
choline (PC) to phosphatidic acid (PA), mediating polymerisation of G-actin to F-actin. Increase
in intracellular calcium and F-actin formation are hallmark features of sperm undergoing
capacitation.
In somatic cells, the ubiquitous ATP1A1 directly interacts with Src through specific
domain-domain interactions and keeps Src in an inactivated state (Tian et al. 2006). Binding of
ouabain with ATP1A1 causes conformational changes in ATP1A1 which activates Src.
Activated Src could trigger phosphorylation of EGFR, which is capable of recruiting adaptor
proteins such as growth factor receptor-bound protein 2 (Grb2), son of sevenless (SOS) and Rat
sarcoma protein (Ras), resulting in assembly and activation of Ras/Raf/ERK 1/2 cascade.
Consistent with Src interaction in the non-raft fraction, we confirmed that EGFR and ERK1/2
interaction also occurred in the same fraction. Even though the presence of adaptor proteins
wasn't investigated in this study, others have reported that Shc, Grb2, Ras, Raf are present in
sperm (de Lamirande & Gagnon 2002). Perhaps EGFR acts through these proteins to initiate the
MAPK cascade during sperm capacitation. That EGFR could activate ERK1/2 pathway outside
of rafts suggested that these membrane domains may not be absolutely critical for activating this
pathway. Activation of ERK1/2 induces tyrosine phosphorylation in sperm, yet another
characteristic feature of capacitation, via PTK (O'Flaherty et al. 2006). A proposed model
regarding potential raft and non-raft mediated ATP1A4 signaling pathways are shown (Figure
2.9). Based on immunoprecipitation studies, it is reasonable to assume that the increased
interaction between ATP1A4 and signaling molecules (total) in presence of ouabain could have
led to a corresponding increase in the phosphoprotein content of these signaling molecules, as
evident from immunoblotting studies.
![Page 77: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/77.jpg)
53
In conclusion, we inferred that the raft and the non-raft pools of ATP1A4 may regulate
distinct downstream signaling events, which are necessary to support capacitation and fertilizing
ability of bovine sperm. During spermatogenesis, sperm acquires specific proteins, for example,
testis-specific lactate dehydrogenase (LDH-C4), testis-specific GAPDH, testis specific
angiotensin converting enzyme (tACE), which are not present in any other cell of the body,
perhaps interacting partners of ATP1A4 are different from their somatic cell counterparts.
Therefore, future studies are aimed at investigating the ATP1A4 interactome in the raft and non-
raft fraction by immunoprecipitation- mass spectrometry-based approaches.
![Page 78: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/78.jpg)
54
Figure 2.9 A hypothetical model for ATP1A4-mediated raft- and non-raft signaling
pathways during bovine sperm capacitation. This model is based on current knowledge
regarding the role of ATP1A1 as a signaling molecule in somatic cells, and available data on
involvement of ATP1A4 in bovine sperm capacitation. The two (raft and non-raft) pools of
ATP1A4 could trigger distinct downstream pathways during sperm capacitation. In the raft,
ouabain signaling involves ATP1A4-caveolin-1-EGFR complex which could bind and activate
PLC, thereby increasing hydrolysis of PIP2, generating IP3 and DAG, which in turn activates
PKC. IP3 binds to IP3R causing an increase in intracellular calcium, whereas PKC mediates
polymerisation of G-actin to F-actin through other mediator proteins. Within non-raft, ATP1A4
signaling activates ERK1/2, leading to protein tyrosine kinase (PTK) mediated tyrosine
phosphorylation of proteins. Increase in F-actin, intracellular calcium and protein tyrosine
phosphorylation contribute to capacitation-associated changes in sperm.
![Page 79: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/79.jpg)
55
Chapter Three: Characterization of the testis-specific isoform of Na/K-ATPase (ATP1A4)
interactome in raft and non-raft membrane fractions from capacitated bovine sperm
3.1 Abstract
Sperm plasma membrane consists of highly dynamic lipid microdomains (rafts), which harbour a
cohort of signaling proteins involved in regulation of sperm capacitation. We previously reported
that incubation of bovine sperm with ouabain induced sperm capacitation through signaling
mechanisms involving kinases and that two distinct pools of ATP1A4 were localised in raft and
non-raft fractions of the sperm plasma membrane. The objective of the present study was to
investigate the ATP1A4 interactome in membrane rafts and non-rafts isolated from capacitated
bovine sperm. Rafts and non-raft fractions were prepared from uncapacitated and capacitated
bovine sperm using a non-detergent based approach. Proteomic analysis using a gel-based LC-
MS/MS approach identified that the non-raft interactome comprised of hexokinase, plakophilin-
1, 14-3-3 protein, cathepsin D, and heat shock protein. A disintegrin and metalloprotease
(ADAM) and annexin A2 were exclusive to the raft fraction, whereas actin and plakoglobin were
identified in both raft and non-raft fractions of ouabain capacitated sperm. Based on gene
ontology, these differentially interacted proteins are putatively involved in sperm-oocyte
interaction, metabolism, protease activity and act as adaptor and cytoskeletal proteins.
Significant differences in plakoglobin-, hexokinase-, and actin- interaction with ATP1A4 across
treatments were subsequently validated using immunoblotting and immunocytochemical studies.
Overall, we identified novel proteins that interacted with ATP1A4 and provided new insights
regarding their potential functions in mammalian fertilization.
![Page 80: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/80.jpg)
56
3.2 Introduction
Ejaculated sperm must remain in the female reproductive tract for a species-dependent interval to
attain fertilizing ability; these maturational changes are collectively known as sperm capacitation
(Yanagimachi 1994). Capacitation-associated changes including hyperactivated motility,
tyrosine phosphorylation and other physiological events are attributed to changes in the
intracellular ionic environment and initiation of several signaling cascades. However, specific
roles of individual sperm proteins in regulation of sperm capacitation are not well characterized.
ATP1A4 serves two functions in sperm, including a classical function as an ion
transporter/enzyme and a non-classical function as a signaling molecule. Most of the signaling
function has been attributed to Na/K-ATPase localised in raft microdomains, due to its proximity
to other signaling molecules within the raft microenvironment (Liu et al. 2003, Liang et al.
2007). However, non-raft domains also contain multiple proteins that could have critical roles in
signal transduction upon interaction with receptors, signaling molecules and ligands through
protein-protein interactions (Simons & Ikonen 1997). In that regard, a recent study identified
that the signaling function of Na/K-ATPase was not only limited to the raft pool and that the
non-raft domain contained various signaling molecules, including Src, EGFR, PI3K, ERK1/2
and Akt (Liu et al. 2011). Sperm plasma membrane is also enriched in rafts and contains a cohort
of molecules that could be involved in sperm-oocyte interaction (Cross 2004, Shadan et al. 2004,
Sleight et al. 2005, Bou Khalil et al. 2006, Nixon & Aitken 2009). Asano (Asano et al. 2009)
identified non-raft domains in sperm, but nothing is known about their functional importance in
sperm capacitation or in subsequent steps leading to fertilization. Furthermore ouabain is
secreted from the bovine adrenal gland and is present in bovine vaginal fluid (Daniel et al. 2010).
![Page 81: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/81.jpg)
57
Therefore, the presence of ATP1A4 in sperm and ouabain in the female reproductive tract
suggests that this protein has a specific role in sperm physiology.
Based on studies in somatic cells, Na/K-ATPase is capable of forming multiple protein-
protein interactions mediated via ATP1A1. In the previous chapter, we highlighted that there are
two distinct pools (raft and non-raft) of ATP1A4 which trigger specific downstream signaling
pathways. The process of sperm development is a unique phenomenon and probably one of the
most complex differentiation processes in higher eukaryotes. During spermatogenesis, sperm
acquire several proteins or their isoforms that are unique and cell-specific to meet functional
demands of the cell, including lactate dehydrogenase (LDH-C4), sperm adhesion molecule 1
(PH-20), and testis-specific isoform of Angiotensin Converting Enzyme (t-ACE). Therefore, we
hypothesized that ATP1A4 interacts with novel sperm proteins during capacitation. To test this
hypothesis, we compared (immunoprecipitation-mass spectrometry) the interactome profile of
ATP1A4 between raft- and non-raft membrane fractions prepared from capacitated sperm and
proposed a potential role for ATP1A4 in sperm-oocyte interaction.
3.3 Materials and methods
3.3.1 Semen collection, preparation of reagents, preparation of raft and non-raft fractions
from uncapacitated and capacitated sperm
Please refer to Chapter 2, Sections 2.3.1 and 2.3.2 for detailed experimental procedures.
3.3.2 Immunoprecipitation and SDS-PAGE
Raft and non-raft fractions isolated from uncapacitated and capacitated sperm were pelleted and
lysed with ice-cold lysis buffer containing 150 mM NaCl, 10 mM Tris·HCl (pH 8.0), 1% Triton
![Page 82: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/82.jpg)
58
X-100, 60 mM octylglucoside, 1X protease inhibitor cocktail, 1 mM NaF, 1 mM Na3Vo4 for 30
min on ice. The supernatant that was obtained by high-speed centrifugation (16,000 g for 15 min
at 4 °C) was precleared with protein A beads for 30 min at 4 °C on a rocker. Simultaneously,
ATP1A4 antibody (3 µg/ml) was incubated with the protein-A bead slurry for 1 h on a rocker at
4 °C before the cross-linking procedure following the manufacturer’s instructions (Thermo
Fisher Scientific). Unbound antibody was washed off the beads and incubated with conjugation
buffer (20 mM Na3PO4, pH 7.4) containing BS3
for 30 min at RT. The reaction was terminated
by quenching with 1 M Tris, pH 7.5 for 15 min at RT. Precleared supernatant from raft and non-
raft fractions of control and capacitated groups were incubated with the cross-linked antibody-
protein A bead slurry for 12 h at 4 °C on a rocker. At the end of the incubation, the beads
containing the antibody-antigen and its interacting partners of interest were pelleted by slow
speed centrifugation (500 g for 1 min at 4 °C). Beads were washed three times with PBS
containing 0.1% Tween-20 and proteins bound to the collected beads were eluted by adding 100
mM glycine pH 2.5 to the beads with gentle rocking at RT for 10 min. This elution was done
twice and combined supernatants were neutralized with 1 M Tris pH 10. The eluted supernatant
was subjected to SDS-PAGE and stained with Coomassie Brilliant Blue G-250.
3.3.3 Protein digestion
All steps, including in-gel trypsin digestion, LC-MS/MS analysis and database search for protein
identification in the raft and non-raft fractions were performed at the mass spectrometric facility,
SAMS centre, University of Calgary. Coomassie-stained protein gel bands were cut and sliced
into small pieces (~1 mm3). These gel pieces were resuspended in 50 mM ammonium
bicarbonate/ acetonitrile (50:50, v/v) before being reduced with 10 mM dithiothreitol for 30 min
![Page 83: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/83.jpg)
59
at 56 °C and alkylated with iodoacetamide for 30 min in the dark at room temperature. Trypsin
digestion was performed for 16 h at 37 °C. After digestion, the supernatant (tryptic peptides)
were transferred into a new tube containing 5 µl of acidifying solution (acetonitrile/water/10%
trifluoroacetic acid (60:30:10, v/v). Samples were then lyophilized and resuspended in 10 µl of
1% formic acid in water.
3.3.4 LC-MS/MS analysis
Tryptic peptides were analyzed by liquid chromatography (LC; Agilent 1260 Infinity chip cube
interface) tandem mass spectrometry (MS/MS) on an Agilent 6550 iFunnel quadrupole (Q)-
time-of-flight (TOF) mass spectrometer. The LC and the Q-TOF were both controlled by
MassHunter (version B.05.00). The capillary pump used for loading the sample was run using
A1 (97% water, 2.9% acetonitrile, 0.1% formic acid) and B1 (90% acetonitrile, 9.9% water;
0.1% formic acid) solutions whereas the nanopump used to generate the gradient for peptide
elution, was run with A1 (97% water, 2.9% acetonitrile, 0.1% formic acid) and B1 (97%
acetonitrile, 2.9% water; 0.1% formic acid) solutions. Tryptic peptides (1 µl) were loaded onto a
C18 trap column of an Agilent chip operating in enrichment mode at a flow rate of 2.5 µl/min
and 3% B1. Once the sample loaded on the enrichment column, the chip valve was switched
from enrichment to analysis mode and elution of the peptides was performed using a 25 min
linear gradient from 3 to 50% B1 generated by the nanopump operated at 0.3 µl/min. Peptides
were electrosprayed into the Q-TOF which was operated in positive auto MS/MS mode. The
precursor ions with a m/z comprised between 275 and 1700 were acquired at a scan rate of 250
ms/spectrum and the 10 most abundant precursors for each cycle having a charge higher than 1,
an intensity of at least 1000 counts and a peptidic isotopic model fragmented by collision
![Page 84: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/84.jpg)
60
induced dissociation (CID). Fragment ions having an m/z between 50 and 1700 were acquired at
a scan rate of 333.3 ms/spectrum.
3.3.5 Database search
The generated LC/MS-MS data files (*.d file) were imported into Agilent MassHunter
qualitative analysis software (version B.05.00) and converted into a Mascot Generic Format
(MGF) file using default parameters. MGF file was used to search the UniProt database using
Mascot algorithm (Matrix Sciences; version 2.4). Search parameters for MS data included Bos
taurus taxonomy, trypsin as enzyme, a maximum number of missed cleavage of 1, cysteine
carbamidomethylation as fixed modification, methionine oxidation as variable modification and
a mass error tolerance of 0.2 Da for both the MS and MS/MS data. Only peptides with a Mascot
expectation value of < 0.05 and Mascot ion score of 23 were kept for further analysis.
3.3.6 Criteria for protein identification
Scaffold 4 (Proteome Software Inc., Portland, OR, USA) was used to validate identified peptides
and proteins. Peptide identifications were accepted if they could be established at >95%
probability as specified by the Peptide Prophet algorithm. Protein identifications were accepted if
they could be established at >95% probability and contained at least two identified peptides.
Common contaminants (such as keratins) and other non-specifically eluted proteins were
manually excluded from subsequent analyses.
![Page 85: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/85.jpg)
61
3.3.7 Western blotting
Immunoprecipitated elute from the raft and non-raft fractions of control and capacitated sperm
were separated on 10% PAGE gels and electrotransferred to nitrocellulose membranes. After
blocking with 3% (w/v) skim milk in TTBS for 1 h, the membrane was incubated with
hexokinase (1:2000; Novus Biologicals, ON, Canada), plakoglobin (1:100; Sigma Aldrich,
Oakville, ON, Canada), actin (1:500; Santa Cruz Biotechnology,TX, USA), phosphotyrosine
(1:10,000; Millipore) and β-tubulin (1:10,000; Sigma) antibodies overnight at 4 °C. Membranes
were washed three times in TTBS for 10 min and subsequently incubated with respective HRP
conjugated goat anti-rabbit and anti-mouse IgG (1:5,000) for 1 h at RT. Following washing,
immunoreactive bands were detected using chemiluminescence.
3.3.8 Colocalisation of plakoglobin and PLCζ with ATP1A4 in capacitated sperm
For immunostaining, uncapacitated and capacitated sperm were adhered onto poly-l-lysine
coated slides and subsequently fixed with 2.5% PFA for 15 min, permeabilized with 0.2%
Tween-20 for 10 min, followed by washing in PBS and incubation with 10% serum for blocking
depending on the source of the secondary antibodies. Co-incubation of ATP1A4 (1:100) with
either plakoglobin (1:20) or PLCζ (1:20; Santa Cruz Biotechnology) antibodies were performed
in 1% serum overnight at 4 °C. Following washing in PBS, chicken anti-rabbit alexa 488
(ATP1A4), goat anti-mouse Cy3 (plakoglobin), and donkey anti-goat Cy3 (PLCζ) secondary
antibodies were added at 1:200 for 1 h at RT. Cells were washed in PBS and mounted with
Vectashield (Vector laboratories) containing DAPI and stored at – 20 °C pending further
imaging.
![Page 86: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/86.jpg)
62
3.3.9 Flow cytometric analysis of F-actin in sperm
Staining of F-actin filaments were performed based on the manufacturer’s instructions (Thermo
Fisher Scientific). Briefly, at the end of capacitation, control and ouabain treated sperm were
washed with PBS and 1 µl of Fixable Live and Dead Cell Stain (Thermo Fisher Scientific) was
added for 30 min at RT. Subsequently, sperm were fixed with 4% PFA for 10 min,
permeabilized with 0.1% Triton X-100 for 5 min followed by washing in PBS and incubated in
PBS containing 1% BSA and FITC-phalloidin (0.33 µM; Thermo Fisher Scientific) for 1 h. Cells
were washed and data were acquired using an Attune Acoustic Focusing Cytometer (BD
Biosciences, Mississauga, ON, Canada). The excitation source was a 488 nm laser for FITC and
a 405 nm laser for the fixable live and dead (violet) dye. Voltage settings used were as follows:
FSC – 1250, SSC – 1650, FITC – 1500, violet – 1650. Subsequently, detector 1 (emission range
of 450 ± 20 nm) was used for detecting violet fluorescence (viability) and detector 2 (emission
range of 530 ± 15 nm) was used for detecting green (FITC-phalloidin) fluorescence. A total of
20 x 103 events were recorded in the form of a scatter plot and histogram.
3.3.10 Statistical analysis
Results are shown as mean ± SEM of the number of samples indicated in each case. Proteomic
analysis was done on raft and non-raft fractions isolated from control and ouabain capacitated
sperm obtained from three bulls. Since expression levels of certain proteins were zero, fold
change was calculated as the difference between the log2 values of spectral counts from control
and ouabain capacitated sperm. Significant differences in fold change values were analysed by
Student’s t-test. All data were analyzed with commercial statistical software (GraphPad Software
Inc., La Jolla, CA, USA) and P < 0.05 was considered significant.
![Page 87: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/87.jpg)
63
3.4 Results
3.4.1 Identification of ATP1A4 interacting partners by mass spectrometry
Hyperactivated motility and tyrosine phosphorylation, hallmark features of capacitated sperm,
were confirmed as detailed in Chapter 2. The ATP1A4 interactomes from the raft and non-raft
fractions of uncapacitated and capacitated sperm were compared using LC-MS/MS analysis.
Raw data regarding protein identities, and their probability scores and peptide sequences (>95%
confidence level) in raft and non-raft fractions were obtained from Mascot (Table 3.1 and Table
3.2). Scaffold subsequently identified four (raft) and seven (non-raft) differentially interacted
proteins between control and ouabain capacitated sperm, based on a peptide threshold set at 95%
and a minimum of two peptides (Table 3.3). Based on gene ontology, raft ATP1A4 interactome
comprised of ADAM (endopeptidase), annexin A2 (calcium dependent phospholipid binding
protein), plakoglobin (cell-cell adhesion) and actin (cytoskeletal component). These four
functional classes of proteins predominantly interacted and contributed equally (25% each) to the
ATP1A4 interactome (Figure 3.1A). Non-raft ATP1A4 interactome consisted of plakoglobin,
plakophilin (cell-cell adhesion), heat shock protein (chaperone), hexokinase (metabolic enzyme),
14-3-3 ζ/δ (adaptor protein), and cathepsin D (protease). Proteins involved in cell-cell adhesion
were the predominant category (28%) that immunoprecipitated with ATP1A4 in the non-raft
fraction. Compared with raft fraction, adaptor protein, chaperone, metabolic enzyme,
cytoskeletal component, and protease were additional categories that were noticed in the non-raft
fraction (Figure 3.1B). These new categories of interacting partners contributed equally (14.29
%) to the non-raft interactome (Figure 3.1B). Overall, 64% of differentially interacted proteins
were exclusive to the non-raft fraction, 18% were identifiable only in the raft fraction and the
remainder (18%) was common to both fractions.
![Page 88: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/88.jpg)
64
Table 3.1: Data from Mascot showing the identity of proteins, their probability scores (protein score and expect score) and
peptide sequences (>95% confidence) in the raft fraction.
Protein name Protein score Expect score Peptide sequences Glial fibrillary acidic protein 97 0.000058 LALDIEIATYR
0.0000026 LALDIEIATYR
Phosphatidylinositol 3-kinase 25 0.038 HGDDLR
Uveal autoantigen with coiled-coil
domains and ankyrin repeats protein 30 0.03 TEELNR
ADAM metallopeptidase domain 32 347 0.0072 SGSICDK
0.0059 YTFCPWR
0.00028 CSEVGPYINR
0.0073 DSASVIYAFVR
0.00044 DSASVIYAFVR
0.00047 LICTYPLQTPFLR
0.0039 LICTYPLQTPFLR
0.001 LICTYPLQTPFLR
0.0000038 AYCFDGGCQDIDAR
0.00000043 AYCFDGGCQDIDAR
0.0000042 VNQCSAQCGGNGVCTSR
0.0000048 NAPFACYEEIQSQTDR
0.000019 NAPFACYEEIQSQTDR
Alpha-fetoprotein 24 0.0093 YIYEIAR
Junction plakoglobin 214 0.011 ATIGLIR
0.0038 LVQLLVK
0.000043 EGLLAIFK
0.00027 QEGLESVLK
0.000085 TMQNTSDLDTAR
![Page 89: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/89.jpg)
65
Protein name Protein score Expect score Peptide sequences
Junction plakoglobin
0.000046 ALMGSPQLVAAVVR
0.01 LLNQPNQWPLVK
0.01 NEGTATYAAAVLFR
0.004 NLALCPANHAPLQEAAVIPR
0.0007 VLSVCPSNKPAIVEAGGMQALGK
0.00086
ILVNQLSVDDVNVLTCATGTLSNLTC
NNSK
Catenin beta-1 54 0.000043 EGLLAIFK
Lysozyme 89 0.0026 STDYGIFQINSR
0.00051 STDYGIFQINSR
0.0000052 STDYGIFQINSR
Annexin A2 72 0.0036 QDIAFAYQR
72 0.0000043 TNQELQEINR
ACTA2 protein 35 0.0044 AGFAGDDAPR
0.013 EITALAPSTMK
Similar to beta actin (Fragment) 31 0.0013
LCYVALDFEQEMATAASSSSL
EK
Actin (Fragment) 30 0.023 IIAPPER
0.021 IIAPPER
Heat shock protein beta-1 59 0.000009 LFDQAFGLPR
Hexokinase 58 0.00011 SANLVAATLGAILSR
0.0014 SANLVAATLGAILSR
Desmoglein-1 53 0.000012 IHSDCAANQQVTYR
Glutathione peroxidase 7 26 0.042 AVNIR
14-3-3 protein sigma 38 0.0045 NLLSVAYK
0.0047 DSTLIMQLLR
SMG5 protein 37 0.0081 NLPPLR
0.0062 NLPPLR
Plakophilin-1 36 0.00045 LDAEVPTR
![Page 90: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/90.jpg)
66
Protein name Protein score Expect score Peptide sequences
Solute carrier family 35 member F5
0.015 FTLSK
Tripartite motif-containing protein 45 33 0.0042 HGDSVR
Glycosylation-dependent cell adhesion
molecule 1 32 0.016 EQIVIR
Glutathione S-transferase P 32 0.0044 ASCLYGQLPK
Cathepsin D 31 0.0013 ISVNNVLPVFDNLMQQK
Pancreatic trypsin inhibitor 30 0.0017 AGLCQTFVYGGCR
Myozenin-2 26 0.019 VSIPR
GLIPR1-like protein 1 25 0.021 TAEAWAK
Elongation factor 1-alpha 24 0.0081 IGGIGTVPVGR
Actin, cytoplasmic 61 0.023 IIAPPER
0.021 IIAPPER
0.0044 AGFAGDDAPR
0.013 EITALAPSTMK
0.0013
LCYVALDFEQEMATAASSSSL
EK
0.023 IIAPPER
0.021 IIAPPER
0.0044 AGFAGDDAPR
0.0013
LCYVALDFEQEMATAASSSSL
EK
0.023 IIAPPER
0.021 IIAPPER
0.0044 AGFAGDDAPR
0.013 EITALAPSTMK
![Page 91: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/91.jpg)
67
Table 3.2: Data from Mascot showing the identity of proteins, their probability scores (protein score and expect score) and
peptide sequences (>95 % confidence) in the non-raft fraction.
Protein name Protein score Expect score Peptide sequences
Glial fibrillary acidic protein 42 0.00014 LALDIEIATYR
Phosphatidylinositol 3-kinase 24 0.052 HGDDLR
NADH dehydrogenase [ubiquinone] iron-
sulfur protein 2, mitochondrial 27 0.021 LIEYK
Hexokinase 239 0.004 LALLQVR
0.0079 ASGVEGTDVVK
0.0039 YLSQIESDR
0.053 FNTSDVSAIEK
0.0000014 MVSGMYLGELVR
0.0027 MISGMYLGEIVR
0.0007 SANLVAATLGAILSR
0.0012 SANLVAATLGAILSR
0.00037 SANLVAATLGAILSR
0.00000013 AAQLCGAGMAAVVDK
0.00089 STPDGTENGDFLALDLGGTNFR
Hexokinase (Fragment) 87 0.0027 MISGMYLGEIVR
0.00000013 AAQLCGAGMAAVVDK
Hexokinase-1 31 0.004 LALLQVR
0.053 FNTSDVSAIEK
HK3 protein 27 0.0027 MISGMYLGEIVR
Alpha-fetoprotein 24 0.0098 YIYEIAR
Junction plakoglobin 223 0.00026 EGLLAIFK
0.0023 LAEPSQLLK
0.024 QEGLESVLK
0.00014 LLNDEDPVVVTK
0.00032 TMQNTSDLDTAR
![Page 92: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/92.jpg)
68
Protein name Protein score Expect score Peptide sequences
0.0025 ALMGSPQLVAAVVR
0.0036 HPEAEMAQNSVR
0.0000037 ALMGSPQLVAAVVR
0.0059 LLNQPNQWPLVK
0.0018 NEGTATYAAAVLFR
0.00035 NEGTATYAAAVLFR
Catenin beta-1 46 0.00026 EGLLAIFK
Actin, cytoplasmic 1 149 0.0093 IIAPPER
0.00017 AGFAGDDAPR
0.0072 EITALAPSTMK
0.0013 EITALAPSTMK
0.0033 QEYDESGPSIVHR
0.0017 VAPEEHPVLLTEAPLNPK
0.0002 DLYANTVLSGGTTMYPGIADR
0.00034 DLYANTVLSGGTTMYPGIADR
0.0093 IIAPPER
0.00017 AGFAGDDAPR
0.0033 QEYDESGPSIVHR
0.0017 VAPEEHPVLLTEAPLNPK
Actin, aortic smooth muscle 76 0.0093 IIAPPER
0.00017 AGFAGDDAPR
0.0072 EITALAPSTMK
0.0013 EITALAPSTMK
ACTA2 protein 67 0.00017 AGFAGDDAPR
0.0072 EITALAPSTMK
0.0013 EITALAPSTMK
Actin (Fragment) 30 0.0093 IIAPPER
Beta actin (Fragment) 30 0.0017 VAPEEHPVLLTEAPLNPK
Solute carrier family 2 (Facilitated glucose
transporter), member 3 108 0.016 FLLINR
![Page 93: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/93.jpg)
69
Protein name Protein score Expect score Peptide sequences
0.002 AFEGQTQTGTR
0.0017 QVTVLELFR
0.0000034 GPIMEMNSIQPTK
0.0028 GPIMEMNSIQPTK
Solute carrier family 2, facilitated glucose
transporter member 1 27 0.016 FLLINR
Desmoglein-1 95 0.041 LADISLGK
0.000013 IHSDCAANQQVTYR
0.00055 ISGVGIDQPPYGIFVINQK
0.00049 ISGVGIDQPPYGIFVINQK
Cathepsin D 68 0.000021 FDGILGMAYPR
0.00089 ISVNNVLPVFDNLMQQK
0.00089 ISVNNVLPVFDNLMQQK
Plakophilin-1 45 0.00049 LDAEVPTR
0.015 AVQYLSSQDEK
PKP1 protein 25 0.015 AVQYLSSQDEK
14-3-3 protein zeta/delta 45 0.000064 SVTEQGAELSNEER
Heat shock protein beta-1 43 0.000084 LFDQAFGLPR
Elongation factor 1-alpha 42 0.0047 EAAEMGK
0.0014 YYVTIIDAPGHR
0.0014 YYVTIIDAPGHR
0.0047 EAAEMGK
Pancreatic trypsin inhibitor 40 0.00016 AGLCQTFVYGGCR
Tripartite motif-containing protein 45 38 0.0015 HGDSVR
Heat shock 70 kDa protein 1 37 0.00045 VEIIANDQGNR
Hyaluronidase 36 0.004 STQNAALYVR
0.006 TVFGGIPQLGNLK
Solute carrier family 2, facilitated glucose
transporter member 5 36 0.0011 AVGFISVLK
Serine/threonine-protein phosphatase 32 0.0052 VNAIESSAIR
![Page 94: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/94.jpg)
70
Protein name Protein score Expect score Peptide sequences
Insulin-degrading enzyme 30 0.0016 ESLDDLTNLVVK
Annexin A2 29 0.0017 TNQELQEINR
Bromodomain, testis-specific 27 0.034 KAAIEK
Solute carrier family 35 member F5 27 0.018 FTLSK
Alpha S1 casein 27 0.0031 FFVAPFPEVFGK
Peroxiredoxin-2 25 0.025 QVTINDLPVGR
Nuclear receptor subfamily 2 group C
member 1 25 0.01 LPALR
Very-long-chain (3R)-3-hydroxyacyl-CoA
dehydratase 25 0.012 AGAGEASSSRR
Rab GDP dissociation inhibitor beta 24 0.0052 FVSISDLLVPK
SLA protein 24 0.0076 KSVSLMYSGSK
![Page 95: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/95.jpg)
71
Table 3.3: Spectral counts of differentially interacted proteins (control vs ouabain-capacitated sperm) in raft and non-raft
membrane fractions
Accession # Protein Average spectral count Fold change
(Raft interactome)
Control 4 h Ouabain 4 h (Log2)
ACTB_BOVIN Actin, cytoplasmic 0 8.5 1.32
PLAK_BOVIN Junction plakoglobin 0 13.5 3.75
Q2NKZ3_BOVIN ADAM metallopeptidase 1.5 5.5 1.87
E1BBP7_BOVIN Annexin A2 0 3.5 1.8
Accession # Protein Average spectral count Fold change
(non-raft interactome)
Control 4 h Ouabain 4 h (Log2)
Q5W5U3_BOVIN Hexokinase 0 11.5 3.52
ACTB_BOVIN Actin, cytoplasmic 1 0 2.5 3.08
PLAK_BOVIN Junction plakoglobin 0 12 3.52
PKP1_BOVIN Plakophilin-1 0 2 1
1433Z_BOVIN 14-3-3 protein zeta/delta 0 2 1
CATD_BOVIN Cathepsin D 0 2 1
E1BEL7_BOVIN Heat shock protein beta-1 0 2 1
![Page 96: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/96.jpg)
72
3.4.2 Validation of mass spectrometry data for selected candidate proteins
Although the list of interacting partners represents high confident proteins, validation was
performed on significant protein hits using their respective antibodies. Non-raft protein,
hexokinase and raft proteins, plakoglobin and actin that interacted with ATP1A4 were chosen for
validating mass spectrometry data, based on their significant interaction in ouabain capacitated
sperm. Based on spectral counts, plakoglobin was equally distributed between raft and non-raft
fractions. However, immunoblotting on raft and non-raft immunoprecipitates indicated that
plakoglobin was restricted to the raft fraction (Figure 3.2A). Plakoglobin was localised to the
equatorial segment of uncapacitated sperm and capacitated sperm. Although the ATP1A4 signal
was predominantly localised to the anterior acrosome in control sperm, it become pronounced in
the equatorial segment, and postacrosome region in capacitated sperm (Figure 3.2C). Presence of
hexokinase was more evident in the non-raft fraction compared to the raft fraction of ouabain
capacitated sperm and no interaction was apparent in the control group, consistent with their
spectral counts (Figure 3.2A). Increased amount of actin was detected in the raft fraction as
compared to the non-raft fraction of ouabain capacitated sperm, consistent with the spectral
counts (Figure 3.2A). We also confirmed the formation of F-actin in control and capacitated
sperm by flow cytometry. Relative content of F-actin (based on intensity of FITC-phalloidin
fluorescence) was higher in ouabain-capacitated sperm, compared to uncapacitated sperm
(Figure 3.2B), consistent with results of immunoblotting.
![Page 97: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/97.jpg)
73
![Page 98: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/98.jpg)
74
Figure 3.1 Potential functions of differentially interacted proteins (control vs ouabain-
capacitated sperm) in raft and non-raft membrane fractions. (A) and (B) correspond to the
percentage contribution of each protein and its function that differentially interacted with
ATP1A4 in the rafts and non-rafts, respectively.
![Page 99: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/99.jpg)
75
![Page 100: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/100.jpg)
76
Figure 3.2 Validation of selected ATP1A4 interactomes and ATP1A4-plakoglobin
interaction during sperm capacitation. (A) Raft and non-raft membrane fractions were
solubilized and immunoprecipitated with the crosslinked ATP1A4 antibody-protein A bead
slurry for 12 h and immunoblotted against the unphosphorylated forms of the antibodies as
described. (B) Capacitated sperm were labelled with FITC-phalloidin and levels of fluorescence
were recorded (flow cytometer) and a representative fluorescence intensity histogram is shown.
(C) Representative images of ATP1A4 (green), plakoglobin (red), nuclei (blue) and merged
plakoglobin, ATP1A4 and DAPI staining in control and ouabain capacitated sperm.
3.5 Discussion
We applied a proteomic approach to investigate profiles of ATP1A4 interacting partners in the
raft and non-raft membrane fractions from uncapacitated and capacitated sperm. Non-raft
interactome was comprised of hexokinase, plakophilin-1, 14-3-3 protein, cathepsin D, and heat
shock proteins, whereas ADAM and annexin A2 were exclusive to the raft fraction. Actin and
plakoglobin were identified in both raft and non-raft fractions of ouabain capacitated sperm.
These differentially interacted proteins were putatively involved in sperm-oocyte interaction,
metabolism, protease activity and act as adaptor and cytoskeletal proteins. Subsequent validation
on plakoglobin indicated that this protein was localised to the rafts and to the equatorial segment
of ouabain capacitated sperm. Interaction of ATP1A4 with hexokinase was more evident in the
non-raft fraction whereas interaction with actin was noticed in the raft fraction and highest
amount of F-actin fluorescence was recorded in ouabain capacitated sperm.
Label-free methodologies, e.g. spectral count, have gained acceptance as a semi-
quantitative approach to measure protein abundance in proteomic studies and had strong linear
correlation with relative protein abundance with a dynamic range more than two orders of
![Page 101: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/101.jpg)
77
magnitude (Liu et al. 2004, Lundgren et al. 2010). Spectra count is defined as the total number
of spectra/peptide sequences (recognized by intensity versus mass to charge ratio plot of
aminoacids detected in a peptide sequence) identified for a particular protein. Using this
approach, relative protein quantification is achieved by comparing the number of identified
MS/MS spectra for the same protein across experimental groups. This is possible because an
increase in protein abundance typically results in an increase in the number of its proteolytic
peptides, which results in an increase in protein sequence coverage, the number of identified
unique peptides, and the number of identified total MS/MS spectra (spectral count) for each
protein (Washburn et al. 2001). Therefore, we used spectral count as a reliable index for relative
protein quantification to assess fold changes in ATP1A4 interacting partners in raft and non-raft
fractions isolated from control and ouabain capacitated sperm. In the previous chapter (Chapter
2) we identified signaling molecules that interacted with ATP1A4 using a candidate molecule
approach, however, none of them were identified by mass spectrometry. A possible reason is that
all of the candidate molecules were either kinases or substrates of kinases which either undergo
autophosphorylation (transfer of highly charged PO4- groups from ATP) or act as downstream
targets. Generally charged peptides are poorly ionised by electrospray MS unless phospho-
protein enrichment strategies were followed (Mann et al. 2002). Other factors to consider include
efficient extraction of the peptides and preparation of the sample for MS while trying to
minimize the presence of salts or detergents may also adversely affect ionization of kinases
(Baldwin 2004). Sometimes, peptides may arise from proteolysis but simply not be detected, or it
may have an unexpected mass due to one or more modifications, or the residues may indeed be
present in the sequence but the proteolysis may not proceed as anticipated. Since mass
spectrometry is a multi-step complex procedure, the information derived will depend on the
![Page 102: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/102.jpg)
78
nature and complexity of the sample, the actual mass spectrometry technology and the particular
search engine that was used to identify the peptide hits (Baldwin 2004). All these factors could
have affected the overall results and contributed to the absence of the candidate proteins
(kinases) that interacted with ATP1A4 as discussed in the previous chapter.
During fertilization, capacitated and acrosome reacted sperm penetrate the zona
pellucida, enter the perivitelline space and is followed by an adhesion step where an initial
contact is made between sperm and egg plasma membrane. This step is required for sperm-egg
fusion, which is initiated by fusion between the equatorial segment (ES) of the sperm head and
the microvilli present on the oolemma (plasma membrane of oocyte; (Yanagimachi 1994).
Oocyte integrins and their respective sperm ligands (ADAM family of proteins), IZUMO and
CD9 are well-characterised proteins in mediating the above-mentioned process (Mitamura et al.
1992, Inoue et al. 2005).
In epithelial cells, the process of cell-cell adhesion is facilitated by E-cadherin, where
their extracellular domain forms homo and heterophilic bonds with cadherins on adjacent cells;
these bonds are further strengthened by interactions between the cytoplasmic domain of E-
cadherin and actin cytoskeleton (Yamada et al. 2005). The γ-catenin (plakoglobin) binds to the
cytoplasmic domain of E-cadherin, whereas α-catenin binds to γ-catenin (Piepenhagen & Nelson
1993). It has been demonstrated that E-cadherin and catenin proteins are expressed in sperm and
oocytes (Rufas et al. 2000, De Vries et al. 2004) where they are specifically localised to the ES
of the sperm head and microvillar region on oolemma (Takezawa et al. 2011). If gamete
interaction involves mechanisms that are similar to epithelial cell adhesion, it is likely that these
proteins are involved in events leading to sperm-oocyte adhesion and fusion considering their
strategic location in sperm and in oocytes. Mass spectrometry revealed that plakoglobin was
![Page 103: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/103.jpg)
79
localized to both the raft and non-raft fractions but subsequent validation on ouabain capacitated
sperm indicated that this protein interacted only in rafts, suggesting the importance of the raft
microdomain in gamete interaction. Generally, proteome analysis involves detection of peptide
sequences which could be unique to a particular protein or shared across proteins. It is possible
that the mass spectrometric identification of peptide sequences were not specific to plakoglobin
in the non-raft fraction. Therfore, when we used a specific antibody against plakoglobin we
weren’t able to identify this protein in the non-raft fraction. Plakoglobin and ATP1A4 were co-
localised in the equatorial segment in ouabain capacitated sperm. Since plakoglobin belongs to
the catenin family, it is reasonable to assume that ATP1A4-plakoglobin interaction would be
involved in gamete fusion, leading to fertilization.
Apart from facilitating physical attachment during sperm-oocyte fusion process,
interaction of ATP1A4 with its binding partners may have key functional roles in oocyte
activation following gamete fusion. During sperm-oocyte fusion, a soluble oocyte activation
factor (SOAF) is released into the oocyte cytoplasm from sperm, which elicits calcium
oscillations leading to oocyte activation. Two potential sperm proteins, PLCζ and post acrosomal
WW binding protein (PAWP) are considered as SOAF candidates. The IP3-IP3R mediated
calcium release in oocytes is dependent upon a sperm-based PLCζ released during fusion events
(Saunders et al. 2002). In somatic cells, ATP1A1-ouabain interaction induces PLCγ
phosphorylation and calcium release via activation of IP3 receptors. In sperm, the PLC isoform
(PLCζ) was localised to the equatorial segment (Cooney et al. 2010). ATP1A4 colocalised with
PLCζ at the ES and postacrosome region in ouabain capacitated sperm (Figure 3.3) and that
ATP1A4-plakoglobin-E-cadherin interaction could facilitate entry of activated PLCζ into the
oocyte following gamete fusion.
![Page 104: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/104.jpg)
80
The adhesion process is also facilitated by the trans-dimerization of the integral proteins
via interactions between their extracellular domains (Hartsock & Nelson 2008). In that regard,
the N-glycan mediated interaction of the β-subunit of Na/K-ATPase could contribute to cell
adhesion by binding to its respective subunit in neighbouring cells. Since β1, and β3 subunits are
demonstrated in sperm, it is likely that it interacts with its corresponding subunit that is
expressed in the oolemma (De Sousa et al. 1997), thereby facilitating cell-cell adhesion
independent of the E-cadherin pathway. A proposed model involving plakoglobin, α and β
subunits of ATP1A4, E-cadherin and PLCζ is shown in Figure 3.4. Further research is required
to elucidate the physiological relevance of this interaction.
Heat shock proteins (HSP; chaperones) have well established roles in de novo folding of
proteins, assembly of multiprotein complexes, prevention of protein aggregation (Hendrick &
Hartl 1993, Neuer et al. 2000) and delivery of proteins (protein trafficking) to their respective
intracellular domain. In that regard, HSP 70 binds directly with Na/K-ATPase and facilitates its
movement to the apical domain from cytoskeletal attachments following renal cell injury
(Riordan et al. 2006). In sperm, perhaps redistribution of ATP1A4 from the anterior acrosome in
uncapacitated sperm to the equatorial segment and postacrosomal region during capacitation is
mediated by HSPs.
The 14-3-3 (YWHA) family of proteins act as adaptor proteins and appear to regulate
diverse physiological events such as cytoskeletal rearrangements, metabolism, cell cycle control,
apoptosis, stress response, and gene expression (Aitken 2006). The 14-3-3 proteins regulate
intracellular signaling pathways via their interactions with molecules containing phosphoserine
and phosphothreonine residues such as PKC, Raf-1 kinases and phosphatidylinositol 3 kinase
[PI3-kinase; (Robinson et al. 1994, Li et al. 1995)]. In opossum kidney (OK) cells, 14-3-3
![Page 105: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/105.jpg)
81
protein interacts with the phosphorylated Na/K-ATPase α-subunit (ser 18) and forms an anchor
for subsequent binding of PI3K to the N-terminus of the phosphorylated α-subunit (Efendiev et
al. 2005). In our study, PI3K was identified as a significant hit, but didn’t show up as a
differentially interacting protein due to the subsequent threshold cut-offs applied for peptide and
protein identification. In sperm, PI3K catalyses formation of PIP3 (phosphatidylinositol 3,4,5-
triphosphate) from PIP2 which acts as a cofactor for PLD (phospholipase D) activation and in
turn mediates F-actin formation from G-actin (Etkovitz et al. 2007). We used a phalloidin probe
to stabilize F-actin levels in sperm and determined their content by flow cytometry. Content of F-
actin was higher in ouabain capacitated sperm, demonstrated by movement of the histogram
along the X axis to the right. It has been documented that F-actin creates a scaffold between the
plasma membrane and outer acrosomal membrane of the sperm, immobilizing molecules like
PLC during capacitation (Brener et al. 2003, Breitbart et al. 2005).
In addition to the above described 14-3-3 protein-ATP1A4-PI3K-PLD mechanism, other
pathways may also contribute to capacitation-associated F-actin polymerization. The Rho family
of GTPases (an upstream activator of PLD) in bull sperm may be an additional link between
Na/K-ATPase and actin polymerization (Ducummon & Berger 2006). Annexins are a group of
calcium-dependent phospholipid binding proteins with high affinity towards PIP2 and similar to
YWHA family, they act as a linker between Na/K-ATPase and actin (Kimura et al. 2007,
Skrahina et al. 2008). In pig kidney outer medulla, annexin A2 tetramers and subunits of Na/K-
ATPase were part of a large multiprotein complex residing in rafts located at the interface
between two adjacent renal cells (Liu et al. 2011). In conclusion, it is likely that F-actin
formation occurs during ouabain-induced capacitation through pathways involving 14-3-3, RhoA
GTPase and annexin proteins.
![Page 106: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/106.jpg)
82
Identification of an interaction between ATP1A4 and proteases (cathepsin D) was
intriguing. We observed a high intensity of ATP1A4 fluorescence in the ES and postacrosomal
region of the sperm head compared to anterior acrosomal region after capacitation. Although the
exact mechanism behind this observation remains unknown, one possibility is translocation of
ATP1A4 from the anterior acrosomal region to the ES and postacrosomal region. To accomplish
this, the protein must be dissociated from its cytoskeletal anchorage. The protease calpain is able
to hydrolyze a variety of proteins such as spectrin and ankyrin (Suzuki & Sorimachi 1998),
which are capable of binding with ATP1A4 and securing it to the actin cytoskeleton. In sperm,
calpain relocated from cytoplasm to plasma membrane where it could interact with spectrin,
leading to acrosome reaction (Bastian et al. 2010). Similar proteolytic mechanisms could operate
during capacitation-associated ATP1A4 redistribution via cathepsins.
Oxidative phosphorylation in mitochondria provides the most efficient generation of ATP
in sperm, yet major consumers of ATP are the dynein ATPases, which are located throughout the
flagellum. Instead of ATP diffusing throughout the entire flagellum, there could be
compartmentalised glycolysis occurring in sperm (Travis et al. 2001). Accordingly, Naz et al.
1996 identified that hexokinase is localised to the acrosome in human sperm. In HeLa cells,
triose-phosphate isomerase, a member of the glycolytic pathway interacts with phosphorylated
cofilin (an actin binding protein), which in turn binds with the cytoplasmic domain of Na/K-
ATPase (Jung et al. 2002). It is likely that ATP1A4, which is localised to the sperm head could
interact with hexokinase through cofilin or other actin binding proteins. Hexokinase catalyses the
first step in the glycolysis pathway and could provide the necessary ATP to ATP1A4 for
carrying out its enzymatic activity.
![Page 107: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/107.jpg)
83
In conclusion, this study represented the first comprehensive report on ATP1A4
interactome from capacitated bovine sperm. Although the relevance of the interaction of these
proteins with ATP1A4 in mammalian fertilization is yet to be investigated, this ATP1A4
interactome provided critical insights into potential mechanisms by which ATP1A4 influences
gamete interaction, leading to successful fertilization.
Figure 3.3 Colocalisation of ATP1A4-PLCζ during sperm capacitation. Representative
images of ATP1A4 (green), PLCζ (red), nuclei (blue) and merged ATP1A4, PLCζ and DAPI
staining in ouabain capacitated sperm.
![Page 108: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/108.jpg)
84
Figure 3.4 A hypothetical model depicting the involvement of plakoglobin, α and β subunits
of ATP1A4, E-cadherin and PLCζ during sperm-oocyte fusion. Complementary E-cadherin
molecules on the sperm and oocyte could bind to each other; these interactions could be further
strengthened by binding of the cytoplasmic domain of E-cadherin (EC) to plakoglobin (PG) –α-
catenin (αC) –actin network. ATP1A4 could bind to an anchor protein, ankyrin (AN), which in
turn interacts with the actin cytoskeleton and indirectly links ATP1A4 to plakoglobin-E-cadherin
complex. This interaction could facilitate entry of sperm-derived PLCζ (indicated by broken
arrows) which results in increase of intracellular calcium and resumption of meiosis in the
oocyte. In addition, ATP1A4 could be involved in sperm-oocyte interactions by N-glycan
motifs-mediated binding of β-subunits of Na/K-ATPase (ATP1B1/ATP1B3) present in gametes.
PV: perivitelline space; ZP: zona pellucida; and ES: equatorial segment.
![Page 109: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/109.jpg)
85
Chapter Four: Content of testis-specific isoform of Na/K-ATPase (ATP1A4) is increased
during bovine sperm capacitation through translation in mitochondrial ribosomes
4.1 Preamble
The entire chapter has been submitted to Cell and Tissue Research and is currently under peer-
review
Title: Content of testis-specific isoform of Na/K-ATPase (ATP1A4) is increased during bovine
sperm capacitation through translation in mitochondrial ribosomes
Gayathri D Rajamanickam, John P Kastelic and Jacob C Thundathil
G.D. performed 100% of the experiments, analysed the data and wrote the manuscript. J. T.
supervised the project. J.T and J.K contributed to critical thinking and reviewed the manuscript.
4.2 Abstract
Capacitation comprises a series of structural and functional modifications of sperm that confer
fertilizing ability. We previously reported that the testis-specific isoform of Na/K-ATPase
(ATP1A4) regulated bovine sperm capacitation through signaling mechanisms involving kinases.
During subsequent investigations to elucidate mechanisms by which ATP1A4 regulates sperm
capacitation, we observed that ATP1A4 was localised in both raft and non-raft fractions of the
sperm plasma membrane and its total content was increased in both membrane fractions during
capacitation. Objective of the present study was to investigate mechanism(s) of capacitation-
associated increase in the content of ATP1A4. Despite the widely accepted dogma of
transcriptional/translational quiescence, incubation of sperm with either ouabain (specific ligand
for ATP1A4) or heparin increased ATP1A4 content in raft and non-raft sperm membrane
![Page 110: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/110.jpg)
86
fractions, total sperm protein extracts (immunoblotting) and fixed sperm (flow cytometry), with a
concurrent increase in Na/K-ATPase enzyme activity. This capacitation-associated increase in
ATP1A4 content was partially decreased by chloramphenicol (mitochondrial translation
inhibitor) but not affected by actinomycin D (transcription inhibitor). To demonstrate de novo
ATP1A4 synthesis, we evaluated incorporation of bodipy conjugated lysine in this protein during
capacitation. A partial decrease in bodipy-lysine incorporation occurred inATP1A4 from sperm
capacitated in the presence of chloramphenicol. Therefore, increased ATP1A4 during
capacitation was attributed to mitochondrial translation of ATP1A4 mRNA present in ejaculated
sperm, rather than gene transcription. To our knowledge, this is the first report demonstrating
ATP1A4 synthesis during bovine sperm capacitation.
4.3 Introduction
In somatic cells, Na/K-ATPase is located in two distinct compartments (raft and non-raft) in the
plasma membrane. The raft pool of the enzyme was involved in relaying the ouabain signal to
intracellular compartments via activation of various protein kinases, thereby initiating pathways
critical for numerous cellular functions (Li & Xie 2009). In our investigation on involvement of
lipid rafts in ATP1A4 signaling during bovine sperm capacitation (Chapter 2), total content of
ATP1A4 was increased in both raft and non-raft membrane fractions of capacitated sperm
compared to uncapacitated sperm. During spermatogenesis, somatic histones are replaced by
sperm-specific protamines, resulting in a highly stable chromatin condensation, and a
transcriptionally inactive sperm genome. A long-standing premise in sperm biology is that
mature sperm cannot synthesise new proteins (with few exceptions). Therefore, increased
![Page 111: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/111.jpg)
87
ATP1A4 content during capacitation challenges this existing dogma and merits further
investigation.
Translation of sperm RNAs are required for successful completion of capacitation, or to
replace degraded proteins. For example, AKAP3 protein concentrations decreased (degradation)
during capacitation (Hillman et al. 2013), and the 12S rRNA, a component of the 28S small
subunit of the 55S mitochondrial ribosome, were identified in the polysome fractions. Since
polysomes are indicative of active translation, it is possible that AKAP3 was likely translated by
the sperm mitochondrial ribosome (Gur and Breitbart 2006). The c-myc protein has a short half-
life (10 to 30 min) in somatic cells (Dani et al. 1985); however, the presence of c-myc protein in
mature sperm indicates the potential for translation by c-myc mRNA (Kumar et al. 1993). Since
cytoplasmic ribosomal components are absent in sperm, studies have questioned the possibility
of de novo translation during capacitation. Interestingly, mitochondrial translation inhibitors such
as chloramphenicol inhibited synthesis of new proteins, suggesting the role of mitochondrial
ribosomes as a potential location for atypical sperm RNA translation in sperm. Consequently, we
examined mechanisms responsible for the capacitation-dependent increase in ATP1A4 content in
bovine sperm.
4.4 Materials and methods
4.4.1 Semen collection and preparation of reagents
Please refer to Chapter 2 Section 2.3.1 for detailed experimental procedures. In addition, stock
solutions of actinomycin D (5 mg/ml in acetone) were stored at − 20 °C and a working solution
(1 mg/ml) were prepared in Sp-TALP. Chloramphenicol stock solution (10 mg/ml in Milli-Q
water) was prepared and a working solution (100 µg/ml) was prepared in Sp-TALP.
![Page 112: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/112.jpg)
88
4.4.2 Sperm preparations for in vitro capacitation and assessment of motility and tyrosine
phosphorylation
Sperm were capacitated in various concentrations and volumes, depending on the specific
experimental objective (1 x 109 sperm for isolation of lipid rafts; 100 x 10
6 sperm for Na/K-
ATPase enzyme activity; 10 x 106 sperm for Na/K-ATPase expression and transcription and
translational inhibition). Capacitation was induced with either ouabain (50 nM) or with heparin
(10 µg/ml) containing IBMX (100 µM) and dbcAMP (1 mM) and incubated for 4 h at 39 °C in a
humidified incubator with 5% CO2. The latter combination was included as one of the study
groups, as these conditions consistently capacitate bovine sperm. Transcription and
mitochondrial translation were inhibited with 100 µg/ml of actinomycin D and 100 µg/ml of
chloramphenicol. These inhibitors were co-incubated with either ouabain or heparin for 4 or 10
h, respectively. In addition, a vehicle control (acetone alone) was included as a group in the
actinomycin D study to rule out possible effects mediated by acetone on ATP1A4 transcription.
Longer incubation times of chloramphenicol could be attributed to the reduced penetration of the
inhibitor/drug in the midst of membrane perturbations (drastic changes in membrane fluidity)
during capacitation as well as phylogenetic differences in the sensitivity of the eukaryotic
mitochondrial system to the antibiotic as compared to prokaryotes (Ott et al. 2016).
4.4.3 Isolation of raft and non-raft fractions from bovine sperm
Please refer to Chapter 2 Section 2.3.2 for detailed experimental methodology related to raft and
non-raft isolation from uncapacitated and capacitated sperm.
![Page 113: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/113.jpg)
89
4.4.4 Immunoblotting
Sperm proteins were separated on 10% PAGE gels and electrotransferred to nitrocellulose
membranes. After blocking with 5% (w/v) skim milk in TTBS for 1 h, membranes were
incubated with the following antibodies: Na/K-ATPase α4 (1:10,000; custom-made antibody at
University of Calgary, Canada), and bodipy (1:2500; Invitrogen, Burlington, ON, Canada)
overnight at 4 °C. Membranes were washed (3X) in TTBS for 10 min and subsequently
incubated with HRP conjugated goat anti-rabbit IgG for 1 h at RT. Following washing,
immunoreactive bands were detected using chemiluminescence. Membranes were stripped and
probed with β-tubulin antibody (1:10,000; Sigma Aldrich, Oakville, ON, Canada) to ensure
equal protein loading.
4.4.5 Flow cytometry
After the capacitation period, heparin-capacitated sperm was treated with protamine sulphate
(20 µg/ml) to detach agglutinated sperm and facilitate single-cell suspension. All groups were
subsequently washed in PBS to remove capacitation-associated reagents. Then, 1 µl of Fixable
Live and Dead Cell Stain (Thermo Fisher Scientific) was added to the sperm suspension and
incubated for 30 min at RT. Sperm were fixed with 2.5% PFA for 15 min and blocked with 5%
chicken serum (Sigma Aldrich) for 45 min at RT. Anti-ATP1A4 antibody (7 µg/ml) was added
and incubated overnight at 4 °C. Alexa-conjugated anti-rabbit secondary antibody (Invitrogen)
was added (1:1000) for 1 h at RT and data acquired using a BD LSR II cytometer (BD
Biosciences, Mississauga, ON, Canada). The excitation source was a diode pumped solid state
(DPSS) 488 nm laser. Voltage settings (log scale) used were as follows: FSC – 165, SSC – 165,
FITC – 588, violet – 438. Compensation was applied to minimise overlap of the violet
![Page 114: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/114.jpg)
90
fluorescence being detected in the green channel. Subsequently, Detector 1 (emission range of
450 ± 25 nm) was used for detecting violet fluorescence (viability status), whereas Detector 2
(emission range of 530 ± 15 nm) was used for detecting green (ATP1A4) fluorescence. A total of
20 x 103 events were recorded for uncapacitated and capacitated sperm samples in the form of a
scatter plot and histogram. The resulting flow cytometric data were analysed by computing
relative median fluorescence intensity (MFI) of each sample.
4.4.6 Na/K-ATPase enzyme activity
The ATP1A4 activity was determined as described (Spokas & Spur 2001). Extracted sperm
membrane proteins were incubated (30 min at 39 ºC, pH 7.4) in a reaction mixture containing
100 mM NaCl, 15 mM KCl, 5 mM MgCl2, 50 mM Tris-HCl, and 4 mM Tris-ATP, with and
without 1 mM ouabain. The Na/K-ATPase enzyme hydrolyses ATP to form ADP and Pi
(inorganic phosphate); this reaction was stopped with 10% sodium dodecyl sulphate (SDS)
which denatures the enzyme. Ammonium molybdate/ascorbic acid solutions (0.1 and 10%,
respectively) were added for color development (30 min at RT). The inorganic phosphate that is
released couples with ammonium molybdate to form a phosphomolybdate complex, which is
reduced to a deep blue color (molybdenum blue) in the presence of a reducing agent (ascorbic
acid) and quantified in a Genesys UV-Vis spectrophotometer at 870 nm (Thermo Fisher
Scientific). The Na/K-ATPase activity was calculated as the difference in the Pi concentration in
the presence or absence of 1 mM ouabain. Enzyme activity (Pi concentration) was normalised to
total protein concentration to express total activity of Na/K-ATPase (pmoles of Pi/μg of
protein/min). However, ATP1A4 comprised 75% of the total Na/K-ATPase content (based on
![Page 115: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/115.jpg)
91
immunoblotting) in bull sperm, similar to that reported for rat sperm (Wagoner et al. 2005).
Therefore, in this thesis, total Na/K-ATPase activity was presented as ATP1A4 activity.
4.4.7 Isolation of sperm RNA and real-time PCR
Percoll-washed sperm were used for capacitation and subsequent RNA isolation to prevent
contamination with somatic cells and leukocytes. Total RNA from sperm was isolated using
TRIzol reagent (Thermo Fisher Scientific), following the manufacturers protocol. The final RNA
pellet was washed with 1 ml of 75% ethanol, air dried and re-suspended in 10 µl of nuclease-free
water (Ambion, Burlington, ON, Canada). The RNA samples were treated with DNase using the
protocol in the DNase kit (Thermo Fisher Scientific). Concentrations of RNA were measured
using a NanoDrop UV/Vis spectrometer (Thermo Scientific, Wilmington, DE, USA) at 260 nm
and samples stored at -80 °C until used for subsequent analysis. Sperm RNA (25 ng) was
reverse-transcribed using the high capacity cDNA reverse transcription kit (Thermo Fisher
Scientific) according to the manufacturer’s instructions. Results pertaining to Figure 4.6A were
based on the intron-spanning primers for the targeted transcripts, designed using the NCBI
primer designing tool (Table 4.1). Presence of full-length ATP1A4 mRNA was demonstrated by
designing primer sequences that spanned the entire length of the mRNA (Table 4.2).
The PCR amplifications were performed in a 25-µl reaction volume using StepOnePlus
Real-Time PCR system (Applied Biosystems, Burlington, ON, Canada) and AmpliTaq fast DNA
polymerase (Fast SYBR Green master mix, Applied Biosystems) with 10 pmol of each primer
and 25 ng of cDNA. The PCR conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C
for 30 s, primer-dependent annealing temperature for 30 s, then 72 °C for 2 min, followed by a
final extension at 72 °C for 10 min. In addition, a negative control (without cDNA) and no
![Page 116: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/116.jpg)
92
template control were included to ensure specific amplification. The PCR products were purified
using E.Z.N.A cycle pure kit (Omega Bio-Tek Inc, Norcross, GA, USA) and both strands were
sequenced (DNA sequencing lab, University of Calgary, Calgary, AB, Canada) and their identity
confirmed with NCBI BLAST. The amount of ATP1A4 was normalised against GAPDH for
each sample and relative expression was calculated using the 2−ΔΔCT (threshold cycle) method.
![Page 117: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/117.jpg)
93
Table 4.1: Primer sequences used for detecting ATP1A4 mRNA in bovine sperm
Gene GenBank accession # Forward primer Reverse primer Product size
(bp)
Atp1a4 NM_001144103.2 GTGTGCTAGGGGTCTGCTTC GCCCCACGAAACAGAGGTTA 108 bp
Gapdh NM_001034034.2 CAGGTTGTCTCCTGCGACTT TGTCGTACCAGGAAATGAGCTT 109 bp
Table 4.2: Primer sequences used for detecting full-length ATP1A4 mRNA in bovine sperm
Location on the
ATP1A4 gene GenBank accession # Forward primer Reverse primer Product size
(bp) 800 – 1200 bp NM_001144103.2 TTTGGGCTCTCGCTTATCTTGG TGTCAGGGTCAGGCATACTGTG 123
1 – 200 bp NM_001034034.2 TCCAAACCCAGGACCTACAA ATTTGTGATCATCCATGACTACTTC 116
1610 – 1760 bp NM_001034034.2 ACGCCTTCCAAAACGCCTA TTCAAGAAGCAGAACCCTAGCA 70
2600 – 3000 bp NM_001034034.2 TTCGTCAGCATCGTGATCGT TCTTGTTTTTCATGCCCTGCTG 91
![Page 118: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/118.jpg)
94
4.4.8 Detection of protein synthesis by fluorescent amino acid incorporation during
capacitation
Sperm were prepared for in vitro capacitation (as detailed above) in the presence or absence of
chloramphenicol under ouabain-induced capacitating conditions. Cells were partially
permeabilized with 0.02% Triton X-100 for 30 s and incubated with a charged lysine transfer
RNA labelled with the fluorophore BODIPY-FL (FlouroTect Greenlys in vitro translation system,
Promega, Madison, WI, USA), which incorporates into lysine residues during protein translation.
Sperm were pelleted and lysed with a buffer containing 250 mM sucrose, 50 mM imidazole, 1
mM EDTA, pH 7.4 with 0.1% sodium deoxycholate, and protease inhibitor tablets for 45 min on
ice. The ATP1A4 antibody was coupled to protein A beads (GE Life Sciences, Mississauga, ON,
Canada) for 1 h on a rocker at 4 °C and subsequently incubated with capacitated total-cell lysates
from control and chloramphenicol-treated groups for 4 h and eluted at 70 °C for 2 min. The
immunoprecipitated eluate was electrophoresed under standard conditions (see Section 4.4.4).
4.4.9 Statistical analyses
Results are shown as mean ± SEM, with the number of samples indicated. Median fluorescence
intensity values from the flow cytometric analyses were tested using Mann-Whitney U test. Data
from Na/K-ATPase enzyme activity, PCR, detergent soluble and insoluble ATP1A4 expression
and sperm kinematic parameters were analysed by one-way ANOVA, followed by a post-hoc
Tukey’s test. Results of ATP1A4 content from raft and non-raft fractions, translation and
transcription inhibition experiments were analysed using repeated-measures ANOVA (with main
effects of groups (raft and non-raft) and treatments (incubation conditions), followed by Tukey’s
![Page 119: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/119.jpg)
95
multiple comparison post-hoc test. All data were analyzed with commercial statistical software
(GraphPad Software Inc., La Jolla, CA, USA) and P < 0.05 was considered significant.
4.5 Results
4.5.1 Content of ATP1A4 increased in raft and non-raft membrane fractions during
capacitation
Since Na/K-ATPase mediates cell signaling through its association with lipid rafts and non-rafts
in the plasma membrane, we evaluated relative distribution of ATP1A4 molecules in both raft
and non-raft sperm membrane fractions during capacitation. Ouabain and heparin (4 h)
capacitating conditions induced significant increase in ATP1A4 content in both raft and non-raft
fractions compared to control samples (control 4 h and 0 h; Figure 4.1A and B).
![Page 120: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/120.jpg)
96
Figure 4.1. ATP1A4 content in membrane fractions under ouabain- or heparin-induced
capacitating conditions. (A) Bovine sperm (1000 x 106 cells) were capacitated for 4 h and
membrane (raft and non-raft) fractions were immunoblotted for ATP1A4. The image was
consolidated by removing the middle lane of the western blot (indicated by dividing line). (B)
Mean pixel intensity of ATP1A4 was calculated and recorded as arbitrary units. a-d
Values
without a common letter differed (P < 0.05)
4.5.2 Content and activity of ATP1A4 is increased during capacitation in detergent
soluble sperm protein extracts
In the absence of a suitable loading control for raft and non-raft membrane preparations, total
sperm extracts were used to determine whether content and activity of ATP1A4 increased during
capacitation. Consistent with our membrane data, ATP1A4 content was higher in the group
capacitated by ouabain or heparin, compared to control groups (control 4 h and 0 h) in detergent-
soluble lysates (Figure 4.2A and B). To determine if increase in total protein levels were
associated with an increase in function (enzyme activity), activity was measured in both
uncapacitated and capacitated sperm. Similar to the increase in the ATP1A4 content, enzyme
activity was higher in the ouabain-capacitated group compared to all other groups (Figure 4.2C).
![Page 121: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/121.jpg)
97
Figure 4.2. Content of ATP1A4 and activity in detergent-soluble sperm protein extracts
prepared from ouabain or heparin capacitated sperm. (A) Bovine sperm were capacitated for
4 h and detergent-soluble sperm cell homogenates (extracted under sodium deoxycholate
conditions) were immunoblotted to determine ATP1A4 content. The pellet that remained after
detergent extraction was boiled in sample buffer to determine content of β-tubulin. (B) Relative
pixel intensity of detergent-soluble ATP1A4 content was calculated by normalizing mean pixel
intensity of ATP1A4 to β-tubulin. (C) Enzyme activity of ATP1A4 was recorded as hydrolysis
of ATP to inorganic phosphate (Pi) in the presence of 1 mM ouabain and normalised to total
protein content (pmoles/µg of protein/min) from uncapacitated and capacitated groups and their
incubation control. Data were expressed as mean ± SEM (n = 5). a-d
Values without a common
letter differed (P < 0.05)
![Page 122: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/122.jpg)
98
4.5.3 Capacitation-associated increase in content of ATP1A4 was not due to translocation of
ATP1A4 from subcellular compartments
To ascertain that an increase in membrane ATP1A4 content was not due to translocation from
other subcellular compartments, sperm proteins were extracted from the insoluble sperm pellet
left after detergent solubilisation (detailed above) from capacitated sperm [ouabain and heparin
(4 h)] and its incubation controls (control 4 h and 0 h; Figure 4.3A and B) with a
radioimmunoprecipitation (RIPA) assay buffer. The RIPA buffer contained 1% Triton X-100,
0.1% SDS and 0.5% sodium deoxycholate which should extract cytoskeletal, nuclear and
mitochondrial-associated proteins. Demonstration of similar content of ATP1A4 among all four
groups excluded the possibility of protein translocation to the plasma membrane from other
sperm compartments.
Figure 4.3 Analysis of ATP1A4 levels in detergent-insoluble extracts from ouabain and
heparin capacitated sperm. (A) Representative western blot data on sperm insoluble protein
extracts, prepared solubilizing the pellet left after sodium deoxycholate extraction in RIPA buffer
and subsequently probed with ATP1A4 antibody. (B) Relative pixel intensity of detergent-
![Page 123: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/123.jpg)
99
insoluble ATP1A4 content was calculated by normalizing mean pixel intensity of ATP1A4 to β-
tubulin. Data shown were expressed as mean ± SEM (n = 5).
4.5.4 Confirmation of capacitation-associated increase in content of ATP1A4 by flow
cytometry
We used flow cytometry to confirm capacitation-associated increase in ATP1A4 content. Gate
settings, distinctions between dead and live sperm population and their corresponding dot plots
were shown in the flow cytometry profile (Figure 4.4A). Ouabain-capacitated sperm had
increased ATP1A4, as evidenced by the histogram shifted to the right (right shift) on the FITC
log scale on the x-axis (Figure 4.4B) and also increased relative median fluorescence intensity
values compared to heparin or controls (Table 4.3).
![Page 124: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/124.jpg)
100
Figure 4.4 Analysis of ATP1A4 content in fixed sperm (flow cytometry) under ouabain- or
heparin-induced capacitating conditions. (A) Capacitated sperm were labelled with ATP1A4
antibody and levels of fluorescence recorded; P1 represented the total cell population analysed;
P2 represented dead cells; P3 denoted viable cells; P4 corresponded to ATP1A4 fluorescence
from the viable population; Q1 & Q3 dot plots corresponded to viable sperm that had low and
high ATP1A4 fluorescence respectively; and Q2 & Q4 corresponded to dead sperm with low and
high ATP1A4 fluorescence, respectively. (B) Representative fluorescence intensity histogram
from capacitated and uncapacitated sperm.
![Page 125: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/125.jpg)
101
Table 4.3: Relative median fluorescence intensity (flow cytometry) values from
uncapacitated and capacitated sperm immunostained with ATP1A4 antibody
Group Relative MFI
Control 0 h 1591a
Control 4 h 3298b
Ouabain 4 h 4732c
Heparin 4 h 4310d
a-d Values without a common superscript differed (p < 0.05)
4.5.5 Capacitation of bull sperm in presence of actinomycin D did not prevent capacitation
associated increase in ATP1A4 content
Roles of transcription/translation machinery to increase ATP1A4 content during capacitation
were investigated. Capacitation of sperm with ouabain or heparin in presence of actinomycin D
(inhibitor of gene transcription) did not affect capacitation-associated increase in content of
ATP1A4 compared to the respective control (incubation in control 4 h; Figure 4.5A and B).
![Page 126: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/126.jpg)
102
Figure 4.5. Effects of actinomycin D on ATP1A4 transcription during capacitation of
bovine sperm. (A) Total sperm homogenates were prepared from sperm incubated with and
without actinomycin D in presence of either ouabain or heparin for 4 h and immunoblotted with
ATP1A4 antibody. (B) Content of ATP1A4 was normalized to β-tubulin and relative pixel
intensity calculated. a-d
Values without a common letter differed (P < 0.05)
4.5.6 Capacitation of bull sperm in presence of chloramphenicol inhibited capacitation
associated increase in ATP1A4 content
Because actinomycin D did not affect ATP1A4 content, we quantified ATP1A4 mRNA content
and evaluated effects of chloramphenicol (inhibitor of mitochondrial translation) on ATP1A4
protein content during capacitation. Although ATP1A4 mRNA was present in bull sperm, there
was no significant difference in the content of ATP1A4 mRNA between control (sperm
incubated in control 4 h) and capacitated groups (ouabain and heparin (4 h); Figure 4.6A).
However, capacitation of sperm [ouabain and heparin (4 h)] in the presence of chloramphenicol
partially decreased ATP1A4 content, suggesting mitochondrial translation of ATP1A4 mRNA
during capacitation (Figure 4.6B and C). Based on relative pixel intensity data, ouabain and
heparin capacitated sperm had 24 and 12% increases, respectively, compared to incubation
![Page 127: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/127.jpg)
103
control alone (Sp-TALP 4 h) in the absence of chloramphenicol. Similar patterns of decrease
were noticed for ouabain (22%) and heparin (12.5%) capacitated sperm in the presence of
chloramphenicol. In addition, presence of full-length ATP1A4 mRNA in bovine sperm was also
demonstrated (Figure 4.7).
![Page 128: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/128.jpg)
104
Figure 4.6 Effects of chloramphenicol on ATP1A4 translation during capacitation of bovine
sperm. (A) Real-time PCR was used to quantify ATP1A4 mRNA content in uncapacitated and
capacitated sperm and normalised to GAPDH levels. (B) To study effects of chloramphenicol on
ATP1A4 protein content, sperm were incubated with and without chloramphenicol in presence
of either ouabain or heparin for 10 h, and total sperm homogenates were probed for ATP14
content. (C) Pixel intensity for ATP1A4 was expressed for various treatment groups after
normalizing values to that of β-tubulin from the respective groups. Data shown were expressed
as mean ± SEM (n = 3) (D). a-e
Values without a common letter differed (P < 0.05).
![Page 129: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/129.jpg)
105
Figure 4.7 Screenshots of NCBI blast corresponding to the sequenced PCR products
obtained from ATP1A4 mRNA in bull sperm
![Page 130: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/130.jpg)
106
4.5.7 Detection of protein synthesis by fluorescent amino acid incorporation during
capacitation
A conclusive demonstration for protein synthesis requires demonstration of amino acid
incorporation during capacitation. Under ouabain-induced capacitating conditions, sperm
incorporated the charged lysine transfer RNA tagged with bodipy, which was evident by an
increase in the intensity of band at ~110 kDa and the presence of additional bands (~ 75, 50 and
37 kDa) in the total cell lysate. This incorporation was partially inhibited in the presence of
chloramphenicol (Figure 4.8A).Reprobing this immunoblot with ATP1A4 antibody
demonstrated that this 110 kDa band contained ATP1A4 (Figure 4.8A). Immunoprecipitation of
total protein extracts (prepared from sperm capacitated with or without chloramphenicol) with
ATP1A4 antibody, followed by immunoblotting with bodipy, further confirmed a partial
decrease in the content of bodipy-tagged ATP1A4 in the group capacitated in presence of
chloramphenicol (Figure 4.8B and C).
![Page 131: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/131.jpg)
107
Figure 4.8. Inhibition of ATP1A4 synthesis in the presence of chloramphenicol (CP) during
capacitation. (A) Total sperm lysates were prepared from ouabain-capacitated sperm in the
presence or absence of chloramphenicol, immunoblotted with bodipy, stripped and reprobed with
ATP1A4 and β-tubulin antibodies. (B) Immunoprecipitation of total lysates with ATP1A4
antibody and subsequent immunoblotting with bodipy antibody. (C) Pixel intensity for ATP1A4
was expressed for various treatment groups after normalizing values to that of β-tubulin from the
respective groups. Data shown were expressed as mean ± SEM (n = 3). *P < 0.05.
4.6 Discussion
To understand mechanisms by which ATP1A4 activates multiple signaling pathways during
sperm capacitation, we investigated capacitation-associated changes in distribution of ATP1A4
in both raft and non-raft sperm membrane fractions. Results demonstrated that content of
ATP1A4 increased in both raft and non-raft fractions from capacitated sperm in comparison to
uncapacitated sperm. To confirm that ATP1A4 content increased in the plasma membrane,
immunoblotting experiments were conducted using protein extracts (detergent-soluble and
detergent insoluble) prepared from capacitated and uncapacitated sperm. Results of these studies
also demonstrated a capacitation-associated increase in the content and activity of ATP1A4,
which was not due to capacitation-associated relocation of ATP1A4 to sperm plasma membrane
![Page 132: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/132.jpg)
108
from other subcellular components. In addition, flow cytometry-based quantification of ATP1A4
from capacitated sperm also demonstrated capacitation-associated increase in the content of
ATP1A4. Synthesis of ATP1A4 was further confirmed by demonstrating bodipy-labeled
ATP1A4 in sperm protein extracts prepared from capacitated sperm, potentially through
mitochondrial translation of ATP1A4 mRNA present in sperm. To our knowledge, this is the first
report on capacitation-associated increase in the content of ATP1A4 and total activity of
ATP1A4 in bovine sperm.
We first isolated raft and non-raft fractions from sperm plasma membrane using a non-
detergent methodology (sodium carbonate), as the classical detergent (Triton X-100) approach
solubilized Na/K-ATPase, leading to its release from lipid rafts to the non-raft fraction (Wang et
al. 2004, Cross 2004). Despite using a similar sperm concentration (1000 x 106
cells) across
various treatment groups, the capacitation process increased the content of ATP1A4 in both raft
and non-raft fractions in comparison to these fractions from uncapacitated sperm. However,
these experiments lacked a loading control, as actin and β-tubulin are not suitable for this
purpose (Thaler et al. 2006, Donatello et al. 2012). Therefore, to confirm an increase in
ATP1A4, immunoblotting experiments were conducted using total sperm homogenates
(detergent-soluble extracts) prepared from capacitated and uncapacitated sperm, where β-tubulin
could be used as a loading control. Consistent with membrane fraction data, whole-sperm
extracts also had increased ATP1A4 content during capacitation.
A previous study demonstrated an increase in plasma membrane ATP1A4 during rat
sperm capacitation due to translocation of this protein to sperm membrane from other subcellular
compartments (nucleus, cytoskeleton, cytosol, etc.; Jimenez et al. 2012). To rule out possible
translocation of ATP1A4 from subcellular compartments to sperm membrane during sperm
![Page 133: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/133.jpg)
109
capacitation, we compared ATP1A4 content in detergent-insoluble extracts of uncapacitated and
capacitated sperm. If there was capacitation-associated redistribution of ATP1A4 to the sperm
surface, there would have been decreased ATP1A4 in other subcellular compartments (detergent-
insoluble extracts) and a concurrent increase in ATP1A4 in the membrane (detergent-soluble
extracts) at the end of the capacitation period. However, our results excluded this possibility, as
ATP1A4 content were similar in detergent-insoluble homogenates prepared from uncapacitated
versus capacitated sperm. Alternatively, an increased content of ATP1A4 at the plasma
membrane could be due to unmasking of epitopes during capacitation due to removal of steric
hindrance factors that mask antibody binding sites (Villarroya & Scholler 1987, Boue et al.
1996). However, this possibility was unlikely, as we observed a concurrent increase in ATP1A4
enzyme activity along with increased content of ATP1A4. Antibodies also behave differently in
fixed cells versus total cell extract, due to the accessibility of the epitope to the antibody and
protein configuration (He & Fox 1996). Therefore, we used flow cytometry in fixed
uncapacitated and capacitated cells to compare our results from immunoblotting experiments.
Results from both these approaches were in complete agreement regarding the total increase in
ATP1A4 during capacitation.
The DNA of mature sperm is generally considered transcriptionally inactive due to its
association with protamines. However, sperm might still undergo transcription, as the histone-to-
protamine conversion is not 100% complete and approximately 5-15% of sperm DNA is still
packed with histones in mammalian sperm (Gatewood et al. 1987), leaving the possibility for
gene transcription in sperm (Naz 1998). Furthermore, actinomycin D inhibited RNA (90-95%)
and protein concentrations (75%) in bovine sperm (Premkumar & Bhargava 1972). Therefore,
perhaps the ATP1A4 gene was transcribed and translated, leading to ATP1A4 protein synthesis
![Page 134: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/134.jpg)
110
during sperm capacitation. To test this hypothesis we capacitated sperm with or without
actinomycin D. We demonstrated that ATP1A4 content was similar between sperm capacitated
with or without actinomycin D. We believe that the effects of actinomycin D were specific to
sperm because we used swim-up sperm populations for capacitation which were devoid of
contaminating leukocytes, epithelial cells and bacteria. In addition, the inhibitory concentration
of actinomycin D for RNA polymerase II (transcribes protein-coding genes) is > 1 µg/ml
(Bensaude 2011) for somatic cells and the inhibitor has been reported to intercalate with little or
no reversibility within the GC rich sequences within minutes of exposure. Moreover, it takes
only ~ 10 – 20 min to transcribe a gene length of 20,000 bp in humans (Heyn et al. 2015).
Considering the rapidity of actinomycin D action, average transcription time and the
concentration (1 mg/ml) we used in our study, we assert that the observed inability of
actinomycin D to block capacitation-associated increase in ATP1A4 was not due to
impenetrability of the inhibitor, insufficient incubation time (4 h) or concentration. Therefore, we
inferred that ATP1A4 gene transcription and subsequent translation of the sperm RNA was not
the mechanism behind increased content of ATP1A4 during sperm capacitation. Alternatively,
we considered the possibility that increased ATP1A4 content during capacitation was due to
translation of mRNA, which had been transcribed during spermatogenesis.
During spermatogenesis, mRNAs are synthesised and stored due to a global cessation in
transcription, which occurs several days before post-meiotic male germ cell differentiation
(Braun 1998). The ability of sperm to store and protect these RNAs until fertilization and
activation of the embryonic genome suggests a physiological function, despite translational
quiescence. We investigated translation of ATP1A4 mRNA as a potential mechanism leading to
increased content of ATP1A4 during capacitation. In that regard, we first quantified ATP1A4
![Page 135: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/135.jpg)
111
mRNA in uncapacitated versus capacitated sperm. Similar content of ATP1A4 in uncapacitated
and capacitated sperm supported our previous conclusion that transcription of ATP1A4 gene is
not occurring during capacitation and the possibility of capacitation-associated translation of
ATP1A4 mRNA as a potential mechanism behind the increased content in sperm. Although it
has been generally assumed that there is a direct relationship between mRNA and protein levels,
there was only a 40% correlation between mRNA and protein abundance in mammalian cells,
presumably due to transcription and mRNA degradation (Tian et al. 2004, Mata et al. 2005, de
Sousa Abreu et al. 2009, Vogel & Marcotte 2012). Since mRNAs can undergo several rounds of
translation initiation, elongation and termination (Decker & Parker 2012), it is possible that
regulation at the translational level (the proportion present in polysomes, and the speed of
translation) may influence the correlation between mRNA and protein abundance (Brockmann et
al. 2007, Maier et al. 2009). Therefore, the increased content of ATP1A4, despite the similar
mRNA content, could have been affected by one or more of the above-mentioned steps.
Based on high-throughput technologies (e.g. RNA sequencing), ejaculated sperm contain
a complex repertoire of transcripts and intact mRNAs (Das et al. 2013, Card et al. 2013, Sendler
et al. 2013). Furthermore, the subcellular localisation of mRNA in sperm is documented
(Kumar et al. 1993). It was suggested that de novo protein translation from sperm mRNA is
essential to supplement proteins that were degraded or to support functional changes during
capacitation (Gur & Breitbart 2006). This de novo protein production was also demonstrated in
other mammals (Gur & Breitbart 2006), suggesting a widespread existence of this mechanism
across species. Since sperm lack classical cytoplasmic machinery (Ostermeier et al. 2002,
Gilbert et al. 2007), mitochondrial ribosomes seem to be responsible for protein synthesis during
capacitation. A gold-standard assay to demonstrate de novo protein synthesis is incorporation of
![Page 136: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/136.jpg)
112
radioactive labeled aminoacids (35
S Methionine and 35
S Cysteine) into newly synthesised
polypeptides. However, due to concerns regarding personnel safety and disposal limitations, we
used an alternative approach which incorporated bodipy-labeled amino acids (lysine) to detect de
novo ATP1A4 synthesis during capacitation (Doi et al. 2002). Bodipy-tagged lysine was
incorporated in several proteins at ~ 110, 75, 50 and 37 kDa; however, in the presence of
chloramphenicol (mitochondrial translation inhibitor), band intensities at ~110 and 37 kDa were
partially inhibited, whereas bands at 75 and 50 kDa were completely abolished, suggesting that
protein synthesis occurred during bovine sperm capacitation. To determine whether the 110 kDa
band was comprised of ATP1A4, we stripped and reprobed the bodipy incorporated blot with
ATP1A4 antibody. Using this system, there was ~22% decrease in ATP1A4 in total proteins
extracted from sperm capacitated in presence of chloramphenicol. In a similar study, when rat
sperm were treated with chloramphenicol under capacitating conditions, the content of ATP1A4
was reduced by 80% (Gur & Breitbart 2006). We speculated apparent differences in the
percentage inhibition of ATP1A4 could be due to different conditions used for capacitating rat
and bovine sperm, which in turn could have affected sensitivity of mitochondrial ribosomes to
the inhibitor (chloramphenicol). In a study by Cunningham and Bridgers (Cunningham &
Bridgers 1970), there was a 30% reduction in protein synthesis when chloramphenicol was added
to brain mitochondrial population, whereas Bosman & Hemswoth (1970) reported a 60%
reduction in mitochondrial protein synthesis in the cerebral cortex, indicating differential
sensitivity of ribosomes to chloramphenicol among studies. To conclusively demonstrate protein
synthesis, we immunoprecipitated ATP1A4 from total cell lysates and measured
immunoreactivity of bodipy in the presence of chloramphenicol.
![Page 137: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/137.jpg)
113
The exact mechanism by which nuclear-encoded ATP1A4 mRNA is translated by
mitochondrial ribosomes remains unclear. We propose a possible mechanism by which protein
synthesis could occur in sperm where translation of ATP1A4 transcripts could occur in
mitochondrial-type ribosomes in localised regions within the sperm head (Figure 4.9). The
mRNAs are targeted to subcellular compartments in diverse somatic cells that display
compartmentalization and polarisation, e.g. neurons (Besse & Ephrussi 2008). Accordingly, it
was proposed that the nucleus, perinuclear theca, and the post-acrosomal sheath could serve as
mRNA repositories in sperm (Miller & Ostermeier 2006). We previously documented that the
ATP1A4 protein is localised to the sperm head (Newton et al. 2010). Therefore, it is reasonable
to speculate that localised translation of ATP1A4 mRNA could occur in the sperm head. Perhaps
ATP1A4 mRNA could exist as a translationally inactive mature ribonuclear protein particle
(RNP) due to its association with RNA binding proteins (RBP), motor proteins (kinesins and
dyneins) and translational repressors. However, transport of this mRNA from the site of
transcription to sperm head and its existence at this site in a translationally repressed form,
awaiting appropriate translation-inducing stimuli, remains speculative.
It is noteworthy that only cytoplasmic ribosomes have been implicated in translation
initiation in other cell types. However, mitochondrial or mitochondrial-type ribosomes may
perform a similar function in sperm, as cytoplasmic machinery is lost during spermatogenesis
(Toshimori 2009). Interestingly, extra-mitochondrial localisation of mitochondrial ribosomes,
especially 16s rRNA, has been demonstrated in murine oocytes and zygotes (Ninomiya &
Ichinose 2007) and sperm nucleus (Villegas et al. 2002) and functional competency of such
mitochondrial ribosomes has been demonstrated in Drosophila embryos (Amikura et al. 2001,
Amikura et al. 2005). All these studies supported our proposition that ribosomal RNAs and
![Page 138: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/138.jpg)
114
proteins could form functional mitochondria-type ribosomes outside mitochondria. In the current
model (Figure 4.9), we hypothesise that ATP1A4 mRNA, mitochondrial or mitochondrial-type
ribosomes and translation initiation and elongation factors are present outside the mitochondria
(perinuclear theca and post-acrosome regions in the head) in ejaculated sperm. However, the
ATP1A4 mRNA is prevented from being translated due to the inhibitory action of RBPs and the
unavailability of a functional 55 S mitochondrial ribosome in ejaculated sperm. Capacitation
associated changes removes the inhibitory effect of RBPs and the binding of the mRNA and
tRNAMet
to the small ribosome subunit (28 S) are facilitated by the mitochondria initiation
factors, mtIF3 and mtIF2, respectively. The latter step is markedly enhanced in the presence of
GTP. These initial steps recruit the large ribosome subunit (39 S) to join the small ribosome
subunit (28 S) and thereby a fully functional mitochondrial ribsome is assembled which
stimulates dissociation of mtIF3 and mtIF2. The initiation phase is completed and translation can
proceed with the elongation and termination phase leading to production of a functional protein.
Perhaps post-translational modifications of ATP1A4 are carried out by membrane-
associated molecular chaperones and their ability to interact with proteins through hydrophobic
and electrostatic interactions, ultimately guiding them to productive folding and transportation
pathways. One of the most highly expressed molecular chaperone complexes in haploid germ
cells is the chaperonin containing T-complex/TCPI-ring complex (CCT/TRiC; (Silver 1985) that
acts as the folding machinery for 5 – 10% of newly synthesised proteins (Kubota et al. 1994).
Mature human and rat sperm have an intact CCT/TRiC complex in the sperm head (Dun et al.
2012); perhaps this chaperone complex is conserved across species and regulates productive
folding of nascent proteins to functional proteins and its transport to the sperm membrane.
![Page 139: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/139.jpg)
115
In summary, we provided evidence that mitochondrial ribosome-associated translation of
ATP1A4 mRNA accounted for the increased ATP1A4 content in bull sperm during capacitation.
Furthermore, the ability of sperm to synthesise protein highlighted the importance of atypical,
yet functional translation pathways to meet physiological demands during capacitation and opens
up new areas of investigation in mammalian sperm biology.
![Page 140: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/140.jpg)
116
Figure 4.9 Hypothetical schematic view of the possible mechanisms involved in translation
of sperm mRNA during capacitation. During spermatogenesis, RBPs bind with pre-mRNA in
the nucleus and are subsequently exported together to the cytoplasm of spermatocytes and early
round spermatids. The RBP-mRNA complex further recruits motor proteins, which allows them
to be transported along the cytoskeletal protein network to the developing sperm head. During
the transport, RBPs block the association of the translation initiation machinery with the mRNA,
thereby keeping the transcript inactive. The perinuclear theca (PT) and postacrosomal sheath
(PS) in the sperm could serve as translation sites in the sperm head. B) The localised mRNA in
the PT and PS are kept silent in the ejaculated sperm (uncapacitated) due to its association with
RBPs and lack of a translation competent mitochondrial ribosome (55 S comprised of 39 S and
29 S subunits). C1) During capacitation, post-translational protein modifications such as
phosphorylation, release the mRNA from the inhibitory effect of RBPs. C2) Translation
initiation factors, mtIF3 and mtIF2 facilitate binding of the mRNA and tRNAMet
, respectively, to
28 S in the presence of GTP hydrolysis. C3) Molecular events described in C2 initiate binding of
39 S to 28 S-mRNA-tRNA complex and formation of a functional 55S mitochondrial or
mitochondrial-type ribosome, followed by the dissociation of the mtIF3 and mtIF2-GDP
complex from the 28 S. C4) Synthesis of ATP1A4 protein and its translocation to the plasma
membrane. Dotted lines indicate sperm tail.
![Page 141: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/141.jpg)
117
Chapter Five: Development and validation of laboratory assays to determine content and
activity of testis-specific isoform of Na/K-ATPase (ATP1A4) in bull sperm
5.1 Abstract
Traditional BBSE eliminates bulls that are grossly abnormal; however, bulls classified as
satisfactory potential breeders still vary in field fertility, implying submicroscopic differences in
sperm characteristics. ATP1A4 is involved in regulation of sperm motility and capacitation in
bulls, by virtue of its enzyme activity and signaling functions. The objective was to develop and
validate laboratory assays to determine content and activity of ATP1A4 in frozen-thawed bull
sperm. We developed a flow cytometry-based assay for quantification of ATP1A4 content and
validated a colorimetric assay for determining ATP1A4 activity in bull sperm. Fixation with
2.5% PFA and use of fixable live and dead cell stain yielded adequate conditions for detection of
ATP1A4 flourescence in viable sperm by flow cytometry. Isolation of sperm membrane protein
extracts in the presence of ionic detergent like sodium deoxycholate yielded maximum enzyme
activity after 30 min of post incubation with substrate ATP. The enzyme assay was also validated
and variability (intra- and inter-assay) and accuracy of the enzyme assay were < 20% and
<120%, respectively. In future studies, content and activity of ATP1A4 will be determined from
bulls with known fertility status to evaluate the association between these parameters and field
fertility.
![Page 142: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/142.jpg)
118
5.2 Introduction
Improving reproductive efficiency of cattle is important for meeting global demands for animal
proteins. In that regard, bull fertility is particularly critical, as one bull can breed thousands of
females by artificial insemination (AI), or 20 to 30 females under natural breeding situations.
Traditional BBSE eliminates bulls that are grossly abnormal. However, bulls or their semen
samples classified as satisfactory still differ in fertility, suggesting submicroscopic differences in
the sperm characteristics (Larson & Miller 2000). Consequently, it would be of great benefit for
the cattle industry to develop marker-based laboratory assays to complement a traditional BBSE
and to better predict variations in bull fertility. As proteins already present in mature sperm
(without additional protein synthesis) are responsible for sperm function, the content and activity
of these sperm proteins may reflect molecular/submicroscopic differences and serve as
biomarkers of fertility. Accordingly, Sutovsky (Sutovsky et al. 2015) identified ubiquitin in
defective sperm (negative biomarker), whereas positive biomarkers are proteins that are up- or
down-regulated in morphologically normal motile sperm. Examples of positive biomarker
proteins include fertility-associated antigen (FAA; (Bellin et al. 1998b), osteopontin (OPN;
(Cancel et al. 1997), lipocalin type-D prostaglandin (PGD) synthase (Gerena et al. 1998) and
type-2 tissue inhibitor of metalloproteinases (TIMP-2; (McCauley et al. 2001).
A ubiquitous integral membrane protein, Na/K-ATPase is responsible for maintaining
Na+
and K+ gradients across the plasma membrane of most mammalian cells. The α subunit of
Na/K-ATPase is the catalytic subunit responsible for the enzyme activity by binding to Na+, K
+,
ATP and ouabain (Jorgensen et al. 2003). It is noteworthy that inhibition of ATP1A4 with
ouabain inhibits several motion characteristics in rat sperm, including total and progressive
motility and several sperm kinematic parameters (Jimenez et al. 2010). However, in bull sperm,
![Page 143: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/143.jpg)
119
ATP1A4 inhibition did not significantly decrease total sperm motility (Thundathil et al. 2006),
suggesting species differences regarding the role of ATP1A4 in regulation of sperm function.
Therefore developing assays to quantify ATP1A4 content and activity may enable us to develop
novel diagnostic approaches for fertility predictions.
Although a radioactive and a colorimetric assay are available to quantify ATP1A4
activity in sperm samples (Zhao & Buhr 1996, Blanco & Mercer 1998), both approaches have
limitations, including handling radioactive substrates and complex methods of membrane
isolation from sperm which would be difficult in a commercial AI industry setting. Therefore
there is a need to develop and validate an enzyme assay that circumvents these limitations.
Validation of an enzyme assay includes all procedures that demonstrate an assay which is used
for quantitative measurement of a particular analyte of interest (Pi released from Na/K-ATPase)
in a given biological sample (sperm) is reliable and reproducible for the intended use. Some of
the fundamental parameters for validation include precision, accuracy and linearity.
Flow cytometry was preferred for quantification of ATP1A4 content, since it is widely
accepted and used technique by AI industries. Flow cytometry analyzes cells based on their size
and granularity and studies have correlated the flow cytometric detection of sperm proteins to the
fertility status of breeding bulls (Lovercamp et al. 2007, Dogan et al. 2015).
Since the content and activity of ATP1A4 in sperm may regulate bull fertility, objectives
of the current study were to: i) develop a flow cytometry-based assay for quantification of
ATP1A4 content; and ii) develop and validate an enzyme assay for determining ATP1A4
activity. Our long-term goal is to use these assays for fertility predictions.
![Page 144: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/144.jpg)
120
5.3 Materials and methods
5.3.1 Validation of Na/K-ATPase activity assay
5.3.1.1 Processing of frozen-thawed sperm bull sperm
The enzyme and flow cytometry assay were validated using frozen-thawed bull semen. First,
frozen semen straws were thawed (60 s) in a water bath maintained at 37 °C. Then, semen was
gently layered on top of 45% percoll in PBS and centrifuged (400 x g for 20 min at RT).
Resulting sperm pellets were washed once again in PBS to remove percoll and number of sperm
in the pellet was determined (hemocytometer).
5.3.1.2 Preparation of sperm membrane protein extracts
To extract sperm membrane proteins, 50 x 106
sperm was re-suspended in 500 µl of extraction
buffer containing 250 mM sucrose, 50 mM imidazole, 1 mM EDTA, pH 7.4 with either 0.1%
sodium deoxycholate or 0.25% Triton X-100 or 0.5% CHAPS, and protease inhibitor tablets
(Roche Diagnostics, Indianapolis, IN, USA) for 45 min on ice, with occasional vortexing. After
incubation, samples were centrifuged (12 000 x g for 10 min at 4 °C) and the supernatant
containing the total membrane proteins was kept on ice pending further analyses. Protein content
was determined with spectrophotometry (Thermo ScientificTM
Genesys 10S UV-Vis, Burlington,
ON, Canada) using a protein assay kit (DCTM
Protein Assay; Bio-Rad, Hercules, CA, USA).
5.3.1.3 Determination of ATP1A4 activity in sperm
Please refer to Chapter 4 Section 4.4.6 for detailed experimental procedures.
![Page 145: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/145.jpg)
121
5.3.1.4 Validation parameters for ATP1A4 activity assay
The ATP1A4 activity assay was validated by determination of linearity, precision, and accuracy.
Linear dependency of Pi formation were determined for varying time points and protein
concentrations. Precision was evaluated through repeatability and reproducibility. To assess
reproducibility (inter-assay variability), frozen-thawed semen sample from the same bull was
assayed three times over a period of 1 wk to determine inter-assay CV. Repeatability (intra-assay
variability) was assessed with multiple replicates (n = 5) from the same bull on a single day in
the same reaction to calculate the intra-assay CV. Accuracy was determined through spike
recovery and dilutional linearity. Known amounts of KH 2 PO4 (positive control, releases
inorganic phosphate when mixed with water) was spiked into the biological sample (extracted
sperm protein) and Pi concentration (recovery values) was compared to spiked samples in
extraction buffer alone. Recovery of Pi was evaluated at various dilutions of spiked samples.
5.3.2 Flow cytometric evaluation of ATP1A4 content in fresh sperm
Percoll-washed sperm (5 x 106) were incubated with 1 µl of Fixable Live and Dead Cell Stain
(Thermo Fisher Scientific) for 30 min at RT. The live and dead cell stain incorporates into
primary amines on the surface of live cells, resulting in a dim fluorescence, whereas both surface
and internal primary amines of proteins are exposed to the stain in dead cells, thereby resulting in
brighter fluorescence. The remainder of the procedure follows exactly the same protocol
explained in Chapter 4 Section 4.4.5.
![Page 146: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/146.jpg)
122
5.3.3 Immunolocalization of ATP1A4 in sperm
For immunostaining, sperm were adhered onto poly-l-lysine coated slides and subsequently fixed
with 2.5% PFA for 15 min (treatment 1), fixed with 2.5% PFA and permeabilized with 0.1%
Triton X-100 for 5 min (treatment 2), or fixed and permeabilized with – 20 °C methanol for 5
min (treatment 3), followed by washing in PBS and incubation with 10% normal chicken serum
for blocking. Anti-ATP1A4 antibody was incubated at 1:100 dilution in 1% chicken serum
overnight at 4 °C. Following washing in PBS, chicken anti-rabbit alexa 488 antibody was added
at 1:1000 for 1 h at RT. Cells were washed in PBS and mounted with Vectashield containing
DAPI and stored at – 20 °C pending imaging.
5.3.4 Statistical analyses
Data were analysed with commercial software (GraphPad Software Inc., La Jolla, CA, USA).
Data from effects of detergents on ATP1A4 activity were analysed by two-way ANOVA,
followed by Tukey’s post-hoc test. For all statistical analyses, p < 0.05 was considered
significant.
5.4 Results
5.4.1 Validation of ATP1A4 enzyme activity
Sperm proteins extracted with sodium deoxycholate had a significantly higher enzyme activity
compared to extraction with either Triton X-100 or CHAPS (Figure 5.1A). Furthermore, there
was an increasing linear trend in Pi concentrations over 15 and 30 min time points with various
protein concentrations. At higher protein concentrations (total protein of 100 and 160 µg/µl),
linearity decreased, especially at longer incubation times (45 and 60 min; Figure 5.1B). Inter-
![Page 147: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/147.jpg)
123
assay and intra-assay CVs ranged from 11 to 19% and 1.9 to 2.8%, respectively (Table 5.1 and
5.2). Spike recovery was close to 100% for low-, medium- and high-spikes (Table 5.3) and
ranged from 98 to 127% for linearly diluted samples (Table 5.4).
Figure 5.1. Validation of ATP1A4 enzyme activity in frozen-thawed bull sperm. (A) Effects
of 0.1% sodium deoxycholate, 0.25% Triton X-100, and 0.5% CHAPS, pH 7.4 on activity of
ATP1A4. Total protein concentrations ranging from 100 to 150 µg/µl were isolated using the
above-mentioned conditions were assayed for ATP1A4 activity by hydrolysis of ATP for 30 min
in the presence of 1 mM ouabain. B) Linear dependency of Pi formation on incubation time was
determined using intervals ranging from 15 to 60 min, whereas linearity of Pi formation on
![Page 148: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/148.jpg)
124
protein content was determined using protein concentrations ranging from 20 to 160 µg/µl
(based on sperm concentration in commercial semen straws [~40 x 106/ml] and thawing 2 to 10
straws). Data shown were expressed as mean ± SEM (n = 4). a-c
Values without a common letter
differed (P < 0.05).
Table 5.1: Precision of the enzyme assay evaluated by inter-assay CV.
Sample no Mean (pmol/µg of total
protein/min)
SD (pmol/µg of
total protein/min)
CV (%)
Bull 1 28.28 5.53 19.53
Bull 2 10.14 1.18 11.72
Table 5.2: Precision of the enzyme assay evaluated by inter-assay CV
Sample no Mean (pmol/µg of total
protein/min) SD (pmol/µg of
total protein/min) CV (%)
Bull 1 14.17 0.40 2.82
Bull 2 6.56 0.12 1.91
![Page 149: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/149.jpg)
125
Table 5.3: Accuracy of the enzyme assay evaluated through spike recovery
Sample no Spiking concentration
(pmoles/µl) Observed value
Expected
value Recovery
(%) Bull 1 Low (50 pmoles/ µl) 22.02 22.29 104
Medium (125pmoles/ µl) 48.84 50.76 103
High (200 pmoles/ µl) 77.57 78.53 101
Table 5.4: Accuracy of the enzyme assay evaluated through dilutional linearity
Sample no Dilution factor
(DF) Observed value
Expected
value Observed value x DF
Recovery
(%) Bull 1 Undiluted (800
pmoles) 349.98 349.98 349.98 100
400 pmoles (1:2) 189.67 379.94 108
200 pmoles (1:4) 98.45 393.8 112
100 pmoles (1:8) 50.78 406.24 116
50 pmoles (1:16) 25.67 410.72 117
![Page 150: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/150.jpg)
126
5.4.2 Validation of ATP1A4 content in frozen-thawed bovine sperm by flow cytometry
Frozen-thawed sperm were exposed to various fixation and permeabilization conditions.
Uniform staining of the sperm head was obtained after fixation with 2.5% PFA. However, sperm
fixed with 2.5% PFA and subsequently permeabilized with 0.1% Triton X-100 had decreased
staining intensity of ATP1A4, whereas no signal was obtained when sperm were fixed and
permeabilised with methanol (Figure 5.2A). Since ATP1A4 content in viable sperm is
physiologically significant, we investigated various amounts (0.75, 1.0 and 1.5 µl) of live and
dead cell stain, with 1 µl of dye sufficient to obtain distinct dead and live sperm populations
(Figure 5.2B). Gate settings and a representative flow cytometric profile showing the threshold
for distinguishing live and dead sperm population and for recording ATP1A4 fluorescence from
viable sperm, along with their corresponding dot plots, are shown in Figure 5.2C.
![Page 151: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/151.jpg)
127
Figure 5.2 Validation of flow cytometry to determine ATP1A4 content in frozen-thawed
bull sperm. (A) Optimization of fixation and permeabilization conditions for detection of
ATP1A4 in sperm by immunofluorescence. Uniform staining of the sperm head was apparent in
sperm fixed with 2.5% PFA, whereas an overall reduction in the staining intensity was noticed in
sperm fixed with a combination of 2.5% PFA and 0.1% Triton X-100. No staining was apparent
when sperm were fixed and permeabilized with methanol or after incubation with only secondary
antibody in the absence of ATP1A4 antibody. (B) Optimization of concentration of the fixable
live and dead cell stain by flow cytometry. Populations P2 and P3 represented dead and live
sperm, respectively. (C) Frozen-thawed sperm were labelled with anti-ATP1A4 antibody and
levels of fluorescence recorded; P1 represented the gated cell population that was analysed; P2
represented dead cells; P3 denoted the ATP1A4 fluorescence from viable population; Q1 & Q2
corresponded to dead cells with low and high ATP1A4 fluorescence, respectively; and Q3 & Q4
![Page 152: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/152.jpg)
128
dot plots corresponded to viable sperm cells that had low and high ATP1A4 fluorescence,
respectively.
5.5 Discussion
In this study, we developed a flow cytometric assay for quantification of ATP1A4 and
validated a colorimetric assay for determination of its activity in frozen-thawed beef bull semen.
Chemicals and reagents used in an enzyme assay should keep the protein of interest stable and
active. Therefore, the detergent used for extraction of proteins should be carefully chosen (de
Lima Santos & Ciancaglini 2000). In that regard, we compared three categories of detergents,
sodium deoxycholate (ionic), Triton X-100 (non-ionic) and CHAPS (zwitterionic) for
solubilisation of ATP1A4 from sperm plasma membrane and assayed for the enzyme activity.
Triton X-100 and CHAPS detergents yielded significantly lower enzyme activity compared to
sodium deoxycholate from sperm homogenates. One possible reason is that Triton X-100
inactivates proteins irreversibly by disrupting the quaternary structure of Na/K-ATPase
(Elesmann 1983), whereas deoxycholate activates proteins (Dahl & Hokin 1974). The traditional
method for assaying Na/K-ATPase activity from sperm is either a radioactive approach for
detecting inorganic phosphorus (Pi) released during catalysis of ATP (Blanco & Mercer 1998) or
a colorimetric approach with a citrate/arsenite/acetic acid solution (Zhao & Buhr 1996). There
are issues to both of these approaches; radioactive methodology requires special disposal
methods and has safety concerns, whereas colorimetric methods use strong acids that promote
non-enzymatic hydrolysis of phosphates (ERNSTER & LINDBERG 1956). Consequently, we
adapted a colorimetric method (Spokas & Spur 2001) using an ascorbic acid/ammonium
molybdate combination that can detect low concentrations (10 nmol of Pi) from membrane
![Page 153: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/153.jpg)
129
preparations but does not promote non-enzymatic hydrolysis of phosphates. Use of strong acids
(e.g. tricholorocetic or perchloric) results in precipitation of proteins that must be pelleted before
colour development is determined (Chifflet et al. 1988). In the Spokas and Spur procedure,
sodium dodecyl sulfate was used to terminate the reaction by rapidly denaturing the enzyme,
leaving proteins in solution and not affecting subsequent product measurement. Inter- and intra-
assay CVs of our enzyme assay were <20%, consistent with other practical enzyme assays (Reed
et al. 2002). Recovery (detection) of Pi in the assay was between 100 and 117% and in
accordance with a standard range of 90 to 120% (Wood et al. 2011). However, at higher total
protein concentrations and prolonged incubation, there was a loss of linearity. Perhaps at higher
enzyme concentrations, the rate of ATP hydrolysis by ATP1A4 gradually diminished with time,
as ADP accumulated (Emmelot & Bos 1966). Therefore, we decided to assay ATP1A4 enzyme
activity by indirectly measuring Pi release at 30 min post incubation.
Since procedures associated with semen processing could affect exposure of antigenic
motifs, we optimised fixation and permeabilization conditions for detection of ATP1A4 antigen
in sperm. We used a custom antiserum against a peptide sequence in the N-terminal
(cytoplasmic) side of ATP1A4, which required permeabilization for the antibody to gain access
to the intracellular epitope. Accordingly, we used either Triton X-100 or methanol to
permeabilize cells which resulted in inadequate staining of ATP1A4 in sperm. Since ATP1A4 is
membrane-bound, the non-ionic detergent Triton X-100 could disrupt protein association with
the lipid bilayer; perhaps the antigenic site of ATP1A4 was sensitive to membrane perturbations,
thereby reducing intensity of immunolabeling in sperm (Ariano et al. 1998). Furthermore,
extraction with Triton X-100 significantly decreased enzyme activity. Overall, we concluded that
Triton X-100 was unsuitable for detection of ATP1A4 antigen in sperm. In contrast, sperm fixed
![Page 154: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/154.jpg)
130
with PFA had intense localisation of ATP1A4 in the sperm head, consistent with the known
function of this enzyme. In some cells, PFA is known to increase membrane permeability
(Amidzadeh et al. 2014). Perhaps partial permeabilization during fixation increased accessibility
of the antibody to the ATP1A4 epitope, located on the cytoplasmic side. Flow cytometry was our
preferred detection method, as it is commonly used under field conditions to assess various
sperm functional parameters. Since sperm were fixed with PFA, standard dyes such as SYBR-14
or propidium iodide were inappropriate to distinguish the live and dead cell population by flow
cytometry. Therefore, we optimised a fixable live and dead stain that selectively incorporated
into the primary amines of proteins, thereby preserving the staining pattern following
formaldehyde fixation. Overall, these assays were deemed effective and reliable. Therefore,
using these assays, we subsequently investigated association among ATP1A4 content, activity
and field fertility in dairy bulls (Chapter 6).
![Page 155: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/155.jpg)
131
Chapter Six: Testis-specific isoform of Na/K-ATPase (ATP1A4) regulates sperm function
and fertility in dairy bulls through mechanisms involving reactive oxygen species,
intracellular calcium and actin polymerization
6.1 Abstract
Traditional BBSE eliminates bulls whose semen is grossly abnormal; however, bulls classified as
satisfactory potential breeders still vary in field fertility, implying submicroscopic differences in
sperm characteristics. ATP1A4 is involved in regulation of sperm motility and capacitation in
bulls through well-established enzyme activity and signaling functions. The objective was to
determine ATP1A4 content and activity and their relationship to post-thaw sperm function and
field fertility, using semen samples from LF and HF Holstein bulls (n = 20 each) with known
FERTSOL rates (measure of field fertility, based on 56-d nonreturn rates). Frozen-thawed sperm
from HF bulls had higher ATP1A4 content and activity compared to LF bulls. Furthermore, post-
thaw sperm from HF bulls showed an increase in tyrosine phosphorylation, ROS, F-actin
content, and low intracellular calcium in comparison to LF bulls. Subsequent incubation of HF
bull sperm with ouabain further augmented the post-thaw increase in tyrosine phosphorylation,
ROS production, and F-actin content, whereas the increase in intracellular calcium was still low
mpared to LF bull sperm. Content and activity of ATP1A4, ATP1A4-induced ROS, F-actin, and
calcium were significantly correlated with fertility. In conclusion, we inferred that ATP1A4 may
regulate sperm function through mechanisms involving ROS, F-actin, calcium and tyrosine
phosphorylation in frozen-thawed sperm of HF and LF bulls.
![Page 156: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/156.jpg)
132
6.2 Introduction
Traditional BBSE is intended to eliminate bulls that are grossly abnormal. However, semen from
bulls deemed satisfactory on a BBSE often differ in pregnancy rates by 20 – 25% (Larson &
Miller 2000). Therefore, we inferred that there may be submicroscopic differences among sperm
with apparently normal morphology. Consequently, there is a need to develop marker-based
laboratory assays to complement traditional BBSE and better predict these variations in bull
fertility. Sutovsky (Sutovsky et al. 2015) reported negative and positive biomarkers of fertility.
Negative biomarkers (e.g. ubiquitin) were detected predominantly in defective sperm, whereas
positive biomarkers (sperm proteins) were present in morphologically normal, motile sperm
except that the marker may either be down- or up-regulated or post-translationally modified. The
bovine artificial insemination (AI) industry uses elite bulls, including HF and LF bulls (3%
above and below the breed average, respectively) for breeding purposes. Consequently,
comparing sperm from bulls with varying levels of fertility may identify submicroscopic
differences (for example, expression of specific proteins) in sperm and determine molecular
markers of fertility.
Na/K-ATPase transduces the energy from ATP hydrolysis to catalyse the exchange of
cytoplasmic Na+ for extracellular K
+ (Kaplan 2002). In somatic cells, the ionic gradients
generated by the Na/K-ATPase play a central role in maintaining cell volume and pH and resting
membrane potential (Hoffmann & Simonsen 1989). Na/K-ATPase is an oligomer composed of
two major polypeptides, the α and β subunits. Interestingly, four isoforms of the Na/K-ATPase α
subunit, namely α1, α2, α3, and α4, are expressed in mammalian tissues. Although α1 is present
in nearly every tissue and it is believed to maintain the basal ion gradients in the cells, the other α
polypeptides are more restricted in their expression and appear to play tissue-specific roles
![Page 157: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/157.jpg)
133
(Blanco & Mercer 1998a, Mobasheri et al. 2000b). In particular, the α4 isoform is found in the
testis, where it is specifically expressed in the male germ cells after meiosis (Woo et al. 1999,
Blanco et al. 2000). Moreover, α4 has a very high sensitivity to ouabain, a characteristic that
most prominently distinguishes it from the α1 isoform (Blanco et al. 1999). The presence of a
Na/K-ATPase catalytic subunit with particular attributes, such as those of α4, suggests that this
polypeptide has a specific role in the physiology of sperm. In support of this, inhibition of α4
activity diminished total motility of spermatozoa (Woo et al. 1999, Sanchez et al. 2006).
Na/K-ATPase-ouabain interaction stimulates phosphorylation of downstream effectors
such as Src, EGFR which in turn recruit adaptor proteins like Grb2, SOS resulting in activation
of MAPK pathway and generation of second messengers such as calcium and reactive oxygen
species (ROS) (Ullrich & Schlessinger 1990, Liu et al. 2000, Haas et al. 2000). Furthermore,
downstream events associated with Na/K-ATPase signaling (increase in ROS, release of
intracellular calcium and actin polymerization) resemble events during sperm capacitation.
Controlled release of ROS drives capacitation-associated changes in sperm through redox
regulation of protein tyrosine phosphorylation and subsequent hyperactivation (de Lamirande &
Gagnon 1998, Rivlin et al. 2004). Factors that trigger tyrosine phosphorylation of proteins can
stimulate polymerization of actin monomers (G-actin) to actin polymers (F-actin). Bicarbonate
activation of cAMP/PKA pathway and oxidants such as H2O2 induce tyrosine phosphorylation of
gelsolin (an actin binding protein) which has a key role in F-actin formation (Liu et al. 2000,
Brener et al. 2003, Shahar et al. 2014). Apart from F-actin formation, in response to cAMP, there
is a pulsatile pattern of calcium release from intracellular stores (Aitken & Nixon 2013) which in
turn stimulates gelsolin to assemble actin filaments (Ickowicz et al. 2012) in the sperm head.
Furthermore, based on a computational approach, the capacitation network of boar sperm
![Page 158: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/158.jpg)
134
contained three important nodes, calcium, ATP and actin polymerization that are linked to one
another (Bernabo et al. 2011). Collectively, it appears that ROS, calcium and F-actin create a
self-perpetuating cascade with one process stimulating another during capacitation and thereby
affecting sperm fertility. In that regard, several studies have investigated the correlation of
various sperm functional parameters, including ROS, intracellular calcium (individually and/or
collectively) to fertility in frozen-thawed sperm (Collin et al. 2000, Peris 2008, Simoes et al.
2013, Del Olmo et al. 2014).
We previously reported that sperm from HF bulls were in transition to hyperactivation,
whereas LF bull sperm had only forward progression (Shojaei et al. 2012). Since ATP1A4 is
involved in regulation of sperm motility and capacitation, aims of the present study were to: i)
investigate ATP1A4 content and activity and measure sperm functional parameters such as
tyrosine phosphorylation, ROS, calcium, actin polymerization (indicated by F-actin content)
which also serve as downstream effectors of ATP1A4 signaling in HF and LF bull sperm; ii)
ATP1A4 -mediated regulation of tyrosine phosphorylation, ROS, calcium and actin
polymerization in HF and LF bull sperm; and iii) determine associations among fertility,
ATP1A4 content and activity, ATP1A4 induced ROS, calcium, and F-actin in HF and LF bulls.
6.3 Materials and methods
6.3.1 Frozen semen production
The study reported was approved by the University of Calgary Institutional Animal Care and Use
committee (protocol number M09078). Bull management, frozen semen production and fertility
evaluations were done by Semex Alliance Inc. as detailed below. Forty Holstein bulls maintained
under standard housing and feeding conditions at this AI center were used for this study. Based
![Page 159: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/159.jpg)
135
on a standard BBSE, all bulls were classified as satisfactory breeders. Semen was collected,
extended and cryopreserved in a standard Tris-egg yolk-glycerol extender (200 mM Tris, 66.7
mM Citric acid, 55.5 mM D-fructose, 594 mM glycerol, 1.10 Benzylpenicillin-G IU/L, 1.10
Streptomycin sulphate IU/L, 0.51 mM Lincomycin, 0.228 mM Spectinomycin, 200 mL/L Egg
yolk). Approximately 15 x 106 sperm were loaded into 0.25 ml straws and batches with a post-
thaw motility of atleast 25% motility and a rate of 3 were used for insemination in a minimum of
10 herds. The percentage of cows having not returned to estrus within 56 d after insemination
(56-d non-return rate; NRR) was determined optimal due to a high correlation of 96% with both
the 60 to 90-d NRR and 75-d NRR (Doormaal 1998). Estrus detection rate for Holstein herds in
Ontario ranged between 39 – 42% in small herds (<50 cows) and from 39 - 54% in larger herds
(>300 cows). Fertility was calculated based on 56-d NRR and was adjusted to include the month
of insemination, age of cow at insemination, semen price, breed of service sire, insemination
technician and herd management to produce the FERTSOL value. Bulls were classified as either
high fertility (FERTSOL > +3.6; range: 3.6 to 6.7) or low-fertility (FERTSOL < -4.0; range: -4
to -19). Frozen semen from HF and LF bulls (n = 20 each) were provided by Semex Alliance Inc.
and used for this study as described below.
6.3.2 Processing of frozen-thawed sperm from HF and LF bulls
Frozen straws of semen were thawed (60 s) in a water bath maintained at 37 °C. Briefly, sperm
was gently layered on top of 45% percoll and centrifuged (400 x g for 20 min at RT). Pellets
were washed once again in PBS to remove percoll and number of sperm in the pellet was
determined using a hemocytometer. For experiments detailed in Results Sections 6.4.1 and 6.4.2,
![Page 160: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/160.jpg)
136
samples were processed as mentioned above and immediately analyzed without further
incubation (0 h). For experiments related to Results Section 6.4.3, the sperm sample was divided
into two aliquots and incubated with and without 50 nM ouabain in Sp-TALP containing 1 mM
pyruvate, 25 mM NaHCO3, 2 mM Ca2+
at 39 °C in a humidified incubator with 5% CO2 for 2 h.
6.3.3 Preparation of sperm crude membrane extracts
Sperm crude membrane extracts were prepared as described in Chapter 5, Section 5.3.1.2.
6.3.4 Enzyme activity and flow cytometric evaluation of ATP1A4 content in frozen thawed
sperm of HF and LF bulls
Please refer to Chapter 4, Sections 4.4.5 and 4.4.6 for relevant experimental methodologies.
6.3.5 Measurement of intracellular ROS in HF and LF bull sperm
The intracellular ROS content in HF and LF bull sperm was measured using 2',7' –
dichlorodihydrofluorescein diacetate (H2-DCFDA, Sigma Aldrich) using flow cytometry. In this
assay, H2-DCFDA is a cell-permeable non-fluorescent probe which is de-esterified
intracellularly and becomes highly fluorescent 2′,7′-dichlorofluorescin after oxidation. Intensity
from 2′,7′-dichlorofluorescin increases as ROS production increases within the cell. Briefly,
percoll-washed sperm (10 x 106) was re-suspended in 1 ml PBS and incubated with H2-DCFDA
dye at a final concentration of 0.5 µM at 35 °C in the dark for 30 min before addition of
propidium iodide (PI; final concentration of 24 µM) and immediately analysed.
![Page 161: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/161.jpg)
137
6.3.6 Measurement of intracellular calcium in HF and LF bull sperm
Intracellular sperm calcium concentrations were measured as described (Harrison et al. 1993).
When calcium is not bound, the cell permeable probe fluo-3 AM is non-fluorescent but on
calcium ion binding, it becomes highly fluorescent. Percoll-washed sperm cells (10 x 106) were
loaded with the fluorescent probe fluo3-AM (Thermo Fisher Scientific) at a final concentration
of 10 µM for 30 min at 35 °C in the dark in the presence of 0.02% pluronic acid. Thereafter,
fluo-3 loaded sperm was resuspended in PBS before addition of PI and subsequently analysed by
flow cytometry.
6.3.7 Flow cytometric evaluation of F-actin content in HF and LF bull sperm
Formation of F-actin in sperm was evaluated by use of FITC phalloidin (a form of phallatoxin;
Thermo Fisher Scientific) which binds and stabilizes polymeric F-actin and is unable to bind to
monomeric G-actin. Post-thaw semen was washed in percoll as explained above and 10 x 106
percoll washed sperm was added to 1 µl of Fixable Live and Dead Cell Stain (Thermo Fisher
Scientific) and incubated for 30 min at RT. Subsequently, sperm were fixed with 4% PFA for 20
min, washed, permeabilized with 0.1% Triton X-100 for 5 min and incubated with 0.33 µM
FITC-phalloidin for 60 min at 37 °C. Thereafter, samples were washed in PBS and used for
further analysis.
6.3.8 Flow cytometry settings for fluoroprobes used in the study
For assessment of viability, DCFDA (ROS) and Fluo-3 (calcium) probes which fluoresce green
were combined with PI (red), whereas FITC-phalloidin (green) was combined with Fixable
violet live and dead cell stain (violet). Data were acquired using an Attune Acoustic Focusing
![Page 162: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/162.jpg)
138
Cytometer (BD Biosciences, Mississauga, ON, Canada). The excitation source was a 488 nm
laser for FITC and PI dyes and a 405 nm laser for the fixable live and dead (violet) dye. Voltage
settings used were as follows: FSC – 1250, SSC – 1650, FITC – 1500, PI – 2050, violet – 1650.
Subsequently, detector 1 (emission range of 450 ± 20 nm) was used for detecting violet
fluorescence (viability), detector 2 (emission range of 530 ± 15 nm) was used for detecting green
(FITC-phalloidin/DCFDA/fluo-3 fluorescence and detector 3 (emission range of 570 ± 10 nm)
was used for detecting PI (viability) fluorescence. A total of 20 x 103 events were recorded in the
form of a scatter plot and histogram. Resulting flow cytometric data were analysed by computing
the relative median fluorescence intensity (MFI) of each sample.
6.3.9 Assessment of sperm tyrosine phosphorylation
For evaluation of tyrosine phosphorylation, 5 x 106 sperm was concentrated (10,000 × g, 3 min,
RT) and the pellet washed (10 ,000 × g, 5 min) in 1 ml of PBS containing 0.2 mM Na2VO3. The
pellet was boiled in sample buffer for 5 min at 100 °C and the supernatant separated on 10%
PAGE gels and electrotransferred to nitrocellulose membranes. After blocking with 5% (w/v)
skim milk in TTBS for 1 h, the membrane was incubated with phosphotyrosine antibody
(1:10,000; Millipore, Billerica, MA, USA) overnight at 4 °C. Membranes were washed (3X) in
TTBS for 10 min and subsequently incubated with HRP conjugated goat anti-mouse IgG
(1:5,000) for 1 h at RT. Following washing, immunoreactive bands were detected using
chemiluminescence. Membranes were stripped and probed with β-tubulin antibody (1:10,000;
Sigma Aldrich) to ensure equal protein loading.
![Page 163: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/163.jpg)
139
6.3.10 Statistical analyses
Data were analysed with a statistical software program (STATA version 12, Statacorp LP,
College Station, TX, USA). Wherever necessary, data were log-transformed before further
analysis. Differences in the post-thaw ATP1A4 enzyme activity was analysed by student’s t-test.
Median fluorescent values for ATP1A4 content, ROS, calcium and F-actin from flow cytometry
between HF and LF bulls were analysed by Mann-Whitney U test. Spearman correlation
coefficients were calculated to determine the nature of relationship between ATP1A4 content,
activity, ATP1A4-induced ROS, calcium, F-actin and fertility. Multivariate regression analysis
was performed to determine the influence of ATP1A4 content, activity, ATP1A4- induced ROS,
calcium and F-actin content on bull fertility. For all statistical analyses, p < 0.05 was considered
significant.
6.4 Results
6.4.1 ATP1A4 content and activity in HF and LF bull sperm
Since ATP1A4 is the major isoform of Na/K-ATPase in sperm, content of ATP1A4 in the post-
thaw sperm of HF and LF bulls was determined by immunoblotting. The HF bull sperm had
higher content of ATP1A4, detected as a single band at 110 kDa, compared to LF bull sperm
(Figure 6.1A). Since content of ATP1A4 in viable sperm is physiologically relevant compared to
ATP1A4 expression from both dead and live sperm, ATP1A4 fluorescence were quantified from
viable sperm from HF and LF bulls using flow cytometry. The ATP1A4 fluorescence was higher
in HF bulls, manifested by a higher relative median fluorescence and the HF histogram pushed
more towards the right (right shift) on the FITC log scale (x-axis) compared to LF bulls. A
representative histogram (Figure 6.1B) and bar graph (Figure 6.1C) illustrated overall median
![Page 164: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/164.jpg)
140
fluorescence intensity from all HF and LF bulls used in this study. The enzyme activity was
measured by hydrolysis of the substrate ATP resulting in the accumulation of inorganic
phosphate (Pi) in the reaction mixture. Consistent with increased ATP1A4 content (as
demonstrated through western blotting and flow cytometry), HF bulls had higher enzyme activity
compared to LF bulls in their post-thaw sperm (Figure 6.1D).
![Page 165: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/165.jpg)
141
Figure 6.1. Post-thaw content and activity of ATP1A4 from HF and LF bulls. Representative
immunoblots (A) of ATP1A4 content from a subpopulation of HF and LF bulls (n = 14 each)
used in this experiment. Sperm pellet obtained after detergent extraction of ATP1A4 from HF
and LF samples was boiled in sample buffer to probe for β-tubulin to ensure equal sample
loading. (B) Sample histogram (from flow cytometry) of ATP1A4 content from a HF and LF
bull. (C) Overall median fluorescence data for the ATP1A4 content from viable sperm of all LF
and HF bulls (n = 20 each). (D) Bar graph of ATP1A4 activity (pmoles of Pi/µg protein/min)
from all LF and HF bulls (n = 20 each). Data shown were expressed as mean ± SEM. a,b
Values
without a common letter differed (P < 0.05).
6.4.2 Post-thaw sperm functional parameters in HF and LF bull sperm
Sperm functional parameters, including tyrosine phosphorylation, intracellular ROS, calcium and
F-actin content were determined in frozen-thawed sperm of HF and LF bulls. Sperm proteins at
~200, 150, 100 and 35 kDa (indicated by black solid arrows) had a higher intensity of tyrosine
phosphorylation in HF bulls (Figure 6.2A). Additionally, sperm from HF bulls had higher
content of ROS compared to LF bulls, shortly after thawing and a representative histogram is
shown in Figure 6.2B. Similarly, for actin polymerization post-thaw sperm from HF bulls had
more F-actin than LF bulls which is evident in the histogram (Figure 6.2C). In contrast, a sample
histogram obtained from post-thaw sperm of LF bulls had greater intracellular calcium
concentration compared to HF bulls (Figure 6.2D). Bar graphs depicting the overall median
fluorescence intensity for ROS, calcium and F-actin from all HF and LF bulls used in this study
were shown in Figure 6.2B, C and D.
![Page 166: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/166.jpg)
142
![Page 167: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/167.jpg)
143
Figure 6.2. Post-thaw sperm functional parameters in HF and LF bulls. Representative
immunoblot (A) of HF and LF total sperm proteins (n = 4 each); note differences in tyrosine
phosphorylation (indicated by black solid arrows) in post-thaw sperm. Protein loading was
assessed by β-tubulin. Representative histograms showing median fluorescence intensity values
from one HF and one LF bull for their (B) ROS, (C) F-actin and (D) calcium content.
Corresponding bar graphs depict overall median fluorescence values for ROS, F-actin and
calcium content from all HF and LF bulls. Data shown were expressed as mean ± SEM (n = 20
each). * P < 0.05.
![Page 168: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/168.jpg)
144
6.4.3 ATP1A4 induced changes in sperm functional parameters in HF and LF bull
sperm
There was a higher content of ATP1A4 and higher enzyme activity with concurrent increase in
tyrosine phosphorylation, ROS and F-actin content, along with low intracellular calcium in HF
bulls. Since the signaling function of ATP1A1 is involved in regulation of ROS, calcium, F-actin
formation and tyrosine phosphorylation in somatic cells, we investigated whether such a
mechanism could operate in sperm via ATP1A4. In order to determine if higher ATP1A4 content
in HF bulls was responsible for the above-mentioned changes in these functional parameters,
sperm from HF and LF bulls were incubated with ouabain. Incubation of HF bull sperm with
ouabain for 2 h showed higher content of tyrosine phosphoproteins, intracellular ROS and F-
actin in relation to LF bulls (in a time-dependent manner). Sperm proteins isolated from ouabain
treated HF bull sperm had higher intensity of tyrosine phosphorylation at 150, 100, 75 and 30
kDa (indicated by black solid arrows) compared to band intensities from ouabain-treated LF bull
sperm (Figure 6.3A). High intracellular ROS and F-actin were manifested by an increasing trend
line in HF bulls, with each point showing the difference between the median fluorescence
intensity values obtained from control and ouabain treated groups (Figure 6.3B and C). However,
trendlines for intracellular calcium were lower in HF bulls in contrast to the LF bulls (Figure
6.3D). In all end points assessed, HF and LF ouabain-treated sperm had increased ROS, F-actin,
protein tyrosine phosphorylation and calcium compared to control sperm.
![Page 169: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/169.jpg)
145
![Page 170: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/170.jpg)
146
Figure 6.3. Assessment of ATP1A4-induced changes in sperm functional parameters in HF
and LF bulls. Representative immunoblot (A) of sperm proteins (indicated by black arrows)
derived from control and ouabain-treated groups of HF and LF bulls for 2 h, and probed with
phosphotyrosine antibody (β-tubulin was used as a loading control). Patterns of intracellular (B)
ROS generation (C) F-actin (D) intracellular calcium release in HF and LF bull sperm were
represented by a trendline, with each dot/square representing normalised median fluorescence
intensity values obtained from control and ouabain-treated groups at 0 h and 2 h, respectively.
Data shown were expressed as mean ± SEM (n = 4). *, #
P < 0.05.
6.4.4 Relationship between ATP1A4 content, activity, sperm functional parameters and
fertility
The ATP1A4 content, determined through semi-quantitative densitometry (Western blotting) and
flow cytometry, enzyme activity, ATP1A4-induced ROS and F-actin, were positively correlated
to fertility (significant), whereas ATP1A4-induced calcium release had a significant negative
relationship with fertility (Figure 6.4 and Table 6.1). Among independent variables, enzyme
activity, ROS, F-actin were positively correlated, whereas calcium was negatively correlated to
ATP1A4 content (both were significant; Table 6.1) Since these experimental variables were
significantly correlated to each other, ATP1A4 content (flow cytometry) was chosen as the
![Page 171: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/171.jpg)
147
single predictor variable to determine changes in fertility. The predictive value of the ATP1A4
content for fertility was determined using regression analysis and calculated as fertility = - 37.58
+ 5.02 ATP1A4 content. Based on regression equation, ATP1A4 content influenced fertility (p <
0.05; Figure 6.5).
![Page 172: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/172.jpg)
148
Figure 6.4 Correlations of various predictor variables to fertility in Holstein bulls.
Association among ATP1A4 content (A: densitometry; B: flow cytometry); enzyme activity of
ATP1A4 (C); ATP1A4-induced ROS (D), F-actin (E), and calcium (F), and fertility of dairy
bulls, as demonstrated by correlation analysis.
Figure 6.5 Regression analysis for prediction of fertility in Holstein bulls
F e rtility
AT
P1
A4
co
nte
nt
-1 5 -1 0 -5 0 5
5
6
7
8
9
Y = -3 7 .5 8 + 5 .0 2 X
p < 0 .0 5
R2
= 0 .5 3 2
![Page 173: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/173.jpg)
149
Table 6.1: Correlation of ATP1A4 content (semi-quantitative densitometry and flow cytometry values), enzyme activity, ROS,
calcium and F-actin with fertility in HF and LF bulls
Variables ATP1A4
content
(densitometry)
ATP1A4
content (flow
cytometry)
Enzyme
activity
ROS Calcium F-actin
Fertility 0.6081* 0.7294* 0.4208* 0.4790* -0.5245* 0.6715*
ATP1A4 content
(densitometry)
- 0.6603* 0.2231 0.3951* -0.3987* 0.4392*
ATP1A4 content (flow
cytometry)
- - 0.4448* 0.3651* -0.4920* 0.5595*
Enzyme activity - - - 0.0178 -0.0897 0.4320*
ROS - - - - -0.3342 0.1745
Calcium - - - - - -0.1294
F-actin - - - - - -
* P < 0.05
![Page 174: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/174.jpg)
150
6.5 Discussion
Since mature sperm DNA is generally transcriptionally quiescent, sperm functions are regulated
by proteins already present without additional protein synthesis with few exceptions. Therefore,
sperm proteins may serve as molecular markers for variations in fertility of bulls or semen
classified as satisfactory potential breeders. In this study, we evaluated ATP1A4 content and
activity in frozen-thawed sperm from satisfactory potential breeders with varying levels of
fertility, and investigated potential mechanisms by which this protein regulates fertility.
Content of ATP1A4 and enzyme activity were higher in HF bulls compared to LF bulls.
A possible explanation for the difference in content could be attributed either to increased
sensitivity to cryo-elution (leakage of sperm components) of ATP1A4 from the sperm membrane
of LF sires during the process of freeze-thawing or these bulls inherently might have had a lower
content ofATP1A4. Unfortunately, it was not possible to investigate the latter possibility, due to
the lack of fresh semen from these bulls. Lateral phase separation of lipids and subsequent lateral
reordering of membrane components followed by the loss of PUFA and cholesterol are common
after freeze-thawing, which lead to leakage of many sperm components (cryo-elution).
Therefore, it is possible that membrane and cytoplasmic bound proteins and enzymes (Lasso et
al. 1994, Ollero et al. 1998, Lessard et al. 2000, Gadea et al. 2004) were cryo-eluted from sperm.
Due to significant membrane alterations in LF bull sperm (Shojaei et al. 2012), coupled with the
fact that Na/K-ATPase is extremely sensitive to its lipid environment (Duran et al. 2010),
perhaps ATP1A4 is cryo-eluted from the surface in higher amounts, leading to the decreased
content of ATP1A4 in frozen-thawed sperm from LF bulls. Cryo-elution of other sperm surface
proteins such as superoxide dismutase and P25b, have been described for human and bovine
sperm, respectively (Lasso et al. 1994, Lessard et al. 2000).
![Page 175: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/175.jpg)
151
Furthermore, we demonstrate herein, apparently for the first time, a significant predictive
value of ATP1A4 content to in vivo bull fertility. To determine relationships between sperm
proteins and bull fertility, it is critical to use in vitro procedures with good accuracy,
repeatability, and objectivity. In that regard, flow cytometry was our primary choice, whereas
immunoblotting was a secondary tool to complement flow cytometry data. Both approaches used
a custom antiserum against a peptide sequence in the N-terminal (cytoplasmic) side of ATP1A4.
During the procedure, cells were fixed with paraformaldehyde, which could increase membrane
permeability (Amidzadeh et al. 2014). Perhaps partial permeabilization during fixation increased
accessibility of the antibody to the ATP1A4 epitope, located in the cytoplasmic side. Flow
cytometry analysis of cells is based on their size; therefore, the presence of contaminants (e.g.
egg yolk particles from extender) could affect outcome (Kennedy et al. 2011). However, in our
study, we excluded all non-sperm events by appropriate gating, based on forward and side scatter
properties. Furthermore, a viability dye was used to quantify relative content of ATP1A4
exclusively from viable sperm due to its functional significance. Even though both western
blotting and flow cytometry yielded comparable results with regard to fertility, use of flow-
cytometry should be more practical than immunoblotting, since the former has already been
adapted to evaluate several other sperm functions in a commercial AI setting (Graham 2001,
Hossain et al. 2011). Apart from inhibiting enzyme activity, binding of ouabain to Na/K-ATPase
activates multiple downstream pathways, including increase in ROS, release of intracellular
calcium, actin polymerisation, and tyrosine phosphorylation of proteins. All of the above-
mentioned parameters of Na/K-ATPase-ouabain signaling are very similar to molecular events
during capacitation. Consequently, these downstream effectors which also serve as sperm
![Page 176: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/176.jpg)
152
functional parameters were measured to determine if ATP1A4 content was related to fertility in
HF and LF bulls.
In somatic cells where the ubiquitous isoform (ATP1A1) of Na/K-ATPase predominates,
communication between ATP1A1 and ROS forms a positive feedback loop, with ROS activating
the signaling function of ATP1A1, which in turn stimulates mitochondrial production of ROS
(Xie et al. 1999). In sperm, generation of ROS is a normal physiological process and controlled
concentrations of ROS function as important second messengers in signaling during sperm
capacitation. However, imbalances between ROS generation and scavenging activity are
deleterious to sperm function (Sharma & Agarwal 1996). Even though it is widely accepted that
increased ROS was related to cryo-capacitation (Bailey et al. 2000) and HF sperm had low ROS
concentration (Simoes et al. 2013, Del Olmo et al. 2014), the results from our flow cytometry
study suggest otherwise. One caveat associated with all studies involving flow cytometric
detection is the inability to establish a minimum threshold value for ROS levels; any value above
the threshold will be categorised as higher ROS production, whereas values below the threshold
will be classified as low in ROS generation (Zini & Sigman 2009). Due to the lack of a
consensus value, comparisons can be made only within a study and not across studies, which use
different protocols, fluorescent probes and different cytometers for analysis. We believe that in
our study, HF and LF sperm might have undergone a phenomenon different from cryo-
capacitation. This could be attributed to different sperm subpopulations; one subpopulation that
has normal plasma membrane with a better cryotolerance and another subpopulation having
capacitation-like changes (Farstad 2012). Perhaps there is a higher percentage of normal sperm
with a healthy, viable plasma membrane compared to the cryo-capacitated sperm subpopulation
in HF and LF groups that is responsible for a physiological response after thawing. Furthermore,
![Page 177: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/177.jpg)
153
the higher level of ROS in HF sperm may actually correspond to the minimum threshold needed
for successful capacitation.
Calcium is a universal intracellular second messenger with dynamic roles in
hyperactivation and sperm capacitation. In somatic cells such as cardiac myocytes, ouabain
regulates intracellular calcium via the Na/K-ATPase (Kelly & Smith 1993). Furthermore, a direct
interaction between the α subunit of Na/K-ATPase and IP3R, an intracellular calcium store
receptor has been identified in several studies (Miyakawa-Naito et al. 2003, Yuan et al. 2005).
Ouabain-activated signalplex can recruit and activate PLC-γ1 and the activated PLC-γ1 can
produce the ligand IP3, which binds to IP3R (Yuan et al. 2005) and opens intracellular calcium
stores, leading to an increase in intracellular calcium concentration. Subsequently, clearance
pumps, including the plasma membrane Ca2+
-ATPase (PMCA) and sodium-calcium exchanger
(NCX) function in order to remove the transient increase in cytosolic calcium concentration,
thereby keeping intracellular concentrations in a low resting state (Wennemuth et al. 2003, Olson
et al. 2011). The existence of PLC isoforms, presence of IP3 ligand and IP3R, PMCA, and NCX
has already been confirmed in sperm by various studies (Walensky & Snyder 1995, Ho & Suarez
2001, Parrington et al. 2002, Wennemuth et al. 2003). Considering that sperm are equipped with
the machinery needed for ouabain-induced calcium release, it is possible that low concentrations
of ouabain would activate a similar pathway by acting on ATP1A4 during capacitation. Previous
studies have indicated the cytosolic calcium concentrations were negatively correlated with
fertility; HF sperm had low intracellular calcium compared to LF sperm (Collin et al. 2000, Peris
2008). Consistent with other studies, we also noticed that HF bull sperm had low intracellular
calcium, despite a high ATP1A4 content. It is possible that calcium clearance mechanisms might
have been activated in HF bull sperm, which could have removed the increase in intracellular
![Page 178: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/178.jpg)
154
calcium induced by ouabain by the end of 2 h. In LF bulls, due to the presence of a defective
plasma membrane (Shojaei et al. 2012), sperm could have suffered from inefficient calcium
clearing mechanisms, which might have contributed to the increase in the calcium concentrations
at the end of 2 h. In summary, it is noteworthy that calcium increased in both fertility groups in
response to ouabain, albeit at a higher magnitude in LF sperm. Contrary to our results,
(Thundathil et al. 2006) reported no increase in cytosolic calcium concentrations in fresh sperm
after incubation with ouabain. It is likely that several variables, including the source of sperm
(fresh versus frozen thawed), duration of calcium measurement (4 versus 2 h) and the
fluoroprobes (Indo-1 AM versus fluo-3) could have contributed to the differences in results in
the presence of ouabain. Nevertheless, a significant correlation between ATP1A4-induced
calcium content and bull fertility was clearly evident in the present study.
Regulation of actin dynamics is pivotal for many sperm processes, including capacitation.
Two putative actin-binding sites have been identified in the α-subunit of Na/K-ATPase and
direct binding with actin filaments stimulate Na/K-ATPase activity (Cantiello 1995). Even
though studies of F-actin are very limited in frozen-thawed sperm, somatic cells provide
abundant clues regarding F-actin regulation in sperm. In epithelial cells, Na/K-ATPase was
involved in assembling actin at the tight junctions by modulating the Rho GTPase activity
(Rajasekaran et al. 2001, Rajasekaran & Rajasekaran 2003). In non-epithelial cells, targeted
production of ROS modulates actin reorganisation through a process that involves the GTP
binding protein Rho and the actin binding proteins cofilin (Carlier et al. 1999, Moldovan et al.
2000) or gelsolin (Shahar et al. 2014) Therefore, perhaps, increased ROS contributes to increase
in actin polymerisation in HF bull sperm. In sperm, Rho protein is localised to the acrosome
![Page 179: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/179.jpg)
155
(Baltierrez-Hoyos et al. 2012) and is involved in actin remodeling in capacitation of fresh sperm
(Brener et al. 2003).
In the present study, there was a link between ATP1A4 content and activity with in vivo
bull fertility through mechanisms involving ROS generation, calcium release and actin
polymerization. These results may aid in development of novel laboratory assays for better
prediction of fertility of bulls that are classified as satisfactory potential breeders based on
traditional BBSE. This could prevent subfertile semen from entering the market, thereby
improving the efficiency of cattle reproduction. Moreover, it is likely that single nucleotide
polymorphisms (SNPs) may be associated with this phenotype. Identifying such genetic markers
and its association with other production traits may enable genetic companies to utilize this
information for genome-enhanced selection of bulls.
![Page 180: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/180.jpg)
156
Chapter Seven: The ubiquitous isoform of Na/K-ATPase (ATP1A1) regulates junctional
proteins, connexin 43 and claudin 11 via Src-EGFR-ERK1/2-CREB pathway in
prepubertal rat Sertoli cells
7.1 Preamble
The entire chapter has been submitted to Biology of Reproduction and is currently under peer-
review
Title: The ubiquitous isoform of Na/K-ATPase (ATP1A1) regulates junctional proteins,
connexin 43 and claudin 11 via Src-EGFR-ERK1/2-CREB pathway in prepubertal rat Sertoli
cells
Gayathri D Rajamanickam, John P Kastelic and Jacob C Thundathil
G.D. performed 100% of the experiments, analysed the data and wrote the manuscript. J. T.
supervised the project. J.T and J.K contributed to critical thinking and reviewed the manuscript.
7.2 Abstract
Interaction of Na/K-ATPase with its ligand ouabain has been implicated in regulation of various
biological processes. The objective was to investigate roles of Na/K-ATPase isoforms in
formation and function of junctional complexes in Sertoli cells. Primary cultures of Sertoli cells
were obtained by enzymatic digestion of prepubertal (20 d) rat testes and grown on Matrigel-
coated dishes for 7 d. Sertoli cells predominantly expressed the ubiquitous isoform (ATP1A1) of
Na/K-ATPase, confirmed by immunoblotting, PCR, immunofluorescence and mass
spectrometry. Treatment of Sertoli cells with 50 nM ouabain increased transepithelial electrical
resistance (TER) and expression of claudin 11 and connexin 43, whereas 1 mM ouabain had
opposite effects. Involvement of Src-EGFR-ERK1/2-CREB pathway in ouabain-mediated
![Page 181: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/181.jpg)
157
expression of claudin 11 and connexin 43 was evaluated. Incubation of Sertoli cells with 50 nM
ouabain increased content of p-Src, p-EGFR, p-ERK1/2, and p-CREB; in contrast, 1 mM
ouabain decreased phosphorylation of these signaling molecules. Pre-incubation of Sertoli cells
with inhibitors of Src and MAPK pathways inhibited ouabain-induced effects on these signaling
molecules, TER, and expression of claudin 11 and connexin 43. In conclusion, we inferred that
ATP1A1 regulated Sertoli cell tight junctions and gap junctions through the Src-EGFR-ERK1/2-
CREB pathway. Ouabain is an endogenous steroid; therefore, its interaction with ATP1A1 may
be a critical signaling mechanism for regulation of Sertoli cell function and male fertility.
7.3 Introduction
Proliferation of Sertoli cells occurs during fetal and early neonatal life and continues until day
15 - 16 in rodents. Thereafter, Sertoli cells cease to proliferate and attain functional maturation
(differentiation), characterized by alterations in gene expression, establishment of the blood-
testis barrier (BTB) and sustained spermatogenesis (Sharpe et al. 2003, Tarulli et al. 2012). The
BTB physically divides the seminiferous epithelium into two physiological compartments (basal
and adluminal), which confers cell polarity, selectively permits transepithelial fluxes of ions and
molecules, and protects germ cell antigens from the immune system, thereby providing a
specialised microenvironment for development and differentiation of spermatocytes.
Ultrastructurally, BTB is comprised of specialised junctional complexes between adjacent Sertoli
cells near the basement membrane. There are three types of Sertoli cell junctional complexes in
the testis: tight junctions (TJs), gap junctions (GJs) and adherens junctions. However, tight
junctions are the only known occluding junctions in mammalian epithelia and endothelia and act
as the first line of defense against entry of small non-charged solutes, ions and macromolecules
![Page 182: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/182.jpg)
158
via diffusion through the paracellular pathway (Schneeberger & Lynch 2004). Several
transmembrane proteins have been localised to TJs, including claudins, occludin, and junctional
adhesion molecule (JAM). Occludin null male mice were infertile due to disrupted
spermatogenesis and few postmeiotic germ cells (Saitou et al. 2000). There are indications that
JAMs are not essential for formation and maintenance of TJs. Several primary and established
fibroblast cell lines have endogenous populations of JAM-A or JAM-C, but do not form TJs
(Morris et al. 2006). However, claudins appeared to be major structural components of TJ
strands and important for optimal establishment of tight junctions. Claudin 1 KO mice died from
dehydration, due to loss of tight junctional barriers to water and macromolecules in the epidermis
(Furuse et al. 2002). Furthermore, claudin 5 KO male mice had evidence of leakage into the
seminiferous lumen when tracer element was injected into the interstitial space (Morrow et al.
2009). Despite the presence of seven claudins (claudin 1, 3, 5, 7, 8 and 11) in the testis, claudin
11 seemed to be functionally relevant, as its deficiency resulted in loss of epithelial phenotype of
Sertoli cells (Mazaud-Guittot et al. 2010), followed by sterility due to lack of TJ strands and
seminiferous tubules filled with clumps of nucleated cells that lacked normal spermatogenesis
(Gow et al. 1999, McCabe et al. 2015).
Gap junctions are intercellular plasma membrane channels that provide a passage for ions
and molecules between cells that are forming junctions. The GJs facilitate intercellular
communication via non-covalent interaction of channels (coupled connexons) between two cells
or communicate with the extracellular environment via hemichannels (uncoupled connexons)
(Mruk & Cheng 2004, Li et al. 2009). Each connexon is comprised of six integral membrane
subunits or connexions, which in association with other connexons, form a GJ plaque. Within
seminiferous tubules, GJs are located in conjunction with occluding TJs (Eusebi et al. 1983)
![Page 183: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/183.jpg)
159
between Sertoli cells at the site of BTB, and between Sertoli and specific stages of germ cells
(McGinley et al. 1979, Mruk & Cheng 2004). Since GJs communicate signals between Sertoli
and germ cells, they may have a crucial role in germ cell movement during spermatogenesis
(Russell 1977). Several connexin members (connexin 26, 32, 33, 46, 50) have been identified in
adult testis, yet connexin 43 seems to be best studied, as it is predominantly located in the basal
compartment of the seminiferous tubules (Brehm & Steger 2005). Also, a connexin 43-targeted
deletion in mice resulted in male infertility (Plum et al. 2000) most likely due to arrest of
spermatogenesis and Sertoli-cell-only (SCO) syndrome, characterized by intratubular Sertoli cell
clusters and abnormal SC cytoplasmic vacuoles (Brehm et al. 2007, Sridharan et al. 2007).
Furthermore, disorganised spatial arrangements of claudin 11 and connexin 43 were noted in
men with primary seminiferous tube failure, presumably due to loss of BTB function (Haverfield
et al. 2013).
Ion transporters and ion channels interact with tight junction proteins (e.g., Na/K-
ATPase). Structurally, the sodium pump is a heterodimer composed of noncovalently linked α
and β subunits which transports 3 Na+ out and 2 K
+ into cells by hydrolysis of ATP. The
catalytic α subunit contains binding sites for Na+, K
+, ATP and also acts as a receptor for
cardiotonic steroids which specifically inhibit Na/K-ATPase. The β subunit is a glycosylated
membrane protein required for normal enzyme activity (Noguchi et al. 1987, Horowitz et al.
1990). Four distinct α isoforms (α1, α2, α3, α4) and three β isoforms (β1, β2, β3) have been
identified, with the α1 isoform having ubiquitous expression, whereas the α4 isoform was
expressed only in spermatocytes and sperm. In Sertoli cell line 93RS2, a low ouabain
concentration modulated expression of claudin 1 and claudin 11 mediated through the α4 isoform
of Na/K-ATPase (Dietze et al. 2015). In addition to maintenance of ionic homeostasis, the pump
![Page 184: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/184.jpg)
160
also regulates intracellular pH, cell volume and membrane potential. The ion transport function
of Na/K-ATPase affects ionic composition of seminiferous tubular fluid (Rato et al. 2010) and
intracellular pH of Sertoli cells (Oliveira et al. 2009). However, in addition to ion transport,
many ionic pumps also have non-classical (signaling) functions. For example, low doses of
ouabain modulated expression of connexin 32 (Larre et al. 2006) and regulated specific
expression and distribution of claudin 1, 2 and 4 via ERK1/2 and c-Src during the polarised
epithelial phenotype transformation in MDCK cells (Larre et al. 2010). However, the mechanism
by which the pumping and signaling activity of other isoforms of Na/K-ATPase in the regulation
of Sertoli cell tight junction and gap junctions are currently unknown. Therefore, the objective
was to determine effects of Na/K-ATPase-ouabain interaction in formation and function of TJs
and GJs in prepubertal rat Sertoli cells.
7.4 Materials and methods
7.4.1 Animals
Sprague-Dawley rats (20 d) were purchased from Charles River Laboratories (Quebec, QC,
Canada) and housed at the Health Science Animal Resource Centre (University of Calgary,
Calgary, AB, Canada). The study reported herein was approved by the University of Calgary
Institutional Animal Care and Use committee (protocol number AC13-0147).
7.4.2 Chemicals and antibodies
Ouabain, Collagenase, Hyaluronidase, Trypsin, Soybean trypsin inhibitor, RIPA buffer, Insulin-
Transferrin-Selenium (ITS) supplement, Epidermal growth factor (EGF), Bacitracin, and
Gentamycin were purchased from Sigma Aldrich, ON, Canada. Vectashield was purchased from
![Page 185: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/185.jpg)
161
Vector Laboratories, Burlingame, CA, USA. Transwell standing insert and Matrigel were
purchased from BD Biosciences, MA, USA. Corning cell recovery solution was from Corning,
NY, USA. Protease inhibitor tablets purchased from Roche Diagnostics, QC, Canada, four-well
chamber slides, cDNA reverse transcription kit, nuclease free water, DNase, TRIzol and DMEM-
F12 with HEPES were from Thermo Fisher Scientific, ON, Canada. Primary antibodies were
purchased from the following companies: AMH, WT-1, GATA-4, Actin (Santa Cruz
Biotechnology, TX, USA), ATP1A2 and claudin 11 (Thermo Fisher Scientific, ON, Canada),
ATP1A3 and VASA (Abcam, MA, USA), connexin 43, p-EGFR, p-ERK1/2, p-CREB, EGFR
(Cell Signaling Technology, MA, USA), ATP1A1, p-Src, Src, ERK1/2 (Millipore, MA, USA)
and affinity-purified ATP1A4 was custom made at Pierce Antibodies. Secondary antibodies were
purchased from Thermo Fisher Scientific, ON, Canada: chicken anti-rabbit Alexa 488 and goat
anti-rabbit Alexa 555. Secondary antibodies for immunoblotting (goat anti-mouse and anti-rabbit
IgG HRP conjugate) were purchased from Millipore, MA, USA.
7.4.3 Isolation and culture of prepubertal rat Sertoli cells
Testes from 20-d-old rats were decapsulated and cut into ~1 mm pieces, which were digested
with 40 mg trypsin and 0.8 mg DNase in a shaking water bath at 110 oscillations/min for 30 min.
Tubules along with interstitial cells were centrifuged at 800 x g for 2 min. Subsequently, they
were digested with 1 M glycine, 2 mM EDTA, pH 7.4 containing 0.01% STI and 0.8 mg DNase
for 10 min at RT to lyse interstitial cells. Intact tubules were washed by centrifugation at 800 x g
for 2 min and re-suspended in 40 mg collagenase and 0.2 mg DNase and allowed to shake at 110
oscillations/min for 30 min. Digested tubules were washed three times (centrifugation at 800 x g
for 2 min), and then re-suspended in media containing 40 mg hyaluronidase and 0.2 mg DNase
![Page 186: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/186.jpg)
162
and shaken at 110 oscillations/min for 30 min. Cells were washed five times by centrifuging at
800 x g, re-suspended in DMEM-F12 media containing 10 µg/ml insulin, 5 µg/ml transferrin, 2.5
ng/ml EGF, 5 µg/ml bacitracin and 20 µg/ml gentamycin, and then seeded with varying densities
(objective specific) on to Matrigel coated culture dishes/bicameral units in a humidified
incubator at 35 °C with 95% air and 5% CO2. Sertoli cells were cultured in the absence of serum
or androgens as these are positive inducers of several junctional proteins in Sertoli cells.
Therefore these chemicals were not added to Sertoli cell media during in vitro culture which
could potentially mask the original effect induced by ouabain. A hypotonic treatment (20 mM
Tris, pH 7.4 for 2.5 min; (Wagle et al. 1986)) was performed 48 h after culture to lyse
contaminating germ cells. Purity of Sertoli cell cultures were determined by various markers
namely, anti-Mullerian hormone (AMH), Wilms tumour (WT1), and GATA binding protein 4
(GATA4) by immunoblotting and microscopically by staining for WT1. Contamination of
Leydig cells and germ cells in Sertoli cell cultures were identified by their immunoreactivity to
3β-HSD and VASA/DDX4 (3beta-hydroxysteroid dehydrogenase and DEAD-box helicase 4,
markers for Leydig and germ cells, respectively).
7.4.4 Mass spectrometry on Sertoli cell extracts
Total Sertoli cell extracts were prepared as detailed in Section 7.4.8, electrophoresed under
standard conditions and stained with Coomassie brilliant blue G-250. All steps, including in-gel
trypsin digestion, LC-MS/MS analysis and database search for protein identification in the raft
and non-raft fractions were performed at the mass spectrometric facility, SAMS centre,
University of Calgary. Please refer to Chapter 3, Sections 3.3.3 and 3.3.4 for detailed procedures
on protein digestion and LC-MS/MS analysis. The following parameters were used for NCBI
![Page 187: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/187.jpg)
163
database search: Rattus norvegicus taxonomy, maximum of one missed trypsin cleavage,
methionine oxidation as variable modification, cysteine carbamidomethylation as fixed
modification, and a mass error tolerance of 20 ppm. All significant peptides had a MASCOT
expectation value <0.05 and an ion score >28. Scaffold (version Scaffold_4.3.2, Proteome
Software Inc., Portland, OR, USA) was used to validate MS/MS based peptide and protein
identifications. Protein identifications were accepted if they could be established at >95%
probability and contained at least two identified peptides.
7.4.5 Measurement of transepithelial electrical resistance (TER) of Sertoli cells
Matrigel-coated standing inserts were seeded with freshly isolated Sertoli cells at high density
(1.2 × 106 cells/cm
2) to promote TJ assembly that was quantified using a Millicell electrical
resistance system (Millipore), as described (Grima et al. 1998). Initially, TER was measured
across the Sertoli cell epithelium 24 h after cells were plated (i.e. day 1), and then daily until day
7. The resulting values were multiplied by the surface area of the filter (1.1 cm2) and data
presented as Ohm.cm2. The net value of electrical resistance was calculated by subtracting the
background resistance obtained by measurement of cell-free Matrigel-coated bicameral units. A
functional TJ barrier was monitored by TER values and expression of TJ markers by PCR,
immunoblotting and immunofluorescence. From this time point, Sertoli cells were either
incubated with 50 nM (stimulates pump signaling) or 1 mM (inhibits pump activity) ouabain or
control media to determine effects of Na/K-ATPase enzyme inhibition and signaling on TJ and
GJ function. Viability of Sertoli cells incubated under various ouabain conditions was
determined with a trypan blue dye exclusion test. For inhibitor based studies, Sertoli cells were
preincubated with PP2 (Src kinase inhibitor), PD98059 (MAPK inhibitor) for 30 min and
![Page 188: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/188.jpg)
164
extracts were probed for phosphorylation of signaling molecules, claudin 11 and connexin 43
expression and measurement of TER.
7.4.6 Isolation of Sertoli cell RNA and quantification of junctional molecules by
RT-qPCR
Total RNA was extracted from Sertoli cells and testis with TRIzol reagent according to the
manufacturer’s instructions. The final RNA pellet was washed with 1 ml of 75% ethanol, air
dried and re-suspended in 30 µl of nuclease free water. The RNA samples were treated with
DNase using the protocol in the DNase kit, RNA concentrations measured using the NanoDrop
UV/Vis spectrometer (Thermo Scientific, Wilmington, DE, USA) at 260 nm, and samples stored
at -80 °C until used for subsequent analysis. Sertoli cell and testis RNA (100 ng) was reverse-
transcribed using a high-capacity cDNA reverse transcription kit according to the manufacturer’s
instructions. Intron-spanning primers for targeted transcripts were designed using the primer-
designing tool from NCBI (Table 7.1).All PCR amplifications were performed in a 25 µl
reaction volume using StepOnePlus Real-Time PCR system (Applied Biosystems, Burlington,
ON, Canada) and AmpliTaq fast DNA polymerase (Fast SYBR Green master mix, Applied
Biosystems) with 10 pmol of each primer and 25 ng of cDNA. The PCR conditions were 95 °C
for 5 min, followed by 35 cycles of 95 °C for 30 s, primer-dependent annealing temperature for
30 s, then 72 °C for 2 min, followed by a final extension at 72 °C for 10 min. In addition, a
negative control (without cDNA) and no template control were included to ensure specific
amplification. Relative changes in gene expression was calculated using the 2 –ΔΔC
T (threshold
cycle) method.
![Page 189: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/189.jpg)
165
Table 7.1: Primer sequences used for detecting transcripts of TJ and GJ molecules, and isoforms of Na/K-ATPase in
prepubertal Sertoli cells
Gene GenBank accession # Forward primer Reverse primer Product
size (bp)
Cldn1 NM_031699.2 GCTGTCATCGGGGGCATAAT CCTGGCCAAATTCATACCTGG 136
Cldn 3 NM_031700.2 CTCGCCCTTCCCAAGTACAG CCCACTATGAGCCTTCTGGC 78
Cldn4 NM_001012022.1 AGGCTCCAGCGAGGATAGAT TCCACTGTCGTACCCAGACA 104
Cldn11 NM_053457.2 CCTCATCCTCCCTGGTTACG GAATAAGGAGCACCCCAGCC 173
Ocln NM_031329.2 GCCGGATGAATTCAAACCCA GCGATGCACATCACGATGAC 195
Tjp1 NM_001106266.1 TCAAGTCGGACAGCCAGATG ATGCTGGGCCTAAGAATCCC 96
Gjb1 NM_017251.2 CCAGGGAGGTGTGAATGAGG CTCGGCCAATGGCTGTAGAA 91
Gja5 NM_019280.1 AGGAAGCAGAAGGCTCAGCAC ACCTTGCCGATGACCGTAGA 113
Gja1 NM_012567.2 TTAAGTGAAAGAGAGGTGCCCA AGGCAGACTGTTCATCACCC 179
Atp1a1 NM_012504.1 TCCTTAAGCGTGCAGTAGCG CTCATCTCCATCACGGAGCC 88
Atp1a4 NM_022848.3 CCCTGCATCTTCATCATTCAGTAGA AGTGGCCGCTGTCTCTTTTC 85
Pcna NM_022381. CCTGCTGGGACATCAGTTCG TTTGGACATGCTGGTGAGGTT 155
Wt1 NM_031534.2 TCCGGTCAGCATCTGAAACC TTCTCACCAGTGTGCTTCCG 121
Gapdh NM_017008.4 CAGGGCTGCCTTCTCTTGTG GATCTCGCTCCTGGAAGATGG 188
![Page 190: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/190.jpg)
166
7.4.7 Immunofluorescence
For immunostaining, Sertoli cells were plated at a density of 0.05 x 106
cells/cm2 in
four-well chamber slides. Cells were fixed in 4% PFA for 15 min, permeabilized with 0.1%
Triton X-100 for 15 min (5 min for claudin 11 and connexin 43), followed by incubation with
10% normal chicken serum or goat serum (depending on the source of the secondary antibody)
for blocking. Primary antibodies were incubated overnight at 4 °C at the following dilutions:
claudin 11 and connexin 43 (1:100), p-CREB (1:500), VASA (1:200), 3β-HSD (1:50), ATP1A1
(1:50). Following washing in PBS, secondary antibodies were added at the following dilutions:
chicken anti-rabbit Alexa 488 (1:1000 for VASA and p-CREB; 1:200 for claudin 11, connexin
43 and ATP1A1) and goat anti-rabbit Alexa 555 (1:1000 for 3β-HSD) for 1 h at RT. Cells were
washed in PBS and mounted with Vectashield containing DAPI and stored in – 20 °C until
further imaging. Images were captured using a Zeiss AxioVert.A1 inverted fluorescence
microscope (Carl Zeiss microscope GmBH, Germany) using the Axiocam ICc 5 camera system
and representative 20X and 40X images were shown.
7.4.8 Preparation of Sertoli cell lysates and immunoblotting
Sertoli cells (0.5 x 106 cells/cm
2) attached to Matrigel-coated dishes were first recovered by
adding a cell recovery solution for 1 h at 4 °C. These cells were washed in PBS and centrifuged
at 500 x g for 10 min at 4 °C. Pelleted Sertoli cells were subsequently lysed with RIPA buffer
containing 1X protease inhibitor cocktail and phosphatase inhibitor cocktail which included 1
mM Na3Vo4, 1 mM NaF and 1 mM β-GP for 30 min at 4 °C. The supernatant (containing
extracted proteins) was obtained by high-speed centrifugation (12,000 g for 5 min at 4 °C).
Proteins were separated on 8% SDS-PAGE gel and electrotransferred to nitrocellulose
![Page 191: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/191.jpg)
167
membranes. After blocking with 5% (w/v) skim milk in Tris-buffered saline containing TTBS
for 1 h, membranes were incubated overnight in TTBS at 4 °C with the following antibodies:
AMH (1:100), WT-1 (1:100), GATA-4 (1:100), ATP1A1 (1:1000), claudin 11 (1: 200),
connexin 43 (1:1000), p-Src (1:1500), p-EGFR (1:1500), p-ERK1/2 (1:1500), p-CREB (1:1000),
Src (1:1500), ERK1/2 (1:1500), and EGFR (1:1000). Membranes were washed (3X) in TTBS for
10 min and subsequently incubated with either HRP conjugated goat anti-rabbit or anti-mouse
IgG for 1 h at RT. Following washing, immunoreactive bands were detected using
chemiluminescence. Membranes were stripped and probed with anti-actin antibody (1:1000) for
whole-cell homogenates and for phosphoproteins, antibodies corresponding to total proteins to
ensure equal protein loading.
7.4.9 Statistical analysis
Data were analysed with commercial statistical software (GraphPad Software Inc., La Jolla, CA,
USA). Data regarding the transcript levels of claudin 11, zona occludens-1 and TER values that
were recorded from day 1 to day 6 of in vitro culture, TER values in Sertoli cells obtained after
ouabain and inhibitor (PP2 and PD98059) exposure were analysed using one-way ANOVA
followed by Tukey’s post-hoc test. Differences in viability, phosphorylated signaling molecules,
claudin 11 and connexin 43 expression between control and ouabain treated groups were
analysed using two-way ANOVA followed by Tukey’s post-hoc test. Fold changes in the
expression of various TJ and GJ molecules subjected to ouabain treatment were analysed using
two-way ANOVA followed by Sidak’s multiple comparison test. For all analyses, P < 0.05 was
considered significant and results were reported as mean ± SEM.
![Page 192: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/192.jpg)
168
7.5 Results
7.5.1 Characterisation of Sertoli cells from prepubertal rat testis
Our Sertoli cell culture system was validated (immunoblotting and immunofluorescence) using
markers predominantly expressed in prepubertal rats, including AMH, WT1 and GATA4 (Figure
7.1A and B). Sertoli cell cultures were 90% pure (based on positive staining to WT1), with 6%
cells designated as Leydig cells (positive for 3β-HSD) and the remaining 4% immunoreactive to
VASA (presumptive germ cells; Figure 7.1C).
![Page 193: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/193.jpg)
169
Figure 7.1 Characterisation of Sertoli cells from prepubertal rat testis. (A) Western blot of
total Sertoli cell extracts documenting presence of Sertoli cell markers including AMH, WT1
(doublets identified by black solid arrows) and GATA4 (indicated by black solid arrows). (B)
Staining pattern of WT1 in the nucleus (green), DAPI staining in the nucleus (blue) and merged
image of WT1 and DAPI. This image was captured from Sertoli cells that were grown on non-
matrigel conditions. (C) Purity of Sertoli cell cultures were evaluated by staining for 3β-HSD
and VASA/DDX4 (markers for Leydig and germ cells, respectively) and DAPI for the nucleus.
7.5.2 Increase in claudin 11 expression indicates the formation of Sertoli cell TJs
Based on various criteria including TER, mRNA and protein profiles of claudin 11, prepubertal
Sertoli cells grown at high density established TJs in vitro. A simplified diagram of TER
assembly is shown in Figure 7.2A. The TER values started to increase on day 1 and peaked on
day 4, consistent with formation of a complete TJ. The TER values decreased on day 5, but were
maintained thereafter (Figure 7.2B). Concurrently, mRNA levels of claudin 11 and zona
![Page 194: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/194.jpg)
170
occludens-1 reached maximum values by day 3, prior to establishment of a functional TJ barrier
by day 4 (Figure 7.2C and E). Protein profiles of claudin 11 were consistent with its mRNA
levels (Figure 7.2D). To confirm differentiation, Sertoli cells were assessed for transcript levels
of proliferating cell nuclear antigen (PCNA) from days 1 to 5 of in vitro culture conditions. The
mRNA levels of PCNA did not change significantly throughout culture (Figure 7.2F).
Localisation patterns of claudin 11 were disorganized and incomplete by day 3, with staining
noticed in the form of dots and patches. Complete staining was apparent at interfaces between
cells at day 4, consistent with the various TJ measurements mentioned above (Figure 7.3).
![Page 195: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/195.jpg)
171
Figure 7.2 Formation of Sertoli cell junctional complexes in vitro. (A) Schematic diagram of
the TER assembly used to assess tightness of TJs in Sertoli cell monolayers. (B) TER recordings
obtained from Sertoli cells grown in vitro for 7 d. (C), (D) and (E) Monitoring formation of
junctional complexes by assessment of transcript and protein levels of claudin 11 mRNA and
protein levels (immunoblotting), and zona occludens-1 (ZO-1) mRNA, respectively. (F) RT-
qPCR values for proliferating cell nuclear antigen (PCNA) obtained from Sertoli cell cultures
maintained in vitro for 5 d. Values represent mean ± SEM (n = 3 replicates). a-e
Values without a
common letter differed (P < 0.05).
![Page 196: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/196.jpg)
172
Figure 7.3 Monitoring the formation of Sertoli cell junctional complexes in vitro by claudin
11 staining. Representative images showing the staining patterns of claudin 11 (green; left
panel) and nucleus (blue; middle panel) and merged image of claudin 11 and DAPI (right panel)
on days 2, 3, and 4 of in vitro Sertoli cell culture.
7.5.3 Detection of α1 and β3 subunits of Na/K-ATPase in Sertoli cells
The presence of α1 subunit in Sertoli cells was detected using RT-PCR and later confirmed by
immunoblotting (Figure 7.4A and B). Staining of Sertoli cells with Na/K-ATPase α1 antibody
revealed the presence of the protein at the membrane interface between adjacent Sertoli cells
![Page 197: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/197.jpg)
173
Figure 7.4C. However, the presence of sperm-specific α4 isoform in Sertoli cells was not
confirmed by either of these approaches (Figure 7.4A and B). Immunoblotting of Sertoli cells
with α4-specific antibody did not detect a 110 kDa band corresponding to the molecular weight
of the protein, although several non-specific bands were apparent (Figure 7.4A). Subsequently,
mass spectrometric identification confirmed the presence of only α1 and β3 subunits in Sertoli
cell extract (Table 7.2).
![Page 198: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/198.jpg)
174
Figure 7.4. Characterisation of Na/K-ATPase isoforms in rat Sertoli cells. (A) Total Sertoli
cell extracts were probed with antibodies against the α1 isoform, pre-immune (PI) serum and
custom-made antibody against the α4 isoform of Na/K-ATPase. Blocking peptide (BP) was used
to confirm the specificity of antigen-antibody binding. Sperm was used as a positive control for
detection of ATP1A4. (B) Real-time PCR detection of α1, α4 isoforms and Sertoli cell marker
(WT1) transcripts in Sertoli cells. Testis was used as a positive control for detection of ATP1A4
mRNA respectively. (C) Immunofluorescent staining of Sertoli cells against ATP1A1 (green)
and the nucleus (blue) and merged image of ATP1A1 and DAPI staining.
![Page 199: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/199.jpg)
175
Table 7.2: Mass spectrometric detection of Na/K-ATPase isoforms in prepubertal rat Sertoli cells
Protein name
NCBI GI
number MW (kDa)
Spectral
count Peptide sequence
Sequence
covered (%)
ATP1A1 6978543 113 6 VDNSSLTGESEPQTR 7
VDNSSLTGESEPQTR
SPDFTNENPLETR
EQPLDEELKDAFQNAYLELGGLGER
EQPLDEELKDAFQNAYLELGGLGER
GVGIISEGNETVEDIAAR
ATP1B3 6978553 32 2 EENIANIVTYPDDGLIDLK 7
EENIANIVTYPDDGLIDLK
![Page 200: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/200.jpg)
176
7.5.4 Dose-dependent regulation of ouabain on claudin 11 and connexin 43 expression
and its effect on TER
To test whether the pump and signaling function of Na/K-ATPase are essential for TJ and GJ
function in Sertoli cells, two distinct concentrations of the ligand ouabain were used. The higher
dose (1 mM) inhibits ion transport activity, whereas the low non-inhibitory dose (50 nM)
activates signaling pathways (Nguyen et al. 2007). Furthermore, since 1 mM ouabain interferes
with cell viability, we monitored cell vitality with a trypan blue dye exclusion test. There was no
significant difference in cell vitality between groups exposed to 50 nM or 1 mM ouabain (Figure
7.5A). Furthermore, tightness of junctional complexes was assessed by measurement of TER
values. Incubation with a low concentration of ouabain resulted in increased TER values
(reached significance after 72 h of treatment; Figure 7.5B). In contrast, a high ouabain
concentration decreased TER. In addition, RT-PCR was used to ascertain whether changes in
TER values were accompanied by changes in expression of the junctional molecules associated
with TJs and GJs. Claudin 1, 3, 4, occludin, ZO-1, connexin 32, and 40 mRNA levels did not
change significantly following ouabain treatment (Figure 7.5C). However, there were significant
changes in the transcriptional and translational activities of claudin 11 and connexin 43 after 72 h
of treatment with ouabain. Transcript levels of both claudin 11 and connexin 43 were increased
when Sertoli cells were treated with 50 nM ouabain; however, there was a corresponding
decrease in both molecules when cells were exposed to higher concentrations (1 mM) of ouabain
(Figure 7.5C). Consistent with changes in mRNA expression, 50 nM ouabain induced an
increase in claudin 11 and connexin 43 protein, whereas 1 mM ouabain had a decreasing effect
(Figure 7.5D and E). In addition, effects of varying concentrations of ouabain on distribution of
claudin 11 and connexin 43 expressions were also determined. Incubation of cells with the low
![Page 201: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/201.jpg)
177
non-inhibitory concentration of ouabain increased staining intensity of claudin 11 expression at
cell-cell junctions, whereas the inhibitory dose of ouabain led to a discontinuous staining pattern
between cells, compared to control cells (Figure 7.6). Staining pattern similar to claudin 11 was
noticed for connexin 43 under different ouabain conditions (data not shown).
![Page 202: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/202.jpg)
178
Figure 7.5 Dose-dependent regulation of ouabain on expression of TJ and GJ proteins. (A)
Assessment of viability in Sertoli cells incubated with various concentrations of ouabain for 24 –
72 h. (B) Recording of TER values (Sertoli cell monolayers) under both control and ouabain-
treated conditions. (C) RT-qPCR based quantification of transcript levels of various members of
the TJ and GJ family of proteins, normalised to GAPDH levels under varying conditions of
ouabain exposure for 72 h. (D) Representative immunoblot of claudin 11 and connexin 43
expression obtained from analogous experimental conditions as described above (cropped image
indicated by dividing lines). (E) Relative pixel intensity of these proteins was calculated by
normalizing mean pixel intensity of claudin 11 and connexin 43 to actin. Values shown were
expressed as mean ± SEM (n = 3 replicates). a-c
Values without a common letter differed (P <
0.05).
![Page 203: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/203.jpg)
179
Figure 7.6 Dose-dependent regulation of ouabain on localisation patterns of claudin 11 in
Sertoli cells. Representative images of claudin 11 (green), nucleus (blue) and merged image of
claudin 11 and DAPI in Sertoli cell cultures after treatment with various ouabain concentrations
for 72 h. Similar staining patterns were obtained for connexin 43 (data not shown).
![Page 204: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/204.jpg)
180
7.5.5 Involvement of Src-EGFR-ERK1/2-CREB pathway in ouabain mediated regulation of
claudin 11 and connexin 43 and its effect on TER
Increase in Src, EGFR, ERK1/2, CREB phosphorylation were apparent in Sertoli cells after 15
min of exposure to a low concentration of ouabain (50 nM), compared to control cells, as shown
in Figure 7.7A-E. Even though treatment with a higher concentration (1 mM) of ouabain
decreased phosphorylation of Src, ERK1/2, and CREB compared to the 50 nM ouabain group,
phosphorylation was still higher compared to the control group, except for p-Src (Figure 7.7A-
E). However, EGFR phosphorylation in the 1 mM ouabain treated group was not significantly
different from other groups in the study. There were no differences in unphosphorylated forms of
the above-mentioned signaling molecules under any of these conditions. Consistent with the p-
CREB expression, staining was more intense in the nuclei of the low-dose ouabain-treated group
compared to the control and high-dose ouabain groups (Figure 7.8). To confirm whether the Src-
EGFR-ERK1/2-CREB pathway was central for ouabain-induced effects on junctional molecules,
PP2 and PD98059, inhibitors that classically block Src and MAPK kinase activity, respectively,
were used. Pre-incubation of cells with 10 µM PP2 completely abolished phosphorylation of
EGFR, ERK1/2 and CREB (Figure 7.9A) whereas 25 µM PD98059 prevented phosphorylation
of CREB, suggesting that Src and ERK1/2 were crucial to activate this pathway (Figure 7.10A)
Expression of claudin 11 and connexin 43 were also decreased in the presence of inhibitors and
further exposure to ouabain did not reverse inhibitory effects (Figure 7.9A). However, neither
inhibitor affected expression of non-phoshorylated forms of Src and ERK1/2. Also, inhibition of
Src and MAPK by PP2 and PD98059 decreased TER and subsequent stimulation with either 50
nM or 1 mM ouabain partially reversed effects of the inhibitors, indicating involvement of
![Page 205: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/205.jpg)
181
ATPA1-Src-EGFR-ERK1/2-CREB pathway in ouabain-mediated regulation of TJ and GJ
molecules (Figure 7.9B and 7.10B).
![Page 206: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/206.jpg)
182
Figure 7.7. Involvement of Src-EGFR-ERK1/2-CREB pathway in ouabain-mediated
regulation of TJ and GJ proteins. Total Sertoli cell homogenates were isolated from cells
incubated in the absence or presence of 50 nM or 1 mM ouabain for 15 min and probed for
various signaling molecules, including (A) Src, (B) EGFR, (C) ERK1/2 and (D) CREB
(indicated by black solid arrows). Top panels of (A), (B), (C) and (D) indicates phosphorylated
signaling molecules, whereas the bottom panels correspond to the unphosphorylated forms of
these signaling molecules. Actin was used as a loading control for p-CREB. (E) Content of
activated signaling molecules were normalised to their unphosphorylated forms and relative
pixel intensity calculated. Data shown were expressed as mean ± SEM (n = 3 replicates). a-
cValues without a common letter differed (P < 0.05).
![Page 207: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/207.jpg)
183
Figure 7.8 Dose-dependent regulation of ouabain on p-CREB staining in Sertoli cells.
Representative images of p-CREB staining in the nuclei (green), DAPI staining in the nucleus
(blue) and merged image of p-CREB and DAPI in Sertoli cells that were incubated under various
ouabain conditions.
![Page 208: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/208.jpg)
184
![Page 209: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/209.jpg)
185
Figure 7.9 Effect of Src inhibition on phosphorylation of signaling molecules, claudin 11
and connexin 43 expression and its effects on TER. (A) Representative immunoblot from total
Sertoli cell extracts preincubated with PP2 for 30 min and subsequently stimulated with either 50
nM or 1 mM ouabain and probed with phosphorylated signaling molecules. Src was used as a
loading control. (B) Measurement of TER in Sertoli cell monolayers that were preincubated with
PP2 for 30 min and stimulated with 50 nM or 1 mM ouabain. Values are mean ± SEM (n = 2
replicates). a-c
Values without a common letter differed (P < 0.05).
![Page 210: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/210.jpg)
186
Figure 7.10 Effect of ERK1/2 inhibition on CREB phosphorylation and its effects on TER.
(A) Sample western blot of Sertoli cell homogenates preincubated with PD98059 for 30 min and
probed for phosphorylation of ERK1/2 and CREB. (B) Measurement of TER in Sertoli cell
monolayers that were preincubated with PD98059 for 30 min and stimulated with 50 nM or 1
![Page 211: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/211.jpg)
187
mM ouabain. ERK1/2 was used as a loading control. Values are mean ± SEM (n = 2 replicates).
a-d Values without a common letter differed (P < 0.05).
7.6 Discussion
Sertoli cells and their junctional complexes have key roles in spermatogenesis and male fertility.
In this study, we provided evidence that the α1 subunit of Na/K-ATPase (ATP1A1) was
localised to junctional complexes in prepubertal Sertoli cells. We also demonstrated dose-
dependent regulation of ouabain on ion transport and signaling functions of ATP1A1, which in
turn regulated expression of two major junctional proteins, claudin 11 and connexin 43 in Sertoli
cells via the Src-EGFR-ERK1/2-CREB pathway.
A functional TJ barrier was formed in vitro when Sertoli cells cultured at a high density
on matrigel-coated transwell insert system after 3 d of culture. Similar results were obtained
from other studies involving prepubertal Sertoli cell primary cultures (Janecki et al. 1991, Grima
et al. 1998). It is interesting to note that somatic epithelial cells display TER values (200 – 2500
Ωcm2) under in vitro culture conditions. In the testis, BTB is constituted by coexisting TJs, GJs,
basal ectoplasmic specialisation (basal ES), and desmosomes (DS) along with germ cells and
peritubular myoid cells which contribute either directly or indirectly in determining the tightness
of the barrier. Although the BTB formed by Sertoli cells represent one of the tightest barrier
systems in the body, it is possible that the absence of germ cells or peritubular myoid cells from
our culture could have contributed to the low TER values compared to somatic epithelial cells.
Additionally, we don’t know whether our Matrigel (culture) conditions support the formation of
other junctional complexes including basal ES and DS. Therefore it is possible that the absence
of protein(s) contributing to other junctions could be a causative factor for the low TER values.
![Page 212: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/212.jpg)
188
Nevertheless, the increase in TER readings under in vitro culture conditions were not attributed
to increase in Sertoli cell number, but rather reflected maturational changes in Sertoli cells due to
formation of TJs. This was further confirmed using RT-PCR for detecting changes in the
proliferating cell nuclear antigen (PCNA), a marker used for assessment of post-natal Sertoli cell
development (Jarvis et al. 2005). We also detected a steady increase in mRNA levels of claudin
11 and ZO-1 preceding establishment of a TJ barrier by day 4 in our Sertoli cell cultures. Claudin
11 and ZO-1 can be used as markers for monitoring establishment of TJ barriers in vitro (Chung
et al. 1999, Wong et al. 2000) especially claudin 11, which is necessary for morphology of TJ
strands, as their presence maintains Sertoli cells in a differentiated state due to contact inhibition
(Morrow et al. 2010). Subsequent localisation of claudin 11 at the inter-Sertoli cell junctions was
consistent with other studies (McCabe et al. 2015).
Various isoforms of Na/K-ATPase are expressed in a tissue-specific and developmental-
specific manner. In that regard, ATP1A1 is expressed ubiquitously, ATP1A2 is detected in
adipocytes, muscle, heart and brain, ATP1A3 is abundant in neurons, and finally ATP1A4 is a
testis-specific isoform with a restricted expression in post-meiotic germ cells and sperm. It was
reported that ATP1A4 mRNA was present in the 93RS2 Sertoli cell line, originally isolated from
15 d-old prepubertal rats (Konrad et al. 2011). However, in that study, there was no conclusive
demonstration that the ATP1A4 protein was present. It is well known that Sertoli cells in rats
proliferate until 15 – 16 d postnatally, after which no proliferative activity is detected. There are
also differences with respect to reproductive hormone profiles in rats. For example, after
postnatal day 15, inhibin negative feedback on FSH secretion declines (Rivier et al. 1988) and
testosterone concentrations increase (Lee et al. 1975). It is well known that FSH and testosterone
are regulators of Na/K-ATPase function and expression (Blok et al. 1999, Sasson et al. 2003).
![Page 213: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/213.jpg)
189
Moreover, cell lines are genetically manipulated, which may alter their response to stimuli, even
though they may appear phenotypically normal (Kaur & Dufour 2012). Therefore, it is possible
that there is age- and hormone-dependent regulation on expression of ATP1A4 mRNA and
protein in Sertoli cell lines. In total contrast, McDermott (McDermott et al. 2012) used GFP
expression, downstream of the ATP1A4 promoter as a tool to identify localisation patterns of
ATP1A4 protein and reported that the α4 protein was detected only in differentiated male germ
cells, but not in Sertoli cells isolated from mice that were 7-, or 18-d old, or adults. Therefore,
due to contradictory reports regarding the presence of Na/K-ATPase isoforms, we decided to use
various approaches to detect ATP1A4 at the protein level using a custom-made rat ATP1A4
antibody for immunoblotting and mass spectrometry. Neither approach detected evidence for
existence of ATP1A4, but rather provided evidence for ATP1A1 and ATP1B3 in prepubertal
Sertoli cell extracts. Similarly, Lucas (Lucas et al. 2012) reported that Sertoli cell primary
cultures from 15-d-old rats had ATP1A1 but not the sperm-specific ATP1A4. The staining
pattern of ATP1A1 in our study was noticeable at cell-cell contacts, consistent with observations
in other epithelial cell types. The β3 subunit is predominantly expressed in the testis
(Arystarkhova & Sweadner 1997) and co-expression of α1 and β3 subunits in baculovirus
infected Sf-9 cells formed α1β3 that exhibited enzymatic properties characteristic of Na/K-
ATPase (Yu et al. 1997).
Apart from its classical role in ion transport, Na/K-ATPase isoforms also act as a receptor
for its ligand ouabain. Various short- and long-term effects have been reported for Na/K-
ATPase-ouabain interaction, including proliferation/viability (Abramowitz et al. 2003, Quintas et
al. 2010), differentiation (Fedorova et al. 2009), apoptosis (Jiang et al. 2010) and contraction
(Mohammadi et al. 2003). The above-mentioned effects of ouabain were concentration-
![Page 214: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/214.jpg)
190
dependent, with the rat α1 isoform being resistant to the inhibitory action of ouabain. In that
regard, a dose as high as 1 x 10 -3
M is needed to inhibit the pumping activity of ATP1A1,
whereas non-inhibitory doses as low as 10-9
M activate the signaling function of ATP1A1.
Similarly, 0.1 to 10 nM ouabain prevented cell death and promoted cell growth, whereas
concentrations >10-7
M prevented cell proliferation associated with extensive inhibition of Na/K-
ATPase enzyme activity (Nguyen et al. 2007). Accordingly, when we subjected Sertoli cells to
inhibitory doses of ouabain (1 mM), there were significant decreases in the mRNA and protein
profiles of claudin 11 and connexin 43, whereas low non-inhibitory doses (50 nM) had the
opposite effect. Likewise, in other epithelial cells, 50 nM ouabain increased expression of
claudin 1, 2 and 4 and their localisation patterns to become more distributed towards cell-cell
junctions (Larre et al. 2010). In another study, a similar concentration of ouabain increased gap
junction communications after 1 h of treatment (Ponce et al. 2014). In contrast, 1 mM ouabain
caused a time-dependent loss of connexin 43 expression in A7r5 smooth muscle cells (Martin et
al. 2003).
As mentioned above, higher doses of ouabain could cause Na/K-ATPase pump
inhibition and the mechanisms by which this pump inhibition affects TJ permeability could be
multifaceted. This could involve biochemical changes, including an increase in intracellular
calcium, secondary changes due to increase in intracellular sodium, inhibition of Rho GTPase
activity which in turn affects actin polymerization, and loss of interaction between Na/K-ATPase
and E-cadherin in recruitment of TJ proteins or mislocalisation of TJ proteins at the plasma
membrane interface (Rajasekaran & Rajasekaran 2003). Due to these biochemical changes that
occurred secondary to pump inhibition, perhaps downstream targets or pathways differed in the 1
mM versus 50 nM group. We believe that the altered intracellular environment or unidentified
![Page 215: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/215.jpg)
191
downstream pathways/molecules, or perhaps a combination of both, could have perturbed the
junctional complexes at the site of BTB and thereby contributed to the leakiness and a
subsequent decrease in TER in the 1 mM ouabain treatment group.
Na/K-ATPase also interacts with membrane and cytosolic proteins, either directly or
indirectly and activates several downstream signaling pathways (Pierre & Xie 2006). In general,
ouabain-activated Na/K-ATPase signaling occurred at concentrations too low to inhibit the
enzyme. In contrast, we determined that both inhibitory and non-inhibitory doses of ouabain
activated Src, ERK1/2 and CREB in a dose-dependent manner except EGFR through the α1
isoform in Sertoli cells. There is considerable evidence that distinct and probably
interconvertible pools of Na/K-ATPase (raft and non-raft) exist in cells with signaling and
pumping functions, respectively. Perhaps both the signaling and pumping pool of ATP1A1 are
activated in response to low concentrations of ouabain, promoting increased phosphorylation of
signaling molecules. The pumping pool of the enzyme might be inhibited, whereas only the
signaling pool is activated in response to high concentration of ouabain, consistent with moderate
phosphorylation of signaling molecules in Sertoli cells.
In 93RS2 Sertoli cell line exposed to low (nM) concentrations of ouabain, the α4 isoform
of Na/K-ATPase modulated expression of claudin 1 and claudin 11 involving the c-Src/c-
Raf/ERK1/2/CREB pathway, similar to non-classical testosterone signaling (Dietze et al. 2015).
The most proximal interaction in Na/K-ATPase signaling is activation of non-receptor tyrosine
kinase Src. This ouabain induced c-Src phosphorylation was conserved among cardiac myocytes,
LLC-PK1, and A7r5 cells, providing evidence that this signaling process is common. In Sertoli
cells, testosterone induces both rapid and sustained (within 5 and 20 min, respectively) c-Src
phosphorylation, followed by phosphorylation of EGFR through the non-classical signaling
![Page 216: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/216.jpg)
192
pathway (Cheng et al. 2007). In the present study, there was a similar type of response with
regard to Src activation when prepubertal Sertoli cells were exposed to non-inhibitory doses of
ouabain. Although exposure of inhibitory doses of ouabain did not cause much change in
activation of EGFR, it caused changes in Src, ERK1/2 and CREB phosphorylation. Higher
concentrations of ouabain are toxic and interfere with cell viability. In order to ascertain that
downregulation of the signaling molecules in the 1 mM ouabain treated group were not due to
loss of viability of the Sertoli cells, we monitored vitality by trypan blue dye. We observed no
gross morphological changes and in the percentage of cells that excluded the viability dye. It is
possible that either the duration or the magnitude of Src, ERK1/2 and CREB activation and
associated secondary changes within the cell due to pump inhibition could have altered
expression of claudin 11 and connexin 43 in this ouabain treated group. Similarly, a high ouabain
concentration (1 µM) activated the MAPK pathway (Lucas et al. 2012), whereas 1 mM ouabain
caused moderate ERK1/2 phosphorylation in rat salivary epithelial cells (Plourde & Soltoff
2006).
A rapid and sustained level of phosphorylation of ERK1/2 and CREB (1 min to more
than 12 h) was reported when Sertoli cells were treated with testosterone (Fix et al. 2004).
Accordingly, we detected increased phosphorylation of CREB on ser 133 residue after exposure
to ouabain. It is suggested that a sustained activation of CREB is needed to induce changes in
transcription for CREB-mediated genes (Fix et al. 2004). The importance of CREB
phosphorylation is also evident from studies involving over expression of mutant CREB isoform
in Sertoli cells that is unable to be phosphorylated. In such a case, spermatogenesis was disrupted
due to the presence of apoptotic spermatocytes and subsequent loss of spermatids (Scobey et al.
2001). Once phosphorylated on Ser 133, CREB can induce the transcription of several genes
![Page 217: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/217.jpg)
193
including claudin 11 (Morrow et al. 2010) and connexin 43 (Salameh et al. 2009). The
GATA/NF-Y region of claudin 11 promoter is induced by the transcription factor complex
comprising of GATA4/NF-YA/CREB (Morrow et al. 2010) in Sertoli cells, whereas the
association of CREB with ATF/AP-1 complex induces transcription of connexin 43 in
cardiomyocytes (Salameh et al. 2009). As the promoter regions of claudin 11 and connexin 43
contain binding sites for CREB, it is reasonable to assume that the increase in mRNA and protein
expression of these junctional molecules after ouabain exposure might have occurred through
this pathway. In several studies, the presence of transcription factors such as AP-1, CREB were
markedly enhanced in the nucleus after activation of the MAPK cascade (Markou et al. 2004).
The physiological relevance of ouabain-mediated increase in claudin 11 and connexin 43
expression were reflected in TER values with a low concentration of ouabain contributing to
increased TER, although high concentrations decreased TER values. Perhaps effects of ouabain
on TER values in the present study were a direct effect of the increase in TJ or GJ molecules, or
they could have been an indirect effect of phosphorylated signaling molecules on TJ and GJ
structures.
To assess if the above-mentioned signaling molecules were central to ouabain-mediated
regulation of claudin 11 and connexin 43, Src inhibitor (PP2) was used which completely
abolished phosphorylation of EGFR, ERK1/2, and CREB; therefore, we inferred that activation
of Src was important to phosphorylate other signaling molecules involved in this pathway. In
addition, MAPK inhibitor (PD98059) prevented CREB phosphorylation, indicating that ERK1/2
activation occurred upstream of CREB phosphorylation. Furthermore, PP2 blocked expression of
claudin 11 and connexin 43 in Sertoli cells and subsequent stimulation with either 50 nM or 1
mM ouabain did not reverse inhibitory effects of Src and MAPK on expression of TJ and GJ
![Page 218: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/218.jpg)
194
molecules. In addition, both PP2 and PD98059 reduced TER values but subsequent stimulation
with ouabain was able to partially reverse the inhibitory effects, suggesting a compensatory
mechanism from other molecules that potentially contribute to TJs and GJs. Likewise, PP2 and
PD98059 inhibited ouabain-induced effects on claudin 1 and claudin 4 expression (Larre et al.
2010), whereas inhibitory effects of these inhibitors on connexin 32 and 43 were reported in
MDCK cells (Ponce et al. 2014).
We concluded that both ion pumping and signaling functions of ATP1A1-ouabain
interaction worked together to modulate several properties associated with Sertoli cell-cell
contacts. Furthermore, effects of low and high concentrations of ouabain were linked to
activation of several signaling pathways that converged on ERK1/2 and CREB molecules
(Figure 7.11). Since ouabain is an endogenous hormone, its interaction with the α1 isoform of
Na/K-ATPase could have a very important role in maintenance of BTB and thus male fertility.
![Page 219: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/219.jpg)
195
Figure 7.11. Schematic representation of signaling pathway mediated by ATP1A1-ouabain
interaction (non-inhibitory dose) in prepubertal Sertoli cells. Ouabain activated Src-EGFR-
ERK1/2-CREB pathway leading to expression of claudin 11 (CL11) and connexin 43 (CX43).
Expression and localisation of these TJ (tight junction) and GJ (gap junction) proteins enhanced
the functionality of junctional complexes, which in turn regulates the communication between
Sertoli cells at the blood-testis barrier (TER) and between Sertoli cells and germ cells. The
numbers 1 – 5 marked on germ cells correspond to spermatogonial stem cell, preleptotene
spermatocyte, pachytene spermatocyte, round spermatid and elongating spermatid, respectively.
![Page 220: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/220.jpg)
196
Chapter Eight: General discussion and future directions
Ionic homeostasis is essential for sperm and Sertoli cell function. Specifically, active
translocation of Na+
and K+ ions between the intracellular and extracellular environments is
under the control of Na/K-ATPase (sodium pump). In this thesis, I investigated the role of the
testis-specific isoform of Na/K-ATPase (ATP1A4) in sperm function and fertility, as well as the
role of the ubiquitous isoform (ATP1A1) in Sertoli cell tight junctions and gap junctions.
Similar to their functions in somatic cells, lipid rafts also had key roles in mediating
ATP1A4 signaling events during sperm capacitation. Traditionally, lipid rafts act as a signaling
hub for initiation of downstream signaling events. Accordingly, in our previous work, we
determined that ATP1A4 signaling involved PKA, RTK and Src kinases. Perhaps these signaling
molecules were pre-assembled with ATP1A4 in sperm lipid rafts. Subsequently, in this thesis, I
determined that ATP1A4 was present in raft and non-raft membrane fractions of the sperm
plasma membrane. In addition, I demonstrated that ATP1A4-ouabain mediated activation
(phosphorylation) of EGFR, ERK1/2 and Src were higher in the non-raft membrane fraction,
whereas increase in p-caveolin-1, and p-Src occurred, albeit at a lower level, in the raft
membrane fraction during capacitation. Subsequent immunoprecipitation experiments indicated
that ATP1A4 interacted with Src, EGFR and ERK1/2 in the non-raft fraction, whereas caveolin-
1 and EGFR interaction was evident in the raft fraction, suggesting that raft and non-raft pools of
ATP1A4 stimulated different signaling pathways leading to capacitation. However, I did not
investigate downstream effectors of raft and non-raft signaling mediated by ATP1A4 during
capacitation. Based on studies in somatic cells, it is well understood that ATP1A1 is involved in
regulation of intracellular ROS, calcium and actin polymerisation. As a logical extension of this
![Page 221: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/221.jpg)
197
work, future studies should be focused on investigating the above-mentioned ATP1A4
downstream targets that could be easily detected with commercial flouroprobes. All these
downstream changes are important regulators of sperm capacitation and defects in capacitation
associated signaling could contribute to idiopathic infertility in normospermic men.
Understanding the molecular basis by which this protein functions in normal sperm could help us
to develop novel diagnostic approaches to identify male infertility.
The above-mentioned signaling molecules were chosen based on reports from somatic
cells in which the ubiquitous isoform (ATP1A1) predominates. However, sperm development is
a unique phenomenon, among the most complex differentiation processes in higher eukaryotes.
During spermatogenesis, sperm acquire several proteins (or their isoforms) that are unique and
cell-specific in order to meet functional demands of the cell. Therefore, it is likely that
interacting partners of ATP1A4 are different from their somatic cell counterparts, which
motivated us to investigate the ATP1A4 interactome during sperm capacitation (using an
immunoprecipitation-mass spectrometry approach). In that study, interacting partners of
ATP1A4 differed between raft and non-raft pools of capacitated sperm. Overall, the interactome
was suggestive of proteins known to be involved in metabolism, sperm-oocyte interactions,
chaperones, proteases, cytoskeletal and adaptor proteins. Specifically, plakoglobin, a molecule
involved in cellular adhesion and signaling, was localised with ATP1A4 in the equatorial
segment during sperm capacitation. In epithelial cells, the process of cell-cell adhesion is
facilitated by homo- or heterophilic bonds between E-cadherins on adjacent cells; these bonds
are further strengthened by interactions between the cytoplasmic domain of E-cadherin and
catenins, which are further linked to the actin cytoskeleton (Yamada et al. 2005). E-cadherin and
catenin proteins are specifically localised to the equatorial segment of the sperm head and
![Page 222: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/222.jpg)
198
microvillar region on the oolemma (Takezawa et al. 2011). If gamete interactions involve
mechanisms that are similar to epithelial cell adhesion, it is likely that these proteins are involved
in events leading to sperm-oocyte fusion, considering their strategic locations in sperm and in
oocytes. Since plakoglobin belongs to the catenin family, it is reasonable to assume that
ATP1A4-plakoglobin interaction would be involved in gamete fusion, leading to fertilization.
Plakoglobin is also present in both adherens junctions and desmosomes between Sertoli cells and
between Sertoli and germ cells (Mruk & Cheng 2011); therefore, it would be interesting to
investigate the physiological relevance of Na/K-ATPase-plakoglobin interactions in testis in
future studies.
Apart from their direct role in mediating sperm-oocyte adhesion and fusion, E-cadherin-
catenin complex could also be involved indirectly in recruitment of PLCζ (sperm-borne oocyte
activating factor; SOAF) to the membrane. In epithelial cells, E-cadherin-β-catenin complex
recruits and activates PI3K leading to PIP3 accumulation which in turn brings PLC-γ1 to the
plasma membrane (Xie & Bikle 2007). Based on the hypothetical model proposed in Chapter 3,
perhaps ATP1A4-plakoglobin-PLCζ form a complex with ATP1A4 responsible for activation of
PLCζ and that the E-cadherin-plakoglobin (catenin) complex helps to recruit the activated PLCζ
to the sperm plasma membrane. Activated PLCζ enters the oocyte and causes intracellular
calcicum release, thereby awakening the oocyte (meiotic resumption).
The adhesion process is also facilitated by the trans-dimerization of the integral proteins
via interactions between their extracellular domains (Hartsock & Nelson 2008). In that regard,
the N-glycan mediated interaction of the β-subunit of Na/K-ATPase could contribute to cell
adhesion by binding to its respective subunit in neighbouring cells (Barwe et al. 2007). Since β1
and β3 subunits are demonstrated in sperm (Hickey & Buhr 2011), it is likely that it interacts
![Page 223: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/223.jpg)
199
with its corresponding subunit (homotypic interaction) that is expressed in the oolemma, thereby
facilitating sperm-oocyte adhesion independent of the E-cadherin pathway. To test this
hypothesis, a straightforward experiment would involve staining the beta subunit (for example:
β1) of acrosome-reacted sperm with a specific flouroprobe (e.g. green) and the beta subunit (β1)
of oocyte with another fluroprobe (red) separately, incubate them and look for colocalisation
patterns.
During the course of my investigation on ATP1A4 involvement in raft and non-raft
signaling, I determined that both content and activity of ATP1A4 increased during sperm
capacitation; furthermore, this increase was not due to protein translocation from other
subcellular compartments, nor was it due to transcriptional activity. However, the capacitation-
associated ATP1A4 increase (monitored by incorporation of fluorescently labelled lysine) was
partially sensitive to the mitochondrial translation inhibitor, chloramphenicol, indicative of
ATP1A4 mRNA being translated on mitochondrial ribosomes or mitochondrial-like ribosomes
during capacitation. In future studies, it would be worthwhile to investigate ATP1A4 mRNA
turnover and degradation after capacitation (not investigated in the current thesis work).
Functionally intact and stable sperm mRNAs can be delivered to the oocyte during fertilization
and are important during the critical window of activation of the embryonic genome and its
epigenetic regulation (Sendler et al. 2013). Perhaps this sperm-specific mRNA persists in the
oocyte until activation of the embryonic genome and has critical roles in embryo development
which remains to be investigated.
The functional significance of the increase in ATP1A4 protein is that it could either be
used by sperm to meet physiological demands during capacitation, or possibly serve a secondary
function (e.g. sperm-oocyte interaction and oocyte activation). Before fertilization, mammalian
![Page 224: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/224.jpg)
200
oocytes are arrested in metaphase II (MII) stage, but they are activated after sperm-oocyte fusion
due to a transient increase in intracellular calcium levels (Stricker 1999, Runft et al. 2002). The
fertilizing sperm delivers the sperm-borne oocyte-activating factor (SOAF) required for initiating
intracellular calcium release through the phosphoinositide signaling pathway, where PIP2 is
cleaved by PLC into IP3 and DAG. Subsequently, IP3 triggers release of calcium from
endoplasmic reticulum (ER) by binding to IP3 receptors located on the ER membrane (Xu et al.
1994). Two potential sperm proteins, PLCζ and post acrosomal WW binding protein (PAWP) are
considered as SOAF candidates. In that regard, microinjection of recombinant PAWP (rPAWP)
or rPLCζ into mouse oocytes induced a high rate of meiotic resumption and pronuclear
formation. Furthermore, corresponding antibodies against PAWP or PLCζ or their competitive
peptides blocked sperm-induced fertilization, suggesting that either PAWP or PLCζ could be the
genuine oocyte activating factor (Wu et al. 2007), Saunders et al. 2002). Although certain steps
of oocyte activation are defined, it is still unclear which sperm factor(s) act upstream of
intracellular calcium release to initiate activation. We propose that ATP1A4 could act upstream
of PLCζ via its redistribution to the equatorial segment (site of sperm-oocyte interaction) and
post-acrosome region during capacitation. This possibility can be tested by microinjecting sperm
obtained from ATP1A4 KO mice (already developed by Blanco et al. 2011) and recording the
intracellular calcium levels in comparison to WT mice. If ATP1A4 works upstream and activates
PLCζ, we expect to see a decrease or a disturbance in the dynamics of intracellular calcium
release in oocytes. Before testing the ATP1A4-PLCζ hypothesis on intracellular calcium release,
it is imperative to test whether the ATP1A4 signal persists in the equatorial segement and
postacrosome region in acrosome-reacted sperm.
![Page 225: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/225.jpg)
201
Sperm RNAs are reflective of past events during spermatogenesis, whereas sperm protein
composition provides information regarding cell function; therefore, both are tightly linked to
fertility. In the bovine AI industry, semen is collected from bulls that are deemed satisfactory
breeders (passed a standard bull breeding soundness evaluation) and subsequently their frozen-
thawed semen is used to impregnate females. Despite being deemed sound for breeding, these
bulls often differ in their pregnancy rates by 20 – 25% (Larson & Miller 2000) possibly due to
submicroscopic differences in sperm characteristics. Similarly, in cases of idiopathic infertility in
humans, routine semen evaluation methods do not consistently provide an etiological basis for
male infertility. However, methods to detect submicroscopic differences in sperm are emerging
in animals and humans, providing clues about underlying mechanisms of differences in
fertility/infertility. Consequently, comparing sperm from bulls with varying levels of fertility
may identify these submicroscopic differences (for example, up- or down-regulation of specific
proteins or RNA) and help to identify molecular markers of fertility, which may provide insights
regarding diagnosis of idiopathic infertility in humans. Although approaches for biomarker
discovery and development are steadily increasing, translation of biomarkers from research to
clinical applications is still slow. In order to address this, I tested ATP1A4 content, its correlation
with fertility and mechanisms by which this protein is involved in regulating fertility in a group
of HF and LF bulls whose fertility rates were determined under controlled conditions (based on
NRR). Since ATP1A4 is involved in regulating several aspects of motility and capacitation, it is
likely that its content and activity are related to post-thaw sperm function and fertility. To
address this objective, I developed an enzyme assay and a flow cytometry assay for
quantification of ATP1A4 activity and content, respectively, in bull sperm. I also demonstrated
that both content and activity of ATP1A4 were higher in HF bulls compared to LF bulls and
![Page 226: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/226.jpg)
202
were positively correlated with fertility. Additionally, there was differential regulation of
downstream effectors of ATP1A4 signaling (ROS, calcium, F-actin) in HF and LF bulls that
were correlated to fertility, implying molecular/submicroscopic differences between HF and LF
bulls in sperm characteristics. Most of the assays that I used for this objective were based on
flow cytometry, a technique widely adapted at the field level by AI industries. I believe that the
flow cytometric quantification of ATP1A4 content and other sperm functional parameters may
contribute to development of novel laboratory assays for better prediction of fertility of bulls that
are classified as satisfactory potential breeders based on traditional assessment. Finally, I also
developed a regression equation by which fertility of unknown samples could be predicted based
on their ATP1A4 content. However, further testing on a larger sample size is recommended to
further validate ATP1A4 as a potential fertility marker. Moreover, it is likely that single
nucleotide polymorphisms (SNPs) may be associated with this phenotype. Identifying such
genetic markers and its association with other production traits may enable AI companies to
utilize this information for bull selection.
In a series of studies (Konrad et al. 2011, Dietze et al. 2015) on the rat prepubertal Sertoli
cell line 93RS2, the authors suggested that ATP1A4 mRNA, but not the ATP1A4 protein, was
present in these cell lines. Quite interestingly, in other studies, there was no evidence of ATP1A4
mRNA or protein being present in Sertoli cells. Alternatively, there was evidence for ATP1A1
isoform in rat prepubertal Sertoli cell primary cultures. Since ATP1A4 expression is unique to
the male reproductive tract, the final objective of my thesis was to resolve controversies
regarding the existence of Na/K-ATPase isoforms and subsequently to investigate their role in
the assembly and regulation of junctional complexes in Sertoli cells. Using Sertoli cell primary
cultures obtained from prepubertal rats, I determined that ATP1A1 mRNA and protein were
![Page 227: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/227.jpg)
203
present in these cultures. Similar to sperm, participation of some of the signaling molecules (Src,
EGFR and ERK1/2) were identified in ATP1A1-ouabain interaction in Sertoli cells.
Furthermore, I identified that ouabain-mediated ATP1A1 signaling regulated expression of
claudin 11 and connexin 43 in Sertoli cells in a dose-dependent manner. In rats, it is well known
that the mechanism of ouabain action on Na/K-ATPase is dependent upon concentration; a low
dose (nM) activates the signaling pathway with no inhibition of the enzyme activity of Na/K-
ATPase, whereas a high dose (mM) inhibits enzyme activity with no effect on the signaling
pathway. Adding 50 nM (a low, non-inhibitory dose) of ouabain increased TER in Sertoli cells,
increased phosphorylation of signaling molecules (Src, EGFR, ERK1/2, CREB) and
subsequently claudin 11 and connexin 43 expression, whereas 1 mM (high, inhibitory dose) had
opposite effects. Claudin 11 is the predominant member of the claudin family that comprise the
tight junctions which are important constituents of BTB. Furthermore, connexin 43, yet another
predominant member of the connexin family, is present in gap junctions, between Sertoli cells,
and Sertoli and germ cells. In my thesis work, I cultured Sertoli cells on Matrigel coated
substratum for a defined interval, after which cells assembles junctions that mimiced the BTB in
vivo. Using this model, I believe that I have acquired information regarding the role of ATP1A1
on TJ and GJ assembly and regulation. However, a potential drawback is that Sertoli cells exists
in two- dimemsional (2D) architecture in cell culture systems, whereas these cells exist in a
three-dimenional (3D) architecture in the tissue to perform specific functions. Even though the
Sertoli cells form TJ and GJs, this barrier was not very tight, suggesting that it might not
accurately reflect the biology of BTB in vivo. To mitigate this, the next logical step would be to
attempt 3D culture of Sertoli cells where cells are embedded within a scaffold consisting of
extracellular matrix (ECM) proteins and cultured on a thin layer of Matrigel within a transwell
![Page 228: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/228.jpg)
204
system. Sertoli cells would eventually achieve a 3D conformation where they aggregate to form
a TJ bearing tubular-like structure with germ cells at the centre (Gassei et al. 2010). Using this
system, it would be interesting to study effects of ouabain on preleptotene/leptotene
spermatocyte migration when they are co-cultured with Sertoli cells that exist in 3D
confirmation. One of the potential clinical applications that I envision for this particular study is
to manipulate the ATP1A1-ouabain interaction to develop novel approaches for male
contraception. In that regard, the 3D coculture of Sertoli cells and germ cells would give us
valuable information regarding the role of germ cells in ATP1A1-ouabain interaction. It is
noteworthy that ATP1A1-ouabain interaction targets cell-cell interaction in the testis without
interfering with the hypothalamus-pituitary-testis hormonal axis. Therefore, this interaction may
have potential for development of reversible male contraception, with advantages over current
hormonal methods that have undesirable side effects.
Fertility is an important trait in both humans and animals; understanding the molecular
basis of sperm and Sertoli cell function will therefore advance knowledge in reproductive
biology, with implications for developing novel approaches for regulating fertility.
![Page 229: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/229.jpg)
205
References
Abramowitz J, Dai C, Hirschi KK, Dmitrieva RI, Doris PA, Liu L & Allen JC 2003
Ouabain- and marinobufagenin-induced proliferation of human umbilical vein smooth muscle
cells and a rat vascular smooth muscle cell line, A7r5. Circulation 108 3048-3053.
Aitken A 2006 14-3-3 Proteins: a Historic Overview. Seminars in cancer biology 16 162-172.
Aitken RJ &Krausz C 2001 Oxidative stress, DNA damage and the Y chromosome.
Reproduction (Cambridge, England) 122 497-506.
Aitken RJ &Nixon B 2013 Sperm capacitation: a distant landscape glimpsed but unexplored.
Molecular human reproduction 19 785-793.
Amidzadeh Z, Behbahani AB, Erfani N, Sharifzadeh S, Ranjbaran R, Moezi L,
Aboualizadeh F, Okhovat MA, Alavi P & Azarpira N 2014 Assessment of different
permeabilization methods of minimizing damage to the adherent cells for detection of
intracellular RNA by flow cytometry. Avicenna journal of medical biotechnology 6 38-46.
Amikura R, Kashikawa M, Nakamura A & Kobayashi S 2001 Presence of mitochondria-type
ribosomes outside mitochondria in germ plasm of Drosophila embryos. Proceedings of the
National Academy of Sciences of the United States of America 98 9133-9138.
Amikura R, Sato K & Kobayashi S 2005 Role of mitochondrial ribosome-dependent
translation in germline formation in Drosophila embryos. Mechanisms of development 122 1087-
1093.
Anpalakan K 2010 Sodium, potassium-ATPase signalling mechanism inducing capacitation in
bull sperm.
Aperia A 2007 New roles for an old enzyme: Na,K-ATPase emerges as an interesting drug
target. Journal of internal medicine 261 44-52.
Arystarkhova E &Sweadner KJ 1997 Tissue-specific expression of the Na,K-ATPase beta3
subunit. The presence of beta3 in lung and liver addresses the problem of the missing subunit.
The Journal of biological chemistry 272 22405-22408.
Asano A, Selvaraj V, Buttke DE, Nelson JL, Green KM, Evans JE & Travis AJ 2009
Biochemical characterization of membrane fractions in murine sperm: identification of three
distinct sub-types of membrane rafts. Journal of cellular physiology 218 537-548.
Bailey JL, Bilodeau JF & Cormier N 2000 Semen cryopreservation in domestic animals: a
damaging and capacitating phenomenon. Journal of andrology 21 1-7.
![Page 230: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/230.jpg)
206
Bailey JL &Buhr MM 1993 Ca2+ regulation by cryopreserved bull spermatozoa in response to
A23187. Cryobiology 30 470-481.
Bajpai M, Asin S & Doncel GF 2003 Effect of tyrosine kinase inhibitors on tyrosine
phosphorylation and motility parameters in human sperm. Archives of Andrology 49 229-246.
Baldi E, Luconi M, Bonaccorsi L, Muratori M & Forti G 2000 Intracellular events and
signaling pathways involved in sperm acquisition of fertilizing capacity and acrosome reaction.
Frontiers in bioscience : a journal and virtual library 5 E110-23.
Baldwin MA 2004 Protein identification by mass spectrometry: issues to be considered.
Molecular & cellular proteomics : MCP 3 1-9.
Baltierrez-Hoyos R, Roa-Espitia AL & Hernandez-Gonzalez EO 2012 The association
between CDC42 and caveolin-1 is involved in the regulation of capacitation and acrosome
reaction of guinea pig and mouse sperm. Reproduction (Cambridge, England) 144 123-134.
Bansal AK &Bilaspuri GS 2010 Impacts of oxidative stress and antioxidants on semen
functions. Veterinary medicine international 2010 10.4061/2011/686137.
Barth A 1993 Evaluation of frozen bovine semen by the veterinary practitioner. In
Theriogenology Handbook, pp B-9. Anonymous .
Barwe SP, Kim S, Rajasekaran SA, Bowie JU & Rajasekaran AK 2007 Janus model of the
Na,K-ATPase beta-subunit transmembrane domain: distinct faces mediate alpha/beta assembly
and beta-beta homo-oligomerization. Journal of Molecular Biology 365 706-714.
Bastian Y, Roa-Espitia AL, Mujica A & Hernandez-Gonzalez EO 2010 Calpain modulates
capacitation and acrosome reaction through cleavage of the spectrin cytoskeleton. Reproduction
(Cambridge, England) 140 673-684.
Bedu-Addo K, Costello S, Harper C, Machado-Oliveira G, Lefievre L, Ford C, Barratt C &
Publicover S 2008 Mobilisation of stored calcium in the neck region of human sperm--a
mechanism for regulation of flagellar activity. The International journal of developmental
biology 52 615-626.
Bellin ME, Oyarzo JN, Hawkins HE, Zhang H, Smith RG, Forrest DW, Sprott LR & Ax
RL 1998 Fertility-associated antigen on bull sperm indicates fertility potential. Journal of animal
science 76 2032-2039.
Bensaude O 2011 Inhibiting eukaryotic transcription: Which compound to choose? How to
evaluate its activity? Transcription 2 103-108.
![Page 231: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/231.jpg)
207
Bernabo N, Berardinelli P, Mauro A, Russo V, Lucidi P, Mattioli M & Barboni B 2011 The
role of actin in capacitation-related signaling: an in silico and in vitro study. BMC systems
biology 5 47-0509-5-47.
Besse F &Ephrussi A 2008 Translational control of localized mRNAs: restricting protein
synthesis in space and time. Nature reviews.Molecular cell biology 9 971-980.
Bilodeau JF, Chatterjee S, Sirard MA & Gagnon C 2000 Levels of antioxidant defenses are
decreased in bovine spermatozoa after a cycle of freezing and thawing. Molecular reproduction
and development 55 282-288.
Blanco G, Melton RJ, Sanchez G & Mercer RW 1999 Functional characterization of a testes-
specific alpha-subunit isoform of the sodium/potassium adenosinetriphosphatase. Biochemistry
38 13661-13669.
Blanco G &Mercer RW 1998 Isozymes of the Na-K-ATPase: heterogeneity in structure,
diversity in function. The American Journal of Physiology 275 F633-50.
Blanco G, Sanchez G, Melton RJ, Tourtellotte WG & Mercer RW 2000 The alpha4 isoform
of the Na,K-ATPase is expressed in the germ cells of the testes. The journal of histochemistry
and cytochemistry : official journal of the Histochemistry Society 48 1023-1032.
BLIGH EG &DYER WJ 1959 A rapid method of total lipid extraction and purification.
Canadian journal of biochemistry and physiology 37 911-917.
Blok LJ, Chang GT, Steenbeek-Slotboom M, van Weerden WM, Swarts HG, De Pont JJ,
van Steenbrugge GJ & Brinkmann AO 1999 Regulation of expression of Na+,K+-ATPase in
androgen-dependent and androgen-independent prostate cancer. British journal of cancer 81 28-
36.
Boscher C &Nabi IR 2012 Caveolin-1: role in cell signaling. Advances in Experimental
Medicine and Biology 729 29-50.
Bou Khalil M, Chakrabandhu K, Xu H, Weerachatyanukul W, Buhr M, Berger T,
Carmona E, Vuong N, Kumarathasan P, Wong PT, Carrier D & Tanphaichitr N 2006
Sperm capacitation induces an increase in lipid rafts having zona pellucida binding ability and
containing sulfogalactosylglycerolipid. Developmental biology 290 220-235.
Boue F, Blais J & Sullivan R 1996 Surface localization of P34H an epididymal protein, during
maturation, capacitation, and acrosome reaction of human spermatozoa. Biology of reproduction
54 1009-1017.
Braun RE 1998 Post-transcriptional control of gene expression during spermatogenesis.
Seminars in cell & developmental biology 9 483-489.
![Page 232: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/232.jpg)
208
Brehm R &Steger K 2005 Regulation of Sertoli cell and germ cell differentation. Advances in
Anatomy, Embryology, and Cell Biology 181 1-93.
Brehm R, Zeiler M, Ruttinger C, Herde K, Kibschull M, Winterhager E, Willecke K,
Guillou F, Lecureuil C, Steger K, Konrad L, Biermann K, Failing K & Bergmann M 2007
A sertoli cell-specific knockout of connexin43 prevents initiation of spermatogenesis. The
American journal of pathology 171 19-31.
Breitbart H, Cohen G & Rubinstein S 2005 Role of actin cytoskeleton in mammalian sperm
capacitation and the acrosome reaction. Reproduction (Cambridge, England) 129 263-268.
Brener E, Rubinstein S, Cohen G, Shternall K, Rivlin J & Breitbart H 2003 Remodeling of
the actin cytoskeleton during mammalian sperm capacitation and acrosome reaction. Biology of
reproduction 68 837-845.
Brinsko SP, Love CC, Bauer JE, Macpherson ML & Varner DD 2007 Cholesterol-to-
phospholipid ratio in whole sperm and seminal plasma from fertile stallions and stallions with
unexplained subfertility. Animal Reproduction Science 99 65-71.
Brockmann R, Beyer A, Heinisch JJ & Wilhelm T 2007 Posttranscriptional expression
regulation: what determines translation rates? PLoS computational biology 3 e57.
Brown DA 2006 Lipid rafts, detergent-resistant membranes, and raft targeting signals.
Physiology (Bethesda, Md.) 21 430-439.
Brown DA &London E 2000 Structure and function of sphingolipid- and cholesterol-rich
membrane rafts. The Journal of biological chemistry 275 17221-17224.
Byrne DP, Dart C & Rigden DJ 2012 Evaluating caveolin interactions: do proteins interact
with the caveolin scaffolding domain through a widespread aromatic residue-rich motif? PloS
one 7 e44879.
Caballero J, Frenette G, D'Amours O, Belleannee C, Lacroix-Pepin N, Robert C &
Sullivan R 2012 Bovine sperm raft membrane associated Glioma Pathogenesis-Related 1-like
protein 1 (GliPr1L1) is modified during the epididymal transit and is potentially involved in
sperm binding to the zona pellucida. Journal of cellular physiology 227 3876-3886.
Cai T, Wang H, Chen Y, Liu L, Gunning WT, Quintas LE & Xie ZJ 2008 Regulation of
caveolin-1 membrane trafficking by the Na/K-ATPase. The Journal of cell biology 182 1153-
1169.
Cancel AM, Chapman DA & Killian GJ 1997 Osteopontin is the 55-kilodalton fertility-
associated protein in Holstein bull seminal plasma. Biology of reproduction 57 1293-1301.
![Page 233: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/233.jpg)
209
Cantiello HF 1995 Actin filaments stimulate the Na(+)-K(+)-ATPase. The American Journal of
Physiology 269 F637-43.
Card CJ, Anderson EJ, Zamberlan S, Krieger KE, Kaproth M & Sartini BL 2013
Cryopreserved bovine spermatozoal transcript profile as revealed by high-throughput ribonucleic
acid sequencing. Biology of reproduction 88 49.
Carlier MF, Ressad F & Pantaloni D 1999 Control of actin dynamics in cell motility. Role of
ADF/cofilin. The Journal of biological chemistry 274 33827-33830.
Carrera A, Moos J, Ning XP, Gerton GL, Tesarik J, Kopf GS & Moss SB 1996 Regulation
of protein tyrosine phosphorylation in human sperm by a calcium/calmodulin-dependent
mechanism: identification of A kinase anchor proteins as major substrates for tyrosine
phosphorylation. Developmental biology 180 284-296.
Cheng J, Watkins SC & Walker WH 2007 Testosterone activates mitogen-activated protein
kinase via Src kinase and the epidermal growth factor receptor in sertoli cells. Endocrinology
148 2066-2074.
Chifflet S, Torriglia A, Chiesa R & Tolosa S 1988 A method for the determination of
inorganic phosphate in the presence of labile organic phosphate and high concentrations of
protein: application to lens ATPases. Analytical Biochemistry 168 1-4.
Christensen P, Hansen C, Liboriussen T & Lehn-Jensen H 2005 Implementation of flow
cytometry for quality control in four Danish bull studs. Animal Reproduction Science 85 201-
208.
Chung SS, Lee WM & Cheng CY 1999 Study on the formation of specialized inter-Sertoli cell
junctions in vitro. Journal of cellular physiology 181 258-272.
Cohen G, Rubinstein S, Gur Y & Breitbart H 2004 Crosstalk between protein kinase A and C
regulates phospholipase D and F-actin formation during sperm capacitation. Developmental
biology 267 230-241.
Collin S, Sirard MA, Dufour M & Bailey JL 2000 Sperm calcium levels and chlortetracycline
fluorescence patterns are related to the in vivo fertility of cryopreserved bovine semen. Journal
of andrology 21 938-943.
Collins BM, Davis MJ, Hancock JF & Parton RG 2012 Structure-based reassessment of the
caveolin signaling model: do caveolae regulate signaling through caveolin-protein interactions?
Developmental cell 23 11-20.
Cooney MA, Malcuit C, Cheon B, Holland MK, Fissore RA & D'Cruz NT 2010 Species-
specific differences in the activity and nuclear localization of murine and bovine phospholipase
C zeta 1. Biology of reproduction 83 92-101.
![Page 234: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/234.jpg)
210
Couet J, Li S, Okamoto T, Ikezu T & Lisanti MP 1997 Identification of peptide and protein
ligands for the caveolin-scaffolding domain. Implications for the interaction of caveolin with
caveolae-associated proteins. The Journal of biological chemistry 272 6525-6533.
Counillon L &Pouyssegur J 2000 The expanding family of eucaryotic Na(+)/H(+) exchangers.
The Journal of biological chemistry 275 1-4.
Cross NL 2004 Reorganization of lipid rafts during capacitation of human sperm. Biology of
reproduction 71 1367-1373.
Cunningham RD &Bridgers WF 1970 Brain and liver mitochondrial protein synthesis:
potassium dependent chloramphenicol inhibition. Biochemical and biophysical research
communications 38 99-105.
Dahl JL &Hokin LE 1974 The sodium-potassium adenosinetriphosphatase. Annual Review of
Biochemistry 43 327-356.
D'Amours O, Frenette G, Fortier M, Leclerc P & Sullivan R 2010 Proteomic comparison of
detergent-extracted sperm proteins from bulls with different fertility indexes. Reproduction
(Cambridge, England) 139 545-556.
Dani C, Mechti N, Piechaczyk M, Lebleu B, Jeanteur P & Blanchard JM 1985 Increased
rate of degradation of c-myc mRNA in interferon-treated Daudi cells. Proceedings of the
National Academy of Sciences of the United States of America 82 4896-4899.
Daniel L, Etkovitz N, Weiss SR, Rubinstein S, Ickowicz D & Breitbart H 2010 Regulation of
the sperm EGF receptor by ouabain leads to initiation of the acrosome reaction. Developmental
biology 344 650-657.
Das PJ, McCarthy F, Vishnoi M, Paria N, Gresham C, Li G, Kachroo P, Sudderth AK,
Teague S, Love CC, Varner DD, Chowdhary BP & Raudsepp T 2013 Stallion sperm
transcriptome comprises functionally coherent coding and regulatory RNAs as revealed by
microarray analysis and RNA-seq. PloS one 8 e56535.
Davis BK 1981 Timing of fertilization in mammals: sperm cholesterol/phospholipid ratio as a
determinant of the capacitation interval. Proceedings of the National Academy of Sciences of the
United States of America 78 7560-7564.
de Lamirande E &Gagnon C 1998 Paradoxical effect of reagents for sulfhydryl and disulfide
groups on human sperm capacitation and superoxide production. Free radical biology &
medicine 25 803-817.
de Lamirande E &Gagnon C 2002 The extracellular signal-regulated kinase (ERK) pathway is
involved in human sperm function and modulated by the superoxide anion. Molecular human
reproduction 8 124-135.
![Page 235: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/235.jpg)
211
de Lima Santos H &Ciancaglini P 2000 A practical approach to the choice of a suitable
detergent and optimal conditions for solubilizing a membrane protein. Biochemical education 28
178-182.
de Nadal E, Alepuz PM & Posas F 2002 Dealing with osmostress through MAP kinase
activation. EMBO reports 3 735-740.
de Sousa Abreu R, Penalva LO, Marcotte EM & Vogel C 2009 Global signatures of protein
and mRNA expression levels. Molecular bioSystems 5 1512-1526.
De Vries WN, Evsikov AV, Haac BE, Fancher KS, Holbrook AE, Kemler R, Solter D &
Knowles BB 2004 Maternal beta-catenin and E-cadherin in mouse development. Development
(Cambridge, England) 131 4435-4445.
Decker CJ &Parker R 2012 P-bodies and stress granules: possible roles in the control of
translation and mRNA degradation. Cold Spring Harbor perspectives in biology 4 a012286.
Del Olmo E, Bisbal A, Garcia-Alvarez O, Maroto-Morales A, Ramon M, Jimenez-Rabadan
P, Anel-Lopez L, Soler AJ, Garde JJ & Fernandez-Santos MR 2014 Free-radical production
after post-thaw incubation of ram spermatozoa is related to decreased in vivo fertility.
Reproduction, fertility, and development.
Demarco IA, Espinosa F, Edwards J, Sosnik J, De La Vega-Beltran JL, Hockensmith JW,
Kopf GS, Darszon A & Visconti PE 2003 Involvement of a Na+/HCO-3 cotransporter in
mouse sperm capacitation. The Journal of biological chemistry 278 7001-7009.
Dietze R, Konrad L, Shihan M, Kirch U & Scheiner-Bobis G 2013 Cardiac glycoside ouabain
induces activation of ATF-1 and StAR expression by interacting with the alpha4 isoform of the
sodium pump in Sertoli cells. Biochimica et biophysica acta 1833 511-519.
Dietze R, Shihan M, Stammler A, Konrad L & Scheiner-Bobis G 2015 Cardiotonic steroid
ouabain stimulates expression of blood-testis barrier proteins claudin-1 and -11 and formation of
tight junctions in Sertoli cells. Molecular and cellular endocrinology 405 1-13.
Dogan S, Vargovic P, Oliveira R, Belser LE, Kaya A, Moura A, Sutovsky P, Parrish J,
Topper E & Memili E 2015 Sperm protamine-status correlates to the fertility of breeding bulls.
Biology of reproduction 92 92.
Doi N, Takashima H, Kinjo M, Sakata K, Kawahashi Y, Oishi Y, Oyama R, Miyamoto-
Sato E, Sawasaki T, Endo Y & Yanagawa H 2002 Novel fluorescence labeling and high-
throughput assay technologies for in vitro analysis of protein interactions. Genome research 12
487-492.
![Page 236: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/236.jpg)
212
Donatello S, Babina IS, Hazelwood LD, Hill AD, Nabi IR & Hopkins AM 2012 Lipid raft
association restricts CD44-ezrin interaction and promotion of breast cancer cell migration. The
American journal of pathology 181 2172-2187.
Doormaal B 1998 Review of the Canadian Non-return Rate System. 14-17.
Ducummon CC &Berger T 2006 Localization of the Rho GTPases and some Rho effector
proteins in the sperm of several mammalian species. Zygote (Cambridge, England) 14 249-257.
Dun MD, Aitken RJ & Nixon B 2012 The role of molecular chaperones in spermatogenesis and
the post-testicular maturation of mammalian spermatozoa. Human reproduction update 18 420-
435.
Duran MJ, Pierre SV, Lesnik P, Pieroni G, Bourdeaux M, Dignat-Georges F, Sampol J &
Maixent JM 2010 7-ketocholesterol inhibits Na,K-ATPase activity by decreasing expression of
its alpha1-subunit and membrane fluidity in human endothelial cells. Cellular and molecular
biology (Noisy-le-Grand, France) 56 Suppl OL1434-41.
Efendiev R, Chen Z, Krmar RT, Uhles S, Katz AI, Pedemonte CH & Bertorello AM 2005
The 14-3-3 protein translates the NA+,K+-ATPase {alpha}1-subunit phosphorylation signal into
binding and activation of phosphoinositide 3-kinase during endocytosis. The Journal of
biological chemistry 280 16272-16277.
Elesmann M 1983 Detergent Solubilization of Na,K-ATPase. Curr. Top. Membr. Transp. 19 67-
81.
Emmelot P &Bos CJ 1966 Studies on plasma membranes. 3. Mg2+-ATPase,(Na+-K+-Mg2+)-
ATPase and 5'-nucleotidase activity of plasma membranes isolated from rat liver. Biochimica et
biophysica acta 120 369-382.
ERNSTER L &LINDBERG O 1956 Determination of organic phosphorus compounds by
phosphate analysis. Methods of biochemical analysis 3 1-22.
Etkovitz N, Rubinstein S, Daniel L & Breitbart H 2007 Role of PI3-kinase and PI4-kinase in
actin polymerization during bovine sperm capacitation. Biology of reproduction 77 263-273.
Eusebi F, Ziparo E, Fratamico G, Russo MA & Stefanini M 1983 Intercellular
communication in rat seminiferous tubules. Developmental biology 100 249-255.
Farstad W 2012 Customizing semen preservation protocols for individual dogs and individual
species: sperm preservation beyond the state of the art. Reproduction in domestic animals =
Zuchthygiene 47 Suppl 6 269-273.
Fedorova LV, Raju V, El-Okdi N, Shidyak A, Kennedy DJ, Vetteth S, Giovannucci DR,
Bagrov AY, Fedorova OV, Shapiro JI & Malhotra D 2009 The cardiotonic steroid hormone
![Page 237: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/237.jpg)
213
marinobufagenin induces renal fibrosis: implication of epithelial-to-mesenchymal transition.
American journal of physiology.Renal physiology 296 F922-34.
Felipe-Perez YE, Valencia J, Juarez-Mosqueda Mde L, Pescador N, Roa-Espitia AL &
Hernandez-Gonzalez EO 2012 Cytoskeletal proteins F-actin and beta-dystrobrevin are altered
by the cryopreservation process in bull sperm. Cryobiology 64 103-109.
Fix C, Jordan C, Cano P & Walker WH 2004 Testosterone activates mitogen-activated
protein kinase and the cAMP response element binding protein transcription factor in Sertoli
cells. Proceedings of the National Academy of Sciences of the United States of America 101
10919-10924.
Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, Noda T, Kubo A &
Tsukita S 2002 Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a
lesson from claudin-1-deficient mice. The Journal of cell biology 156 1099-1111.
Funahashi H 2002 Induction of capacitation and the acrosome reaction of boar spermatozoa by
L-arginine and nitric oxide synthesis associated with the anion transport system. Reproduction
(Cambridge, England) 124 857-864.
Gadea J, Selles E, Marco MA, Coy P, Matas C, Romar R & Ruiz S 2004 Decrease in
glutathione content in boar sperm after cryopreservation. Effect of the addition of reduced
glutathione to the freezing and thawing extenders. Theriogenology 62 690-701.
Gadella BM &Harrison RA 2000 The capacitating agent bicarbonate induces protein kinase A-
dependent changes in phospholipid transbilayer behavior in the sperm plasma membrane.
Development (Cambridge, England) 127 2407-2420.
Gadella BM, Tsai PS, Boerke A & Brewis IA 2008 Sperm head membrane reorganisation
during capacitation. The International journal of developmental biology 52 473-480.
Galantino-Homer HL, Visconti PE, Kopf GS 1997 Regulation of protein tyrosine
phosphorylation during bovine sperm capacitation by a cyclic adenosine 3'5'-monophosphate-
dependent pathway. Biol Reprod 56 707-719
Gassei K, Ehmcke J, Wood MA, Walker WH & Schlatt S 2010 Immature rat seminiferous
tubules reconstructed in vitro express markers of Sertoli cell maturation after xenografting into
nude mouse hosts. Molecular human reproduction 16 97-110.
Gatewood JM, Cook GR, Balhorn R, Bradbury EM & Schmid CW 1987 Sequence-specific
packaging of DNA in human sperm chromatin. Science (New York, N.Y.) 236 962-964.
Geering K 1991 The functional role of the beta-subunit in the maturation and intracellular
transport of Na,K-ATPase. FEBS letters 285 189-193.
![Page 238: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/238.jpg)
214
Gerena RL, Irikura D, Urade Y, Eguchi N, Chapman DA & Killian GJ 1998 Identification
of a fertility-associated protein in bull seminal plasma as lipocalin-type prostaglandin D
synthase. Biology of reproduction 58 826-833.
Gilbert I, Bissonnette N, Boissonneault G, Vallee M & Robert C 2007 A molecular analysis
of the population of mRNA in bovine spermatozoa. Reproduction (Cambridge, England) 133
1073-1086.
Girouard J, Frenette G & Sullivan R 2008 Seminal plasma proteins regulate the association of
lipids and proteins within detergent-resistant membrane domains of bovine spermatozoa. Biology
of reproduction 78 921-931.
Gow A, Southwood CM, Li JS, Pariali M, Riordan GP, Brodie SE, Danias J, Bronstein JM,
Kachar B & Lazzarini RA 1999 CNS myelin and sertoli cell tight junction strands are absent in
Osp/claudin-11 null mice. Cell 99 649-659.
Graham JK 2001 Assessment of sperm quality: a flow cytometric approach. Animal
Reproduction Science 68 239-247.
Grasa P, Cebrian-Perez JA & Muino-Blanco T 2006 Signal transduction mechanisms
involved in in vitro ram sperm capacitation. Reproduction (Cambridge, England) 132 721-732.
Grima J, Wong CC, Zhu LJ, Zong SD & Cheng CY 1998 Testin secreted by Sertoli cells is
associated with the cell surface, and its expression correlates with the disruption of Sertoli-germ
cell junctions but not the inter-Sertoli tight junction. The Journal of biological chemistry 273
21040-21053.
Gur Y &Breitbart H 2006 Mammalian sperm translate nuclear-encoded proteins by
mitochondrial-type ribosomes. Genes & development 20 411-416.
Haas M, Askari A & Xie Z 2000 Involvement of Src and epidermal growth factor receptor in
the signal-transducing function of Na+/K+-ATPase. The Journal of biological chemistry 275
27832-27837.
Hall A 1998 Rho GTPases and the actin cytoskeleton. Science (New York, N.Y.) 279 509-514.
Hall SM, Evans J & Haworth SG 1993 Influence of cold preservation on the cytoskeleton of
cultured pulmonary arterial endothelial cells. American journal of respiratory cell and molecular
biology 9 106-114.
Hammerstedt RH, Graham JK & Nolan JP 1990 Cryopreservation of mammalian sperm:
what we ask them to survive. Journal of andrology 11 73-88.
Hansen GR 2006 Managing bull fertility in beef bull herds. http://edis.ifas.ufl.edu./ 2016 9.
![Page 239: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/239.jpg)
215
Hartsock A &Nelson WJ 2008 Adherens and tight junctions: structure, function and
connections to the actin cytoskeleton. Biochimica et biophysica acta 1778 660-669.
Harrison RA, Mairet B & Miller NG 1993 Flow cytometric studies of bicarbonate-mediated
Ca2+ influx in boar sperm populations. Molecular reproduction and development 35 197-208.
Haverfield JT, Meachem SJ, O'Bryan MK, McLachlan RI & Stanton PG 2013 Claudin-11
and connexin-43 display altered spatial patterns of organization in men with primary
seminiferous tubule failure compared with controls. Fertility and sterility 100 658-666.
He L &Fox MH 1996 Comparison of flow cytometry and western blotting to measure Hsp70.
Cytometry 25 280-286.
Head BP &Insel PA 2007 Do caveolins regulate cells by actions outside of caveolae? Trends in
cell biology 17 51-57.
Helms JB &Zurzolo C 2004 Lipids as targeting signals: lipid rafts and intracellular trafficking.
Traffic (Copenhagen, Denmark) 5 247-254.
Hendrick JP &Hartl FU 1993 Molecular chaperone functions of heat-shock proteins. Annual
Review of Biochemistry 62 349-384.
Hernandez-Gonzalez EO, Sosnik J, Edwards J, Acevedo JJ, Mendoza-Lujambio I, Lopez-
Gonzalez I, Demarco I, Wertheimer E, Darszon A & Visconti PE 2006 Sodium and epithelial
sodium channels participate in the regulation of the capacitation-associated hyperpolarization in
mouse sperm. The Journal of biological chemistry 281 5623-5633.
Herrero MB, de Lamirande E & Gagnon C 2001 Tyrosine nitration in human spermatozoa: a
physiological function of peroxynitrite, the reaction product of nitric oxide and superoxide.
Molecular human reproduction 7 913-921.
Heyn P, Kalinka AT, Tomancak P & Neugebauer KM 2015 Introns and gene expression:
cellular constraints, transcriptional regulation, and evolutionary consequences. BioEssays : news
and reviews in molecular, cellular and developmental biology 37 148-154.
Hickey KD &Buhr MM 2011 Lipid bilayer composition affects transmembrane protein
orientation and function. Journal of lipids 2011 208457.
Hillman P, Ickowicz D, Vizel R & Breitbart H 2013 Dissociation between AKAP3 and
PKARII promotes AKAP3 degradation in sperm capacitation. PloS one 8 e68873.
Hlivko JT, Chakraborty S, Hlivko TJ, Sengupta A & James PF 2006 The human Na,K-
ATPase alpha 4 isoform is a ouabain-sensitive alpha isoform that is expressed in sperm.
Molecular reproduction and development 73 101-115.
![Page 240: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/240.jpg)
216
Ho HC &Suarez SS 2001 An inositol 1,4,5-trisphosphate receptor-gated intracellular Ca(2+)
store is involved in regulating sperm hyperactivated motility. Biology of reproduction 65 1606-
1615.
Hoffmann EK &Simonsen LO 1989 Membrane mechanisms in volume and pH regulation in
vertebrate cells. Physiological Reviews 69 315-382.
Horowitz B, Eakle KA, Scheiner-Bobis G, Randolph GR, Chen CY, Hitzeman RA & Farley
RA 1990 Synthesis and assembly of functional mammalian Na,K-ATPase in yeast. The Journal
of biological chemistry 265 4189-4192.
Hossain MS, Johannisson A, Wallgren M, Nagy S, Siqueira AP & Rodriguez-Martinez H
2011 Flow cytometry for the assessment of animal sperm integrity and functionality: state of the
art. Asian Journal of Andrology 13 406-419.
Hughes CM, Lewis SE, McKelvey-Martin VJ & Thompson W 1996 A comparison of
baseline and induced DNA damage in human spermatozoa from fertile and infertile men, using a
modified comet assay. Molecular human reproduction 2 613-619.
Ickowicz D, Finkelstein M & Breitbart H 2012 Mechanism of sperm capacitation and the
acrosome reaction: role of protein kinases. Asian Journal of Andrology 14 816-821.
Inoue N, Ikawa M, Isotani A & Okabe M 2005 The immunoglobulin superfamily protein
Izumo is required for sperm to fuse with eggs. Nature 434 234-238.
Janecki A, Jakubowiak A & Steinberger A 1991 Regulation of transepithelial electrical
resistance in two-compartment Sertoli cell cultures: in vitro model of the blood-testis barrier.
Endocrinology 129 1489-1496.
Jarvis S, Elliott DJ, Morgan D, Winston R & Readhead C 2005 Molecular markers for the
assessment of postnatal male germ cell development in the mouse. Human reproduction (Oxford,
England) 20 108-116.
Jiang Y, Zhang Y, Luan J, Duan H, Zhang F, Yagasaki K & Zhang G 2010 Effects of
bufalin on the proliferation of human lung cancer cells and its molecular mechanisms of action.
Cytotechnology 62 573-583.
Jimenez T, McDermott JP, Sanchez G & Blanco G 2011a Na,K-ATPase alpha4 isoform is
essential for sperm fertility. Proceedings of the National Academy of Sciences of the United
States of America 108 644-649.
Jimenez T, Sanchez G & Blanco G 2012 Activity of the Na,K-ATPase alpha4 isoform is
regulated during sperm capacitation to support sperm motility. Journal of andrology 33 1047-
1057.
![Page 241: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/241.jpg)
217
Jimenez T, Sanchez G, McDermott JP, Nguyen AN, Kumar TR & Blanco G 2011b
Increased expression of the Na,K-ATPase alpha4 isoform enhances sperm motility in transgenic
mice. Biology of reproduction 84 153-161.
Jimenez T, Sanchez G, Wertheimer E & Blanco G 2010 Activity of the Na,K-ATPase alpha4
isoform is important for membrane potential, intracellular Ca2+, and pH to maintain motility in
rat spermatozoa. Reproduction (Cambridge, England) 139 835-845.
Jorgensen PL, Hakansson KO & Karlish SJ 2003 Structure and mechanism of Na,K-ATPase:
functional sites and their interactions. Annual Review of Physiology 65 817-849.
Jung J, Yoon T, Choi EC & Lee K 2002 Interaction of cofilin with triose-phosphate isomerase
contributes glycolytic fuel for Na,K-ATPase via Rho-mediated signaling pathway. The Journal
of biological chemistry 277 48931-48937.
Kaplan JH 2002 Biochemistry of Na,K-ATPase. Annual Review of Biochemistry 71 511-535.
Kasimanickam V, Kasimanickam R, Arangasamy A, Saberivand A, Stevenson JS &
Kastelic JP 2012 Association between mRNA abundance of functional sperm function proteins
and fertility of Holstein bulls. Theriogenology 78 2007-2019.e2.
Kastelic JP &Thundathil JC 2008 Breeding soundness evaluation and semen analysis for
predicting bull fertility. Reproduction in domestic animals = Zuchthygiene 43 Suppl 2 368-373.
Kaur G &Dufour JM 2012 Cell lines: Valuable tools or useless artifacts. Spermatogenesis 2 1-
5.
Kelly RA &Smith TW 1993 Digoxin in heart failure: implications of recent trials. Journal of
the American College of Cardiology 22 107A-112A.
Kennedy C, Ahlering P, Rodriguez H, Levy S & Sutovsky P 2011 Sperm chromatin structure
correlates with spontaneous abortion and multiple pregnancy rates in assisted reproduction.
Reproductive biomedicine online 22 272-276.
Kimura S, Noda T & Yoshimori T 2007 Dissection of the autophagosome maturation process
by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 3 452-460.
Kodama H, Yamaguchi R, Fukuda J, Kasai H & Tanaka T 1997 Increased oxidative
deoxyribonucleic acid damage in the spermatozoa of infertile male patients. Fertility and sterility
68 519-524.
Konrad L, Dietze R, Kirch U, Kirch H, Eva A & Scheiner-Bobis G 2011 Cardiotonic steroids
trigger non-classical testosterone signaling in Sertoli cells via the alpha4 isoform of the sodium
pump. Biochimica et biophysica acta 1813 2118-2124.
![Page 242: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/242.jpg)
218
Krasznai Z, Krasznai ZT, Morisawa M, Bazsane ZK, Hernadi Z, Fazekas Z, Tron L, Goda
K & Marian T 2006 Role of the Na+/Ca2+ exchanger in calcium homeostasis and human sperm
motility regulation. Cell motility and the cytoskeleton 63 66-76.
Kubota H, Hynes G, Carne A, Ashworth A & Willison K 1994 Identification of six Tcp-1-
related genes encoding divergent subunits of the TCP-1-containing chaperonin. Current biology :
CB 4 89-99.
Kumar G, Patel D & Naz RK 1993 c-MYC mRNA is present in human sperm cells. Cellular &
molecular biology research 39 111-117.
Kuster CE, Hess RA & Althouse GC 2004 Immunofluorescence reveals ubiquitination of
retained distal cytoplasmic droplets on ejaculated porcine spermatozoa. Journal of andrology 25
340-347.
Lajoie P &Nabi IR 2010 Lipid rafts, caveolae, and their endocytosis. International review of
cell and molecular biology 282 135-163.
Lalancette C, Thibault C, Bachand I, Caron N & Bissonnette N 2008 Transcriptome analysis
of bull semen with extreme nonreturn rate: use of suppression-subtractive hybridization to
identify functional markers for fertility. Biology of reproduction 78 618-635.
Larre I, Lazaro A, Contreras RG, Balda MS, Matter K, Flores-Maldonado C, Ponce A,
Flores-Benitez D, Rincon-Heredia R, Padilla-Benavides T, Castillo A, Shoshani L &
Cereijido M 2010 Ouabain modulates epithelial cell tight junction. Proceedings of the National
Academy of Sciences of the United States of America 107 11387-11392.
Larre I, Ponce A, Fiorentino R, Shoshani L, Contreras RG & Cereijido M 2006 Contacts
and cooperation between cells depend on the hormone ouabain. Proceedings of the National
Academy of Sciences of the United States of America 103 10911-10916.
Larson JL &Miller DJ 2000 Can relative spermatozoal galactosyltransferase activity be
predictive of dairy bull fertility? Journal of dairy science 83 2473-2479.
Lasso JL, Noiles EE, Alvarez JG & Storey BT 1994 Mechanism of superoxide dismutase loss
from human sperm cells during cryopreservation. Journal of andrology 15 255-265.
Lax Y, Rubinstein S & Breitbart H 1994 Epidermal growth factor induces acrosomal
exocytosis in bovine sperm. FEBS letters 339 234-238.
Leclerc P, de Lamirande E & Gagnon C 1998 Interaction between Ca2+, cyclic 3',5' adenosine
monophosphate, the superoxide anion, and tyrosine phosphorylation pathways in the regulation
of human sperm capacitation. Journal of andrology 19 434-443.
![Page 243: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/243.jpg)
219
Lee VW, de Kretser DM, Hudson B & Wang C 1975 Variations in serum FSH, LH and
testosterone levels in male rats from birth to sexual maturity. Journal of reproduction and
fertility 42 121-126.
Lemma A 2011 Effect of cryopreservation on sperm quality and fertility. In Artificial
Insemination in Farm Animals, Anonymous .
Lessard C, Parent S, Leclerc P, Bailey JL & Sullivan R 2000 Cryopreservation alters the
levels of the bull sperm surface protein P25b. Journal of andrology 21 700-707.
Li MW, Mruk DD, Lee WM & Cheng CY 2009 Connexin 43 and plakophilin-2 as a protein
complex that regulates blood-testis barrier dynamics. Proceedings of the National Academy of
Sciences of the United States of America 106 10213-10218.
Li S, Janosch P, Tanji M, Rosenfeld GC, Waymire JC, Mischak H, Kolch W & Sedivy JM
1995 Regulation of Raf-1 kinase activity by the 14-3-3 family of proteins. The EMBO journal 14
685-696.
Li Z &Xie Z 2009 The Na/K-ATPase/Src complex and cardiotonic steroid-activated protein
kinase cascades. Pflugers Archiv : European journal of physiology 457 635-644.
Liang M, Tian J, Liu L, Pierre S, Liu J, Shapiro J & Xie ZJ 2007 Identification of a pool of
non-pumping Na/K-ATPase. The Journal of biological chemistry 282 10585-10593.
Liu H, Sadygov RG & Yates JR,3rd 2004 A model for random sampling and estimation of
relative protein abundance in shotgun proteomics. Analytical Chemistry 76 4193-4201.
Liu J, Tian J, Haas M, Shapiro JI, Askari A & Xie Z 2000 Ouabain interaction with cardiac
Na+/K+-ATPase initiates signal cascades independent of changes in intracellular Na+ and Ca2+
concentrations. The Journal of biological chemistry 275 27838-27844.
Liu L &Askari A 2006 Beta-subunit of cardiac Na+-K+-ATPase dictates the concentration of
the functional enzyme in caveolae. American journal of physiology.Cell physiology 291 C569-
78.
Liu L, Ivanov AV, Gable ME, Jolivel F, Morrill GA & Askari A 2011 Comparative
properties of caveolar and noncaveolar preparations of kidney Na+/K+-ATPase. Biochemistry 50
8664-8673.
Liu L, Mohammadi K, Aynafshar B, Wang H, Li D, Liu J, Ivanov AV, Xie Z & Askari A
2003 Role of caveolae in signal-transducing function of cardiac Na+/K+-ATPase. American
journal of physiology.Cell physiology 284 C1550-60.
![Page 244: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/244.jpg)
220
Lopes S, Jurisicova A, Sun JG & Casper RF 1998 Reactive oxygen species: potential cause
for DNA fragmentation in human spermatozoa. Human reproduction (Oxford, England) 13 896-
900.
Lovercamp K 2009 Factors Affecting the Presence of Reactive Oxygen Species in the Fresh and
Extended Porcine Ejaculate.
Lovercamp KW, Safranski TJ, Fischer KA, Manandhar G, Sutovsky M, Herring W &
Sutovsky P 2007 Arachidonate 15-lipoxygenase and ubiquitin as fertility markers in boars.
Theriogenology 67 704-718.
Lucas TF, Amaral LS, Porto CS & Quintas LE 2012 Na+/K+-ATPase alpha1 isoform
mediates ouabain-induced expression of cyclin D1 and proliferation of rat sertoli cells.
Reproduction (Cambridge, England) 144 737-745.
Lundgren DH, Hwang SI, Wu L & Han DK 2010 Role of spectral counting in quantitative
proteomics. Expert review of proteomics 7 39-53.
Maier T, Guell M & Serrano L 2009 Correlation of mRNA and protein in complex biological
samples. FEBS letters 583 3966-3973.
Mann M, Ong SE, Gronborg M, Steen H, Jensen ON & Pandey A 2002 Analysis of protein
phosphorylation using mass spectrometry: deciphering the phosphoproteome. Trends in
biotechnology 20 261-268.
Markou T, Hadzopoulou-Cladaras M & Lazou A 2004 Phenylephrine induces activation of
CREB in adult rat cardiac myocytes through MSK1 and PKA signaling pathways. Journal of
Molecular and Cellular Cardiology 37 1001-1011.
Martin PE, Hill NS, Kristensen B, Errington RJ & Griffith TM 2003 Ouabain exerts
biphasic effects on connexin functionality and expression in vascular smooth muscle cells.
British journal of pharmacology 140 1261-1271.
Martinez-Lopez P, Santi CM, Trevino CL, Ocampo-Gutierrez AY, Acevedo JJ, Alisio A,
Salkoff LB & Darszon A 2009 Mouse sperm K+ currents stimulated by pH and cAMP possibly
coded by Slo3 channels. Biochemical and biophysical research communications 381 204-209.
Mata J, Marguerat S & Bahler J 2005 Post-transcriptional control of gene expression: a
genome-wide perspective. Trends in biochemical sciences 30 506-514.
Mazaud-Guittot S, Meugnier E, Pesenti S, Wu X, Vidal H, Gow A & Le Magueresse-
Battistoni B 2010 Claudin 11 deficiency in mice results in loss of the Sertoli cell epithelial
phenotype in the testis. Biology of reproduction 82 202-213.
![Page 245: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/245.jpg)
221
McCabe MJ, Foo CF, Dinger ME, Smooker PM & Stanton PG 2015 Claudin-11 and
occludin are major contributors to Sertoli cell tight junction function, Asian Journal of
Andrology.
McCauley TC, Zhang HM, Bellin ME & Ax RL 2001 Identification of a heparin-binding
protein in bovine seminal fluid as tissue inhibitor of metalloproteinases-2. Molecular
reproduction and development 58 336-341.
McDermott JP, Sanchez G, Chennathukuzhi V & Blanco G 2012 Green fluorescence protein
driven by the Na,K-ATPase alpha4 isoform promoter is expressed only in male germ cells of
mouse testis. Journal of assisted reproduction and genetics 29 1313-1325.
McGinley DM, Posalaky Z, Porvaznik M & Russell L 1979 Gap junctions between Sertoli
and germ cells of rat seminiferous tubules. Tissue & cell 11 741-754.
Miller D &Ostermeier GC 2006 Spermatozoal RNA: Why is it there and what does it do?
Gynecologie, obstetrique & fertilite 34 840-846.
Mineo C, Gill GN & Anderson RG 1999 Regulated migration of epidermal growth factor
receptor from caveolae. The Journal of biological chemistry 274 30636-30643.
Mitamura T, Iwamoto R, Umata T, Yomo T, Urabe I, Tsuneoka M & Mekada E 1992 The
27-kD diphtheria toxin receptor-associated protein (DRAP27) from vero cells is the monkey
homologue of human CD9 antigen: expression of DRAP27 elevates the number of diphtheria
toxin receptors on toxin-sensitive cells. The Journal of cell biology 118 1389-1399.
Miyakawa-Naito A, Uhlen P, Lal M, Aizman O, Mikoshiba K, Brismar H, Zelenin S &
Aperia A 2003 Cell signaling microdomain with Na,K-ATPase and inositol 1,4,5-trisphosphate
receptor generates calcium oscillations. The Journal of biological chemistry 278 50355-50361.
Mobasheri A, Avila J, Cozar-Castellano I, Brownleader MD, Trevan M, Francis MJ, Lamb
JF & Martin-Vasallo P 2000 Na+, K+-ATPase isozyme diversity; comparative biochemistry
and physiological implications of novel functional interactions. Bioscience reports 20 51-91.
Mohammadi K, Kometiani P, Xie Z & Askari A 2001 Role of protein kinase C in the signal
pathways that link Na+/K+-ATPase to ERK1/2. The Journal of biological chemistry 276 42050-
42056.
Mohammadi K, Liu L, Tian J, Kometiani P, Xie Z & Askari A 2003 Positive inotropic effect
of ouabain on isolated heart is accompanied by activation of signal pathways that link Na+/K+-
ATPase to ERK1/2. Journal of cardiovascular pharmacology 41 609-614.
Moldovan L, Moldovan NI, Sohn RH, Parikh SA & Goldschmidt-Clermont PJ 2000 Redox
changes of cultured endothelial cells and actin dynamics. Circulation research 86 549-557.
![Page 246: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/246.jpg)
222
Morris AP, Tawil A, Berkova Z, Wible L, Smith CW & Cunningham SA 2006 Junctional
Adhesion Molecules (JAMs) are differentially expressed in fibroblasts and co-localize with ZO-1
to adherens-like junctions. Cell communication & adhesion 13 233-247.
Morrow CM, Mruk D, Cheng CY & Hess RA 2010 Claudin and occludin expression and
function in the seminiferous epithelium. Philosophical transactions of the Royal Society of
London.Series B, Biological sciences 365 1679-1696.
Morrow CM, Tyagi G, Simon L, Carnes K, Murphy KM, Cooke PS, Hofmann MC & Hess
RA 2009 Claudin 5 expression in mouse seminiferous epithelium is dependent upon the
transcription factor ets variant 5 and contributes to blood-testis barrier function. Biology of
reproduction 81 871-879.
Mruk DD &Cheng CY 2004 Sertoli-Sertoli and Sertoli-germ cell interactions and their
significance in germ cell movement in the seminiferous epithelium during spermatogenesis.
Endocrine reviews 25 747-806.
Mruk DD &Cheng CY 2011 Desmosomes in the testis: Moving into an unchartered territory.
Spermatogenesis 1 47-51.
Naz RK 1998 Effect of actinomycin D and cycloheximide on human sperm function. Archives of
Andrology 41 135-142.
Neuer A, Spandorfer SD, Giraldo P, Dieterle S, Rosenwaks Z & Witkin SS 2000 The role of
heat shock proteins in reproduction. Human reproduction update 6 149-159.
Newton LD, Kastelic JP, Wong B, van der Hoorn F & Thundathil J 2009 Elevated testicular
temperature modulates expression patterns of sperm proteins in Holstein bulls. Molecular
reproduction and development 76 109-118.
Newton LD, Krishnakumar S, Menon AG, Kastelic JP, van der Hoorn FA & Thundathil
JC 2010 Na+/K+ATPase regulates sperm capacitation through a mechanism involving kinases
and redistribution of its testis-specific isoform. Molecular reproduction and development 77 136-
148.
Nguyen AN, Wallace DP & Blanco G 2007 Ouabain binds with high affinity to the Na,K-
ATPase in human polycystic kidney cells and induces extracellular signal-regulated kinase
activation and cell proliferation. Journal of the American Society of Nephrology : JASN 18 46-
57.
Ninomiya Y &Ichinose S 2007 Subcellular distribution of mitochondrial ribosomal RNA in the
mouse oocyte and zygote. PloS one 2 e1241.
Nixon B &Aitken RJ 2009 The biological significance of detergent-resistant membranes in
spermatozoa. Journal of reproductive immunology 83 8-13.
![Page 247: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/247.jpg)
223
Noguchi S, Mishina M, Kawamura M & Numa S 1987 Expression of functional (Na+ + K+)-
ATPase from cloned cDNAs. FEBS letters 225 27-32.
O'Flaherty C, de Lamirande E & Gagnon C 2006 Positive role of reactive oxygen species in
mammalian sperm capacitation: triggering and modulation of phosphorylation events. Free
radical biology & medicine 41 528-540.
Oliveira PF, Sousa M, Barros A, Moura T & Rebelo da Costa A 2009 Intracellular pH
regulation in human Sertoli cells: role of membrane transporters. Reproduction (Cambridge,
England) 137 353-359.
Ollero M, Bescos O, Cebrian-Perez JA & Muino-Blanco T 1998 Loss of plasma membrane
proteins of bull spermatozoa through the freezing-thawing process. Theriogenology 49 547-555.
Olson SD, Fauci LJ & Suarez SS 2011 Mathematical modeling of calcium signaling during
sperm hyperactivation. Molecular human reproduction 17 500-510.
Ostermeier GC, Dix DJ, Miller D, Khatri P & Krawetz SA 2002 Spermatozoal RNA profiles
of normal fertile men. Lancet 360 772-777.
Ott M, Amunts A & Brown A 2016 Organization and Regulation of Mitochondrial Protein
Synthesis. Annual Review of Biochemistry 85 77-101.
Parent S, Lefièvre L, Brindle Y & Sullivan R 1999 Bull subfertility is associated with low
levels of a sperm membrane antigen. 52 57-65.
Parrington J, Jones ML, Tunwell R, Devader C, Katan M & Swann K 2002 Phospholipase
C isoforms in mammalian spermatozoa: potential components of the sperm factor that causes
Ca2+ release in eggs. Reproduction (Cambridge, England) 123 31-39.
Parrish JJ, Susko-Parrish JL, Uguz C & First NL 1994 Differences in the role of cyclic
adenosine 3',5'-monophosphate during capacitation of bovine sperm by heparin or oviduct fluid.
Biology of reproduction 51 1099-1108.
Patel HH &Insel PA 2009 Lipid rafts and caveolae and their role in compartmentation of redox
signaling. Antioxidants & redox signaling 11 1357-1372.
Peddinti D, Nanduri B, Kaya A, Feugang JM, Burgess SC & Memili E 2008 Comprehensive
proteomic analysis of bovine spermatozoa of varying fertility rates and identification of
biomarkers associated with fertility. BMC systems biology 2 19-0509-2-19.
Peris S 2008 Semen cryopreservation facilitates sperm DNA damage: Relationship between
sperm DNA stability and fertility in vivo.
![Page 248: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/248.jpg)
224
Piepenhagen PA &Nelson WJ 1993 Defining E-cadherin-associated protein complexes in
epithelial cells: plakoglobin, beta- and gamma-catenin are distinct components. Journal of cell
science 104 ( Pt 3) 751-762.
Pierre SV &Xie Z 2006 The Na,K-ATPase receptor complex: its organization and membership.
Cell biochemistry and biophysics 46 303-316.
Plourde D &Soltoff SP 2006 Ouabain potentiates the activation of ERK1/2 by carbachol in
parotid gland epithelial cells; inhibition of ERK1/2 reduces Na(+)-K(+)-ATPase activity.
American journal of physiology.Cell physiology 290 C702-10.
Plum A, Hallas G, Magin T, Dombrowski F, Hagendorff A, Schumacher B, Wolpert C,
Kim J, Lamers WH, Evert M, Meda P, Traub O & Willecke K 2000 Unique and shared
functions of different connexins in mice. Current biology : CB 10 1083-1091.
Plummer JM &Watson PF 1985 Ultrastructural localization of calcium ions in ram
spermatozoa before and after cold shock as demonstrated by a pyroantimonate technique.
Journal of reproduction and fertility 75 255-263.
Ponce A, Larre I, Castillo A, Garcia-Villegas R, Romero A, Flores-Maldonado C,
Martinez-Rendon J, Contreras RG & Cereijido M 2014 Ouabain increases gap junctional
communication in epithelial cells. Cellular physiology and biochemistry : international journal
of experimental cellular physiology, biochemistry, and pharmacology 34 2081-2090.
Premkumar E &Bhargava PM 1972 Transcription and translation in bovine spermatozoa.
Nature: New biology 240 139-143.
Purdy PH 2008 Ubiquitination and its influence in boar sperm physiology and cryopreservation.
Theriogenology 70 818-826.
Quintas LE, Pierre SV, Liu L, Bai Y, Liu X & Xie ZJ 2010 Alterations of Na+/K+-ATPase
function in caveolin-1 knockout cardiac fibroblasts. Journal of Molecular and Cellular
Cardiology 49 525-531.
Rajasekaran AK &Rajasekaran SA 2003 Role of Na-K-ATPase in the assembly of tight
junctions. American journal of physiology.Renal physiology 285 F388-96.
Rajasekaran SA, Barwe SP, Gopal J, Ryazantsev S, Schneeberger EE & Rajasekaran AK
2007 Na-K-ATPase regulates tight junction permeability through occludin phosphorylation in
pancreatic epithelial cells. American journal of physiology.Gastrointestinal and liver physiology
292 G124-33.
Rajasekaran SA, Palmer LG, Moon SY, Peralta Soler A, Apodaca GL, Harper JF, Zheng
Y & Rajasekaran AK 2001 Na,K-ATPase activity is required for formation of tight junctions,
![Page 249: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/249.jpg)
225
desmosomes, and induction of polarity in epithelial cells. Molecular biology of the cell 12 3717-
3732.
Rato L, Socorro S, Cavaco JE & Oliveira PF 2010 Tubular fluid secretion in the seminiferous
epithelium: ion transporters and aquaporins in Sertoli cells. The Journal of membrane biology
236 215-224.
Reed GF, Lynn F & Meade BD 2002 Use of coefficient of variation in assessing variability of
quantitative assays. Clinical and diagnostic laboratory immunology 9 1235-1239.
Riordan M, Sreedharan R, Kashgarian M & Siegel NJ 2006 Modulation of renal cell injury
by heat shock proteins: lessons learned from the immature kidney. Nature clinical
practice.Nephrology 2 149-156.
Rivier C, Cajander S, Vaughan J, Hsueh AJ & Vale W 1988 Age-dependent changes in
physiological action, content, and immunostaining of inhibin in male rats. Endocrinology 123
120-126.
Rivlin J, Mendel J, Rubinstein S, Etkovitz N & Breitbart H 2004 Role of hydrogen peroxide
in sperm capacitation and acrosome reaction. Biology of reproduction 70 518-522.
Robinson K, Jones D, Patel Y, Martin H, Madrazo J, Martin S, Howell S, Elmore M,
Finnen MJ & Aitken A 1994 Mechanism of inhibition of protein kinase C by 14-3-3 isoforms.
14-3-3 isoforms do not have phospholipase A2 activity. The Biochemical journal 299 ( Pt 3)
853-861.
Rufas O, Fisch B, Ziv S & Shalgi R 2000 Expression of cadherin adhesion molecules on human
gametes. Molecular human reproduction 6 163-169.
Runft LL, Jaffe LA & Mehlmann LM 2002 Egg activation at fertilization: where it all begins.
Developmental biology 245 237-254.
Russell L 1977 Movement of spermatocytes from the basal to the adluminal compartment of the
rat testis. The American Journal of Anatomy 148 313-328.
Saitou M, Furuse M, Sasaki H, Schulzke JD, Fromm M, Takano H, Noda T & Tsukita S
2000 Complex phenotype of mice lacking occludin, a component of tight junction strands.
Molecular biology of the cell 11 4131-4142.
Salameh A, Krautblatter S, Karl S, Blanke K, Gomez DR, Dhein S, Pfeiffer D & Janousek
J 2009 The signal transduction cascade regulating the expression of the gap junction protein
connexin43 by beta-adrenoceptors. British journal of pharmacology 158 198-208.
![Page 250: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/250.jpg)
226
Salicioni AM, Platt MD, Wertheimer EV, Arcelay E, Allaire A, Sosnik J & Visconti PE
2007 Signalling pathways involved in sperm capacitation. Society of Reproduction and Fertility
supplement 65 245-259.
Sanchez G, Nguyen AN, Timmerberg B, Tash JS & Blanco G 2006 The Na,K-ATPase alpha4
isoform from humans has distinct enzymatic properties and is important for sperm motility.
Molecular human reproduction 12 565-576.
Sanocka D &Kurpisz M 2004 Reactive oxygen species and sperm cells. Reproductive biology
and endocrinology : RB&E 2 12.
Sasson R, Dantes A, Tajima K & Amsterdam A 2003 Novel genes modulated by FSH in
normal and immortalized FSH-responsive cells: new insights into the mechanism of FSH action.
FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 17 1256-1266.
Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, Swann K & Lai
FA 2002 PLC zeta: a sperm-specific trigger of Ca(2+) oscillations in eggs and embryo
development. Development (Cambridge, England) 129 3533-3544.
Schiefelbein D 1998 Back to the basics: A real world strategy for improving the quality and
consistency of beef: 30th Beef Improvement Federation Research Symposium and Annual
Meeting. Calgary, AB, Canada. 74.
Schneeberger EE &Lynch RD 2004 The tight junction: a multifunctional complex. American
journal of physiology.Cell physiology 286 C1213-28.
Schwartz A, Grupp G, Wallick E, Grupp IL & Ball WJ,Jr 1988 Role of the Na+K+-ATPase
in the cardiotonic action of cardiac glycosides. Progress in clinical and biological research 268B
321-338.
Scobey M, Bertera S, Somers J, Watkins S, Zeleznik A & Walker W 2001 Delivery of a
cyclic adenosine 3',5'-monophosphate response element-binding protein (creb) mutant to
seminiferous tubules results in impaired spermatogenesis. Endocrinology 142 948-954.
Sendler E, Johnson GD, Mao S, Goodrich RJ, Diamond MP, Hauser R & Krawetz SA 2013
Stability, delivery and functions of human sperm RNAs at fertilization. Nucleic acids research
41 4104-4117.
Senger PL 2012 Pathways to pregnancy and parturition. 2nd edn. (Current Conceptions:
Pullman, WA)
Shadan S, James PS, Howes EA & Jones R 2004 Cholesterol efflux alters lipid raft stability
and distribution during capacitation of boar spermatozoa. Biology of reproduction 71 253-265.
![Page 251: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/251.jpg)
227
Shahar S, Hillman P, Lubart R, Ickowicz D & Breitbart H 2014 Activation of sperm EGFR
by light irradiation is mediated by reactive oxygen species. Photochemistry and photobiology 90
1077-1083.
Sharma RK &Agarwal A 1996 Role of reactive oxygen species in male infertility. Urology 48
835-850.
Sharpe RM, McKinnell C, Kivlin C & Fisher JS 2003 Proliferation and functional maturation
of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction
(Cambridge, England) 125 769-784.
Shojaei H, Kroetsch T, Wilde R, Blondin P, Kastelic JP & Thundathil JC 2012 Moribund
sperm in frozen-thawed semen, and sperm motion end points post-thaw and post-swim-up, are
related to fertility in Holstein AI bulls. Theriogenology 77 940-951.
Signorelli J, Diaz ES & Morales P 2012 Kinases, phosphatases and proteases during sperm
capacitation. Cell and tissue research 349 765-782.
Silver LM 1985 Mouse t haplotypes. Annual Review of Genetics 19 179-208.
Simoes R, Feitosa WB, Siqueira AF, Nichi M, Paula-Lopes FF, Marques MG, Peres MA,
Barnabe VH, Visintin JA & Assumpcao ME 2013 Influence of bovine sperm DNA
fragmentation and oxidative stress on early embryo in vitro development outcome. Reproduction
(Cambridge, England) 146 433-441.
Simons K &Ikonen E 1997 Functional rafts in cell membranes. Nature 387 569-572.
Simons K &Toomre D 2000 Lipid rafts and signal transduction. Nature reviews.Molecular cell
biology 1 31-39.
Skrahina T, Piljic A & Schultz C 2008 Heterogeneity and timing of translocation and
membrane-mediated assembly of different annexins. Experimental cell research 314 1039-1047.
Sleight SB, Miranda PV, Plaskett NW, Maier B, Lysiak J, Scrable H, Herr JC & Visconti
PE 2005 Isolation and proteomic analysis of mouse sperm detergent-resistant membrane
fractions: evidence for dissociation of lipid rafts during capacitation. Biology of reproduction 73
721-729.
Spokas EG &Spur BW 2001 Rapid measurement of low levels of sodium, potassium-ATPase
activity by ascorbic acid reduction without strong acid. Analytical Biochemistry 299 112-116.
Sridharan S, Simon L, Meling DD, Cyr DG, Gutstein DE, Fishman GI, Guillou F & Cooke
PS 2007 Proliferation of adult sertoli cells following conditional knockout of the Gap junctional
protein GJA1 (connexin 43) in mice. Biology of reproduction 76 804-812.
![Page 252: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/252.jpg)
228
Stricker SA 1999 Comparative biology of calcium signaling during fertilization and egg
activation in animals. Developmental biology 211 157-176.
Sutovsky P, Aarabi M, Miranda-Vizuete A & Oko R 2015 Negative biomarker based male
fertility evaluation: Sperm phenotypes associated with molecular-level anomalies. Asian Journal
of Andrology 17 554-560.
Sutovsky P, Neuber E & Schatten G 2002 Ubiquitin-dependent sperm quality control
mechanism recognizes spermatozoa with DNA defects as revealed by dual ubiquitin-TUNEL
assay. Molecular reproduction and development 61 406-413.
Sutovsky P, Terada Y & Schatten G 2001 Ubiquitin-based sperm assay for the diagnosis of
male factor infertility. Human reproduction (Oxford, England) 16 250-258.
Sutovsky P, Turner RM, Hameed S & Sutovsky M 2003 Differential ubiquitination of stallion
sperm proteins: possible implications for infertility and reproductive seasonality. Biology of
reproduction 68 688-698.
Suzuki K &Sorimachi H 1998 A novel aspect of calpain activation. FEBS letters 433 1-4.
Takezawa Y, Yoshida K, Miyado K, Sato M, Nakamura A, Kawano N, Sakakibara K,
Kondo T, Harada Y, Ohnami N, Kanai S, Miyado M, Saito H, Takahashi Y, Akutsu H &
Umezawa A 2011 Beta-Catenin is a Molecular Switch that Regulates Transition of Cell-Cell
Adhesion to Fusion. Scientific reports 1 68.
Tardif S, Dube C & Bailey JL 2003 Porcine sperm capacitation and tyrosine kinase activity are
dependent on bicarbonate and calcium but protein tyrosine phosphorylation is only associated
with calcium. Biology of reproduction 68 207-213.
Tarulli GA, Stanton PG & Meachem SJ 2012 Is the adult Sertoli cell terminally
differentiated? Biology of reproduction 87 13, 1-11.
Thaler CD, Thomas M & Ramalie JR 2006 Reorganization of mouse sperm lipid rafts by
capacitation. Molecular reproduction and development 73 1541-1549.
Thundathil J, de Lamirande E & Gagnon C 2003 Nitric oxide regulates the phosphorylation
of the threonine-glutamine-tyrosine motif in proteins of human spermatozoa during capacitation.
Biology of reproduction 68 1291-1298.
Thundathil JC, Anzar M & Buhr MM 2006 Na+/K+ATPase as a signaling molecule during
bovine sperm capacitation. Biology of reproduction 75 308-317.
Thundathil JC, Rajamanickam GD, Kastelic JP & Newton LD 2012 The effects of increased
testicular temperature on testis-specific isoform of Na+/K+ -ATPase in sperm and its role in
![Page 253: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/253.jpg)
229
spermatogenesis and sperm function. Reproduction in domestic animals = Zuchthygiene 47
Suppl 4 170-177.
Tian J, Cai T, Yuan Z, Wang H, Liu L, Haas M, Maksimova E, Huang XY & Xie ZJ 2006
Binding of Src to Na+/K+-ATPase forms a functional signaling complex. Molecular biology of
the cell 17 317-326.
Tian Q, Stepaniants SB, Mao M, Weng L, Feetham MC, Doyle MJ, Yi EC, Dai H,
Thorsson V, Eng J, Goodlett D, Berger JP, Gunter B, Linseley PS, Stoughton RB,
Aebersold R, Collins SJ, Hanlon WA & Hood LE 2004 Integrated genomic and proteomic
analyses of gene expression in Mammalian cells. Molecular & cellular proteomics : MCP 3 960-
969.
Toshimori K 2009 Dynamics of the sperm head: Modification and maturation events from
spermatogenesis to egg activation.
Travis AJ, Jorgez CJ, Merdiushev T, Jones BH, Dess DM, Diaz-Cueto L, Storey BT, Kopf
GS & Moss SB 2001 Functional relationships between capacitation-dependent cell signaling and
compartmentalized metabolic pathways in murine spermatozoa. The Journal of biological
chemistry 276 7630-7636.
Ullrich A &Schlessinger J 1990 Signal transduction by receptors with tyrosine kinase activity.
Cell 61 203-212.
Vainio S, Heino S, Mansson JE, Fredman P, Kuismanen E, Vaarala O & Ikonen E 2002
Dynamic association of human insulin receptor with lipid rafts in cells lacking caveolae. EMBO
reports 3 95-100.
Valcarcel A, de Las Heras MA, Perez L, Moses DF & Baldassarre H 1994 Fluorescent
staining as a method of assessing membrane damage and post-thaw survival of ram spermatozoa.
Theriogenology 41 483-489.
van Gestel RA, Brewis IA, Ashton PR, Brouwers JF & Gadella BM 2007 Multiple proteins
present in purified porcine sperm apical plasma membranes interact with the zona pellucida of
the oocyte. Molecular human reproduction 13 445-454.
van Gestel RA, Brewis IA, Ashton PR, Helms JB, Brouwers JF & Gadella BM 2005
Capacitation-dependent concentration of lipid rafts in the apical ridge head area of porcine sperm
cells. Molecular human reproduction 11 583-590.
Villarroya S &Scholler R 1987 Lateral diffusion of a human sperm-head antigen during
incubation in a capacitation medium and induction of the acrosome reaction in vitro. Journal of
reproduction and fertility 80 545-562.
![Page 254: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/254.jpg)
230
Villegas J, Araya P, Bustos-Obregon E & Burzio LO 2002 Localization of the 16S
mitochondrial rRNA in the nucleus of mammalian spermatogenic cells. Molecular human
reproduction 8 977-983.
Visconti PE 2009 Understanding the molecular basis of sperm capacitation through kinase
design. Proceedings of the National Academy of Sciences of the United States of America 106
667-668.
Visconti PE, Krapf D, de la Vega-Beltran JL, Acevedo JJ & Darszon A 2011 Ion channels,
phosphorylation and mammalian sperm capacitation. Asian Journal of Andrology 13 395-405.
Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P & Kopf GS 1995 Capacitation of
mouse spermatozoa. I. Correlation between the capacitation state and protein tyrosine
phosphorylation. Development (Cambridge, England) 121 1129-1137.
Visconti PE &Kopf GS 1998 Regulation of protein phosphorylation during sperm capacitation.
Biology of reproduction 59 1-6.
Vogel C &Marcotte EM 2012 Insights into the regulation of protein abundance from proteomic
and transcriptomic analyses. Nature reviews.Genetics 13 227-232.
Wagle JR, Heindel JJ, Steinberger A & Sanborn BM 1986 Effect of hypotonic treatment on
Sertoli cell purity and function in culture. In vitro cellular & developmental biology : journal of
the Tissue Culture Association 22 325-331.
Wagoner K, Sanchez G, Nguyen AN, Enders GC & Blanco G 2005 Different expression and
activity of the alpha1 and alpha4 isoforms of the Na,K-ATPase during rat male germ cell
ontogeny. Reproduction (Cambridge, England) 130 627-641.
Walensky LD &Snyder SH 1995 Inositol 1,4,5-trisphosphate receptors selectively localized to
the acrosomes of mammalian sperm. The Journal of cell biology 130 857-869.
Wang H, Haas M, Liang M, Cai T, Tian J, Li S & Xie Z 2004 Ouabain assembles signaling
cascades through the caveolar Na+/K+-ATPase. The Journal of biological chemistry 279 17250-
17259.
Washburn MP, Wolters D & Yates JR,3rd 2001 Large-scale analysis of the yeast proteome by
multidimensional protein identification technology. Nature biotechnology 19 242-247.
Wennemuth G, Babcock DF & Hille B 2003 Calcium clearance mechanisms of mouse sperm.
The Journal of general physiology 122 115-128.
Wong CC, Chung SS, Grima J, Zhu LJ, Mruk D, Lee WM & Cheng CY 2000 Changes in
the expression of junctional and nonjunctional complex component genes when inter-sertoli tight
junctions are formed in vitro. Journal of andrology 21 227-237.
![Page 255: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/255.jpg)
231
Woo AL, James PF & Lingrel JB 1999 Characterization of the fourth alpha isoform of the
Na,K-ATPase. The Journal of membrane biology 169 39-44.
Woo AL, James PF & Lingrel JB 2000 Sperm motility is dependent on a unique isoform of the
Na,K-ATPase. The Journal of biological chemistry 275 20693-20699.
Woo AL, James PF & Lingrel JB 2002 Roles of the Na,K-ATPase alpha4 isoform and the
Na+/H+ exchanger in sperm motility. Molecular reproduction and development 62 348-356.
Wood MW, Nordone SK, Vaden SL & Breitschwerdt EB 2011 Assessment of urine solute
and matrix effects on the performance of an enzyme-linked immunosorbent assay for
measurement of interleukin-6 in dog urine. Journal of veterinary diagnostic investigation :
official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 23
316-320.
Wu AT, Sutovsky P, Xu W, van der Spoel AC, Platt FM & Oko R 2007 The postacrosomal
assembly of sperm head protein, PAWP, is independent of acrosome formation and dependent on
microtubular manchette transport. Developmental biology 312 471-483.
Xie Z 2003 Molecular mechanisms of Na/K-ATPase-mediated signal transduction. Annals of the
New York Academy of Sciences 986 497-503.
Xie Z &Bikle DD 2007 The recruitment of phosphatidylinositol 3-kinase to the E-cadherin-
catenin complex at the plasma membrane is required for calcium-induced phospholipase C-
gamma1 activation and human keratinocyte differentiation. The Journal of biological chemistry
282 8695-8703.
Xie Z, Kometiani P, Liu J, Li J, Shapiro JI & Askari A 1999 Intracellular reactive oxygen
species mediate the linkage of Na+/K+-ATPase to hypertrophy and its marker genes in cardiac
myocytes. The Journal of biological chemistry 274 19323-19328.
Xu Z, Kopf GS & Schultz RM 1994 Involvement of inositol 1,4,5-trisphosphate-mediated
Ca2+ release in early and late events of mouse egg activation. Development (Cambridge,
England) 120 1851-1859.
Yagi A &Paranko J 1995 Actin, alpha-actinin, and spectrin with specific associations with the
postacrosomal and acrosomal domains of bovine spermatozoa. The Anatomical Record 241 77-
87.
Yamada S, Pokutta S, Drees F, Weis WI & Nelson WJ 2005 Deconstructing the cadherin-
catenin-actin complex. Cell 123 889-901.
Yanagimachi R 1994 Mammlian Fertilization. In The Physiology of Reproduction, pp 189-317.
Eds E Knobil and J Neill, New York: Raven Press.
![Page 256: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/256.jpg)
232
Yu C, Xie Z, Askari A & Modyanov NN 1997 Enzymatic properties of human Na,K-ATPase
alpha1beta3 isozyme. Archives of Biochemistry and Biophysics 345 143-149.
Yuan Z, Cai T, Tian J, Ivanov AV, Giovannucci DR & Xie Z 2005 Na/K-ATPase tethers
phospholipase C and IP3 receptor into a calcium-regulatory complex. Molecular biology of the
cell 16 4034-4045.
Zhang X, Ling MT, Wang Q, Lau CK, Leung SC, Lee TK, Cheung AL, Wong YC & Wang
X 2007 Identification of a novel inhibitor of differentiation-1 (ID-1) binding partner, caveolin-1,
and its role in epithelial-mesenchymal transition and resistance to apoptosis in prostate cancer
cells. The Journal of biological chemistry 282 33284-33294.
Zhao Y &Buhr M 1996 Localisation of various ATPases in fresh and cryopreserved bovine
spermatozoa. 44 139-148.
Zini A &Sigman M 2009 Are tests of sperm DNA damage clinically useful? Pros and cons.
Journal of andrology 30 219-229.
![Page 257: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/257.jpg)
233
Appendix: Copyright permissions
Co-author release letter
I, ____________________, consent to the inclusion of the following manuscripts that I have co-
authored in the PhD thesis of Gayathri Devi Rajamanickam for publication with Library and
Archives Canada, including the agreements included in the Thesis Non-Exclusive Licence that
authorizes Library and Archives Canada to reproduce, communicate to the public on the
internet, load, distribute or sell copies of the thesis, among other things.
Gayathri D Rajamanickam, John P Kastelic, Jacob C Thundathil. Testis-specific isoform of
Na/K-ATPase (ATP1A4) regulates bovine sperm capacitation through raft and non-raft mediated
signaling
Gayathri D Rajamanickam, John P Kastelic, Jacob C Thundathil. Characterization of the testis-
specific isoform of Na/K-ATPase (ATP1A4) interactome in raft and non-raft membrane
fractions from capacitated bovine sperm
Gayathri D Rajamanickam, John P Kastelic, Jacob C Thundathil. Content of testis-specific
isoform of Na/K-ATPase (ATP1A4) is increased during bovine sperm capacitation through
translation in mitochondrial ribosomes. Submitted to Cell and Tissue Research
Gayathri D Rajamanickam, John P Kastelic, Jacob C Thundathil. Testis-specific isoform of
Na/K-ATPase (ATP1A4) regulates sperm function and fertility in dairy bulls through
mechanisms involving reactive oxygen species, intracellular calcium and actin polymerization
Gayathri D Rajamanickam, John P Kastelic, Jacob C Thundathil. The ubiquitous isoform of
Na/K-ATPase (ATP1A1) regulates junctional proteins, connexin 43 and claudin 11 via Src-
EGFR-ERK1/2-CREB pathway in prepubertal rat Sertoli cells. Submitted to Biology of
Reproduction
![Page 258: The Sodium Pump Regulates Sperm and Sertoli Cell Function](https://reader031.fdocuments.us/reader031/viewer/2022011913/61d79fef8d73fc1794325339/html5/thumbnails/258.jpg)
234
Name
Signature
Date