The SloR/Dlg Metalloregulator Modulates …dzumenvis.nic.in/Microbes and Metals...

JOURNAL OF BACTERIOLOGY, July 2006, p. 5033–5044 Vol. 188, No. 140021-9193/06/$08.00�0 doi:10.1128/JB.00155-06Copyright © 2006, American Society for Microbiology. All Rights Reserved.

The SloR/Dlg Metalloregulator Modulates Streptococcus mutansVirulence Gene Expression

Elizabeth Rolerson, Adam Swick, Lindsay Newlon, Cameron Palmer, Yong Pan,Britton Keeshan, and Grace Spatafora*

Department of Biology, Middlebury College, 276 Bicentennial Way, MBH354, Middlebury, Vermont 05753

Received 27 January 2006/Accepted 17 April 2006

Metal ion availability in the human oral cavity plays a putative role in Streptococcus mutans virulence geneexpression and in appropriate formation of the plaque biofilm. In this report, we present evidence thatsupports such a role for the DtxR-like SloR metalloregulator (called Dlg in our previous publications) in thisoral pathogen. Specifically, the results of gel mobility shift assays revealed the sloABC, sloR, comDE, ropA, sod,and spaP promoters as targets of SloR binding. We confirmed differential expression of these genes in aGMS584 SloR-deficient mutant versus the UA159 wild-type progenitor by real-time semiquantitative reversetranscriptase PCR experiments. The results of additional expression studies support a role for SloR in S.mutans control of glucosyltransferases, glucan binding proteins, and genes relevant to antibiotic resistance.Phenotypic analysis of GMS584 revealed that it forms aberrant biofilms on an abiotic surface, is compromisedfor genetic competence, and demonstrates heightened incorporation of iron and manganese as well as resis-tance to oxidative stress compared to the wild type. Taken together, these findings support a role for SloR inS. mutans adherence, biofilm formation, genetic competence, metal ion homeostasis, oxidative stress tolerance,and antibiotic gene regulation, all of which contribute to S. mutans-induced disease.

Streptococcus mutans, the principal causative agent of dentalcaries, is a successful oral pathogen owing to its ability toadhere to host tissues, form biofilms, and adapt to conditionsof oxidative stress and low pH. Adherence of S. mutans to thetooth surface facilitates the colonization of other oral patho-gens and hence the formation of a mixed-species biofilmknown as dental plaque. In the plaque environment, S. mutansgenerates lactic acid as a by-product of sugar metabolism,resulting in a localized drop in pH at the tooth surface and thedemineralization of tooth enamel. In addition to direct damageto the dentition, S. mutans can also cause endocarditis, a life-threatening valvular inflammation of the heart (8). The presentstudy centers on the investigation of a putative role for theSloR metalloregulator in Streptococcus mutans virulence geneexpression.

Metal ions such as iron and manganese are essential micro-nutrients, and their incorporation has been implicated in thepathogenesis of many bacteria, including Legionella pneumo-phila, Mycobacterium tuberculosis, Staphylococcus epidermidis,and Streptococcus gordonii (2, 9, 16, 24, 30, 33, 34, 35). Specif-ically, iron is an important enzyme cofactor in the respiratorypathways of many aerobic and anaerobic microorganisms (26).However, the accumulation of iron in bacteria can lead to theproduction of toxic oxygen radicals via Fenton chemistry. Thus,while sufficient levels of iron are necessary to promote bacte-rial survival and growth, its intracellular transport must betightly controlled.

Iron availability is also restricted in the mammalian host,where it is sequestered to host proteins such as transferrin and

lactoferrin (42, 46). Such an iron-withholding system protectsthe host from the harmful effects of reactive oxygen specieswhile restricting the availability of this essential micronutrientto invading pathogens. In response, microorganisms have evolvedspecialized mechanisms for robbing iron from host proteins, someof which depend on small iron chelating molecules called sid-erophores. In previous work, we and others confirmed a sid-erophore-independent mechanism for iron transport in S. mutans(12, 38).

Manganese is another essential micronutrient of particularimportance to the oral streptococci (39). In fact, high concen-trations of manganese have been strongly correlated with in-creased prevalence of dental caries (1, 5). This is not surprisinggiven that sucrose-dependent adherence and glucan binding bythe mutans group streptococci both require manganese (4, 25).Unlike iron, however, manganese does not promote Fentonchemistry but rather plays a crucial role in bacterial defenseagainst oxidative stress (2, 49). This is so, in part, becausemanganese serves as a cofactor for superoxide dismutase,which facilitates the conversion of damaging oxygen radicalsinto harmless by-products.

Metalloregulatory proteins have been implicated in viru-lence gene control for a variety of gram-positive pathogens,including Mycobacterium tuberculosis (IdeR), Staphylococcusepidermidis (SirR), and Corynebacterium diphtheriae (DtxR) (3,16, 27). These bacterial metalloregulators repress the tran-scription of downstream genes upon binding to palindromicconsensus sequences when free iron or manganese is available.However, in the human host, where metal ions are limiting,these consensus sequences remain unoccupied, and the tran-scription of genes, some of which may contribute to virulence,is derepressed. A report in the literature describes inactivationof the IdeR metalloregulator in M. tuberculosis which attenu-ates virulence in vivo (27), and others describe targets of the

* Corresponding author. Mailing address: Department of Biology,Middlebury College, 276 Bicentennial Way, MBH354, Middlebury,Vermont 05753. Phone: (802) 443-5431. Fax: (802) 443-2072. E-mail:[email protected].

5033

DtxR transcriptional regulator in Corynebacterium diphtheriae,which include the disease-causing diphtheria toxin (tox) gene(21, 37, 40).

Numerous SloR homologs have also been identified forstreptococci, including the recently reported MtsR metal-loregulator in Streptococcus pyogenes, which has been impli-cated in iron homeostasis and oxidative stress tolerance (3).Other SloR homologs that likely contribute to virulence in-clude the ScaR and AdcR metalloregulators in S. gordonii,which modulate transcription of the scaCBA and adcCBAoperons, respectively. Both of these operons encode manga-nese transport systems that are required for genetic compe-tence and biofilm formation (17, 24).

Previously, we described the cariogenic potential of an S.mutans UA130 sloR-deficient mutant (GMS800), as attenuatedin a germ-free rat model, thereby implicating SloR as a metal-loregulator in S. mutans-induced disease (38). In addition,work conducted in our laboratory and by others revealed thatthe expression of sloC, an LraI lipoprotein adhesin and metalion transporter, contributes to S. mutans-induced disease andis subject to repression by SloR when free iron or manganeseis plentiful. In contrast, sloC expression is derepressed whenthe availability of these metal ions becomes limiting (18, 38).Taken together, these findings implicate metal ions in theregulation of S. mutans virulence gene expression.

In the present study, we hypothesize a role for the S. mutansSloR metalloregulator similar to that of its DtxR homolog inC. diphtheriae and propose that either iron or manganese canassociate with the metalloregulator to modulate virulence geneexpression. This suggests the presence of a SloR regulon in thisoral pathogen that promotes the expression of virulence genesin a host organism where metal ions are limiting. Herein, wedescribe the characterization of the S. mutans UA159 sloR-deficient mutant (GMS584) and identify multiple virulenceattributes that are targeted by the SloR metalloregulator. SloRmodulation of S. mutans virulence gene expression in responseto metal ion availability is likely a significant contributor tocaries formation, and its study could reveal novel candidatesfor therapeutic intervention.

MATERIALS AND METHODS

Bacterial strains, plasmids, and primers. Bacterial strains and plasmids usedin the present study are described in Table 1. Oligonucleotide primers designedusing MacVector 7.0 software and purchased from Sigma Genosys (St. Louis,Mo.) are presented in Table 2.

Bacteriological media and reagents. Escherichia coli DH5� and TB1 cells weregrown at 37°C in L broth with gentle aeration. E. coli transformants were alsogrown in this manner, with the addition of 100 �g/ml ampicillin or 100 �g/mlspectinomycin to the medium. S. mutans cultures for RNA isolation, biofilmformation, and Western blot analysis were grown at 37°C and 5% CO2 in asemidefined medium (SDM) that contained 0.38 �M Fe and 1.75 �M Mn, asdetermined by inductively coupled argon plasma analysis. For metal ion incor-poration assays, S. mutans was grown in Todd-Hewitt broth (THB) at 37°C and5% CO2. For all other assays, S. mutans was grown at 37°C and 5% CO2 in THBsupplemented with 0.3% yeast extract (THYE). Spectinomycin (1,200 �g/ml) orerythromycin (10 �g/ml) was added to THYE to select for transformants. Allbuffers and reagents for purification of the SloR and maltose binding proteins(MBP) were prepared according to the pMal protein and purification systeminstruction manual and in accordance with the recommendations of the supplier(New England BioLabs, Beverly, MA).

Cloning of the S. mutans sloR gene. A 1,063-bp amplicon that harbors thewild-type sloR coding sequence and promoter region, amplified with primersdlg.LR.BamHI.F and dlg.LR.BamHI.R (Table 2), was cloned into the BamHI

site of the replicative shuttle plasmid pDL277. The resulting recombinant wasintroduced into E. coli DH5� by electroporation (36), and transformants wereselected on L agar supplemented with spectinomycin. Plasmid DNA was isolatedfrom selected transformants on minispin columns according to the recommen-dations of the supplier (QIAGEN) and subsequently mapped with restrictionenzymes to confirm the presence of the pER4 recombinant construct.

Construction of S. mutans GMS584, a sloR-deficient mutant. An establishedPCR ligation mutagenesis approach (20) was used to inactivate the sloR gene onthe S. mutans chromosome. Primers dlg.LR.P1, dlg.LR.P2, dlg.LR.P3, and dlg.LR.P4 (Table 2) were used to amplify the 5� and 3� regions of the sloR codingsequence from the S. mutans UA159 chromosome by use of a thermal cycler(Hybaid, Ltd., Ashford, United Kingdom) for 94°C for 10 min, 35 cycles at 94°Cfor 1 min, optimal annealing temperature (Table 2) for 2 min, 72°C for 2 min,and 72°C for 10 min. The resulting 5� and 3� sloR amplicons were digested withAscI and FseI and ligated to an ermAM amplicon with compatible AscI and FseIoverhangs. The ligation mixture was then used as a template for PCR amplifi-cation with primers dlg.LR.P1 and dlg.LR.P4. The resulting amplification prod-ucts, including a 1,784-bp sloR:ermAM:sloR linear construct (Fig. 1a), were usedto transform S. mutans UA159 in the presence of 150 �g competence-stimulatingpeptide (CSP) (22). Transformants were selected on THYE agar plates supple-mented with erythromycin. Chromosomal DNA was isolated from selected trans-formants according to established protocols (36), and PCR and nucleotide se-quencing with primers dlg.LR.P1 and dlg.LR.P4 were used to confirm sloRdisruption by allelic exchange (Fig. 1b and c). The resulting sloR mutant wasnamed GMS584.

Complementation of the sloR mutation in S. mutans GMS584. Plasmid pER4was used to complement the sloR mutation in S. mutans GMS584 in trans. Theplasmid was introduced into S. mutans by CSP-induced transformation as de-scribed previously (22), and transformants resistant to spectinomycin were se-lected on THYE agar plates. Complementation of the sloR-specific mutation inthe resulting strain, GMS585, was confirmed with real-time PCR experiments bymonitoring sloR- and sloC-specific expression.

Isolation and purification of the S. mutans SloR protein. The sloR gene andflanking DNA sequences were PCR amplified from the S. mutans UA159 chro-mosome with sloR-specific primers Dlg_c Forward and Dlg_c Reverse (Table 2)and in the presence of Platinum Taq DNA high-fidelity polymerase (Invitrogen).The cycling conditions consisted of a 94°C denaturation step for 2 min, followedby 35 cycles at 94°C for 30 s, 50°C for 2 min, and 68°C for 1 min, followed by a10-min extension period at 68°C. The resulting 756-bp amplicon was PCR puri-fied (QIAGEN), digested with the restriction enzyme XbaI, and ligated into theXbaI and XmnI cloning sites on the pMal-c2x vector (New England BioLabs)with T4 DNA ligase (Promega) at 16°C overnight. The ligation mixture was then

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Genotype or phenotype Source or reference

StrainsStreptococcus mutans

UA159 Wild type, serotype c ATCC 700610GMS584 UA159 derived, sloR

deficient, EmrThis work

GMS585 GMS584 transformedwith plasmid pER4

This work

citM deficient UA159 derived, Emr University of Toronto

Escherichia coliDH5� F� supE44 �lacU169

�80dlacZ�M15hsdR17 recA1 endA1gyrA96 thi-1 relA

15

TB1 F� ara�(lac-proAB)�80dlacZ�M15 rps(Strr) thi hsdR

New England BioLabs

PlasmidspDL277 E. coli-streptococcal

shuttle vector, Spr6

pER4 pDL277 derived, harborssloR gene, Spr

This work

pMal-c2x E. coli expression vectorwith MBP, Apr

New England BioLabs

pMal-c2x:SloR E. coli pMal-c2xcontaining SloR, Apr

This work

5034 ROLERSON ET AL. J. BACTERIOL.

used to electroporate E. coli DH5� (36), and transformants resistant to ampi-cillin were selected on X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyrano-side)- and IPTG (isopropyl-�-D-thiogalactopyranoside)-containing L ampicillinplates. Plasmid DNA was isolated from selected colonies on minispin columns(QIAGEN) and used as a template for PCR amplification with vector-specificprimers dlg.intern.LR.F and dlg.intern.LR.F (Table 2) to confirm the presence ofthe sloR insert. Recombinant plasmids that harbored the sloR gene were trans-formed into E. coli TB1 cells for subsequent SloR purification according to thepMal protein fusion and purification system instruction manual (New EnglandBioLabs). The protein purification procedure was repeated with E. coli TB1transformants containing the cloned MBP gene for use in gel mobility shiftassays.

In silico analysis. The PredictRegulon search engine (47) was used to searchthe S. mutans UA159 genome for sequence homology to a 22-bp SloR consensussequence (AAATTAACTTGACTTAATTTTT) (18), as well as to 24-bp (AAAAATTAACTTGACTTAATTTTT) and 38-bp (CTAATATAAAAATTAACTTGACTTAATTTTTATATTAG) versions of the consensus sequence. The searchvariables for upstream and downstream positioning of this sequence were set at300 bp and 20 bp, respectively. Targets identified by PredictRegulon were sub-sequently screened for characteristic stem-loop secondary structure by use ofMfold algorithms, with conditions for folding set at 37°C, 300 mM sodium, and0 mM magnesium (50).

Gel mobility shift assays. Gel mobility shift assays were performed using aprotocol developed by John Murphy at Boston University (31), with some mod-

TABLE 2. List of primers used in this study

Primer use Primer name Nucleotide sequence (5� to 3�)Annealing

temp(°C)c

Ampliconsize (bp)c

PCR ligation mutagenesisa dlg.LR.P1 GGCGCGCCGAAAGGTTTCCGCCTACTCCCAGC 52.3 441dlg.LR.P2 GGCGCGCCGCGATGCTTGCGATAAAGAGAT

GACGdlg.LR.P3 GGCCGGCCCCGCATGGAGGGACCATTCC 53.4 513dlg.LR.P4 GGCCGGCCAGCTGAAACCATTTCGGAAGTCGAGerm.Asc1.F GGCGCGCCCCGGGCCCAAAATTTGTTTGAT 52.3 860erm.Fse1.R ATTCTATGAGTCGCTGCCGACTGGCCGGCC

Real-time PCR dlg.intern.LR.F CATCTCTTTATCGCAAGCATCG 49.1 127dlg.intern.LR.R CGTTCAACAAACACATCAGAAACAGfimA.GS.R CCAGCCTGTCCTTTTTTAGCAAC 52.2 186fimA.GS.F CGAAGAAGAGGGAACACCAAATCropA.realtime.F CGGTCGCTAATGCTGAAATCG 51.2 113ropA.realtime.R CTCTGATGAAATCCCTTGGCGsko6 F GTTTAGGTATGTTGTCAATGAACG 47.4 137sko6 R CAGTTGTCCAAGAGGAATAGAAGsko9 F GTTCTAATGTCTGATACAATCGGCTTGC 50.0 82sko9 R CAGTTAGAGCCTCACCAGCAACAATGcomD F TTATGGTCTGCTGCCTGTTG 51.6 161comD R ACACACTGAGAAAGAGGTAACTTAGCcomE F CACAACAACTTATTGACGCTATCCC 49.8 106comE F TGATTGGCTACTTCCAGTCCTTTCspaP F TTTGCCGATGAAACGACCAC 50.6 106spaP R TACTCGCACTCCCTTGAGCCTCsod F GGCTCAGGTTGGGCTTGGTTAG 53.5 128sod R GCGTGTTCCCAGACATCAAGTGCgbpB F TGGACAATGGGCAGCAAGTG 53.9 124gbpB R TTGAACACCTGTAACATAAGCAACGgtfB F TACACTTTCGGGTGGCTTGG 50.0 135gtfB R GCTTCTTGCTTAGATGTCACTTCG

Cloningb dlg.LR.BamHI.F CGGGATCCCGGGTTTCCGCCTACTCCCAGC 53.5 1,063dlg.LR.BamHI.R CGGGATCCCGGCTGAAACCATTTCGGAAGTCGAGDlg_c Forward ATGACACCTAATAAAGAAGATTACC 51.1 756Dlg_c Reverse TGCGAAAATTTCAAAAAGCA

Gel mobility shift preSloABCFor ATCGGTGAATCGCACTGTCG 51.1 310preSloABCRev TAAGGTTGACTTGCCCGCACpreSloR F AAGGTTTCCGCTTACTCCC 49.8 306preSloR R ACCATTTCTGAGACAGCCGpreRopAFor GGATTTCATAAAACCCTCTTC 44.9 203preRopARev ATGTAACAACACCACGATTGcomD F TGAAAATAGCATAGGTGAGTCAAAG 48.6 268comD R ATTTAGGTTAGCTGATTAACACTATACACrecA.Gel.LN.F CGGTTATCCAAAAGGGCGTATC 55.3 212recA.Gel.LN.R CCTGTTCTCCTGAATCTGGTTGTGpresod-PCR-AS-F CGTGATTCAAGAACACTCA 47.3 315presod-PCR-AS-R CTGGTAAAAGAATAGCCATAspaP.BK.Forward GGCCAGAACATCTAGTCCAACTCAG 50.7 225spaP.BK.Reverse CGAGCACAAACTCCACACTTTATCC

a AscI restriction sites appear in boldface type, whereas FseI restriction sites are underlined.b BamHI cut sites are underlined and appear in boldface type.c Annealing temperatures and amplicon sizes are relevant to the primer pair.

VOL. 188, 2006 SloR/Dlg MODULATES S. MUTANS VIRULENCE GENE EXPRESSION 5035

ifications. The promoter region of genes targeted for SloR binding were PCRamplified with specific primer sets (Table 2) and end labeled in a reactionmixture containing [-32P]ATP (Perkin Elmer) and 10 U of T4 polynucleotidekinase (New England BioLabs). Following incubation at 37°C for 30 min andthen at 70°C for 20 min, the final sample volume was brought to 100 �l withsterile distilled water. Unincorporated radiolabel was removed by passing thereaction mixture through a G-25 Sepharose column (Roche Applied Science,Indianapolis, IN). Binding reactions were performed in a 16-�l total volumecontaining 1 �l of end-labeled DNA, 2.5 �g of either the SloR fusion protein orthe MBP, and 3.2 �l of 5 binding buffer (42 mM NaH2PO4, 58 mM Na2HPO4,250 mM NaCl, 25 mM MgCl2, 50 �g/ml bovine serum albumin, 1 mg sonicatedsalmon sperm DNA, and 99% sterile glycerol). In separate assays, 2.5, 5, 10, or25 �g of the SloR fusion protein was used in binding reactions to determinewhether the SloR fusion protein forms oligomers. In additional gel shift assays,crude cell lysate from S. mutans UA159 and GMS584 was used to confirm adysfunctional SloR protein in the mutant. The 5 binding buffer was supple-mented with MnCl2 to a final concentration of 150 mM for binding reactions.EDTA was added to some of the reaction mixtures at a final concentration of 15mM to determine whether SloR binding was metal ion dependent. A 212-bpamplicon that harbors the S. mutans recA gene was used as a negative control toconfirm SloR binding specificity to its proposed targets. Competition assays, inwhich up to 10-fold excess cold recA DNA was added to reaction mixturescontaining end-labeled target DNA, were also performed. All reaction mixtureswere incubated at room temperature for 20 min and then resolved on 18%nondenaturing polyacrylamide gels for 1 h at 300 V. The gels were processed forautoradiography and exposed to Kodak BIOMAX film for 10 h at �80°C in thepresence of an intensifying screen.

RNA isolation. S. mutans UA159 and GMS584 cultures grown to mid-loga-rithmic phase (optical density at 600 nm [OD600] of �0.5) in SDM were har-vested by centrifugation and stored in RNAlater according to the manufacturer’s

instructions (Ambion). The 10-ml RNAlater suspension was diluted in 15 ml 1phosphate-buffered saline (PBS), harvested at 7,000 rpm for 20 min in a SorvallRC5B centrifuge, and resuspended in 3ml Trizol reagent (Invitrogen). Thesuspension was divided equally into two tubes, each containing a zirconium beadlysing matrix, and mechanically disrupted at 4°C in a BIO101 Fast Prep machinerun for 40 s on setting 6. Nucleic acids were ethanol precipitated overnight andcollected by centrifugation at 12,000 rpm for 20 min in a refrigerated IECMicromax RF microcentrifuge. The supernatant was aspirated away from visiblepellets, and the pellets were resuspended in nuclease-free water. Nucleic acid wasfurther purified and DNase I treated on an RNeasy column (QIAGEN) accord-ing to the recommendations of the supplier. RNA integrity was assessed byethidium bromide staining of the 23S and 16S ribosomal subunits on 1% agarosegels. Total intact RNA was quantified with a Genosys spectrophotometer (FisherBiotech), and an OD260:OD280 ratio was obtained to estimate purity.

Real-time qRT-PCR. Real-time semiquantitative reverse transcriptase PCR(qRT-PCR) was used to monitor the transcription of S. mutans genes whosepromoter regions bind SloR as determined in silico and/or by gel mobility shiftassays. Specifically, a first-strand cDNA synthesis kit (MBI Fermentas, Burling-ton, Ontario, Canada) was used in accordance with the recommendations of thesupplier to reverse transcribe 1 �g of total RNA isolated from S. mutans UA159and GMS584 as described above. Reverse transcriptase negative controls, cor-responding to each of the experimental conditions, were prepared in parallelexcept that the Moloney murine leukemia virus reverse transcriptase was omittedfrom the reaction mixture. Next, 10 ng of cDNA (RNA equivalents) was ampli-fied in a Cepheid Smart Cycler (Sunnyvale, CA) in the presence of SYBR greenI nucleic acid stain (Molecular Probes) and 150 nM primers (Table 2). Cyclingwas programmed at 95°C for 900 s, followed by 40 cycles at 94°C for 15 s, theoptimal annealing temperature for the primer set as determined with MacVector7.0 software (Table 2) for 30 s, and then 72°C for 30 s. To confirm the absenceof chromosomal DNA from our cDNA preparations, we used the reverse trans-

FIG. 1. Construction of an S. mutans sloR-deficient mutant (GMS584) by PCR ligation mutagenesis. (a) We generated a 139-bp deletion in thesloR coding sequence, into which an 860-bp ermAM cassette was ligated. The resulting product was introduced into the UA159 genome by allelicexchange. (b) Amplicons derived by PCR confirm disruption of the sloR coding sequence by ermAM. A 1,063-bp wild-type fragment is increasedby the size of ermAM, minus the 139-bp deletion, to yield a 1,784-bp product in the mutant. (c) Nucleotide sequence across the sloR-ermAM cassettejunction further confirms disruption of the sloR coding sequence.


criptase negative control described above as a template for amplification witheach primer set. All expression was normalized to that of the endogenous hk11control gene, the expression of which we determined does not vary by more than0.2 cycle threshold (CT) units under the experimental test conditions. Melt curveswere analyzed to ensure specificity of primer annealing and lack of primersecondary structure, and relative standard curves were generated to assessprimer pair efficiency and to calculate changes (n-fold). CT values represent thecycle at which the fluorescence levels of experimental reactions crossed thethreshold of background fluorescence, which we defined as 30 fluorescence units.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotanalysis. Sixty micrograms of total protein derived from S. mutans UA159,GMS584, and GMS585 crude cell extracts was resuspended in sample buffercontaining sodium dodecyl sulfate, resolved on a 10% Tris-HCl precast gel(Bio-Rad) at 200 V for 45 min, and subsequently transferred to nitrocellulosemembranes by use of a Hoeffer transfer apparatus. Immunoblotting was per-formed as described by Towbin et al. (41), using a rabbit polyclonal antiserumagainst the SloC protein in S. mutans (provided by Paula Fives-Taylor, Universityof Vermont). A peroxidase-conjugated goat anti-rabbit immunoglobulin G sec-ondary antibody (Sigma) was subsequently applied to the membrane, and react-ing proteins were visualized using enhanced chemiluminescence according to therecommendations of the supplier (Amersham).

Assay for S. mutans biofilm biomass. The biomass of S. mutans UA159 andGMS584 biofilms was assessed by crystal violet release assays as previouslydescribed (23). Overnight cultures grown in THYE supplemented with erythro-mycin were diluted 1:15 in THYE, and 25 �l of mid-logarithmic-phase cells wasused to inoculate 2 ml of SDM contained in a 24-well polystyrene microtiter dish.The microtiter dish was incubated at 37°C and 5% CO2 for 18 h prior to staining.Wells were inoculated in quadruplicate for each experimental condition, andcontrol wells were inoculated with an equivalent amount of sterile distilled water.

Monitoring S. mutans biofilm architecture by scanning electron microscopy.Biofilms were prepared in SDM as described previously (43), with the followingmodifications. S. mutans biofilms were grown on Thermonox coverslips (NalgeNunc International, Rochester, N.Y.) in 24-well polystyrene microtiter platescontaining 2 ml medium supplemented with 20 mM glucose or 10 mM sucrose.Wells were inoculated in duplicate with 25 �l of a UA159 or GMS584 overnightculture, which had been diluted in SDM to an OD600 of 0.4 to 0.6 to standardizethe inoculum to within 0.02 absorbance units. Wells containing uninoculatedSDM served as negative controls. Following incubation at 37°C and 5% CO2 for48 h, the medium was carefully removed by aspiration and biofilms were washedwith 10 mM PBS both before and after fixation with 3.7% formaldehyde in 10mM PBS for 24 h. Biofilm architecture was examined with a JSM-T300 scanningelectron microscope following sputter coating with a gold-palladium mixture.Morphometric analysis involved measuring the diameters of 23 randomly se-lected water channels on electron micrographs of S. mutans UA159 and GMS584biofilms grown in the presence of sucrose.

Growth rate determination. S. mutans UA159 and GMS584 overnight culturesdiluted 20 in fresh THYE and grown to an OD600 of �0.4 to 0.5 were moni-tored for growth with a Bioscreen microbiology reader (Bioscreen C; Lab-systems, Helsinki, Finland). Twenty microliters of mid-logarithmic-phase cellswas inoculated in triplicate into 24-well microtiter plates containing 400 �lTHYE. Wells containing uninoculated THYE were used as controls. By use ofBiolink software (Labsystems), the Bioscreen reader was programmed to mon-itor OD600 at 37°C every 20 min for 24 h, with moderate shaking every 3 min.OD600 measurements were exported to an Excel file (Microsoft 2003), wherethey were averaged and plotted against time to generate growth curves.

Assay for genetic competence. S. mutans UA159 and GMS584 overnight cul-tures grown in THYE with appropriate antibiotic selection were harvested bycentrifugation, washed in prewarmed THYE, and diluted in prewarmed THYEto an OD600 of 0.1. One microgram of plasmid pDL277 was added to the cellsuspensions for transformation in the presence of 150 �g competence-stimulat-ing peptide as previously described (22). Control groups were treated identicallyexcept that sterile distilled water was added to the transformation mixture in-stead of plasmid DNA. Cell suspensions were incubated at 37°C and 5% CO2

with gentle agitation for 3 h and then plated onto THYE agar plates supple-mented with spectinomycin. The plates were incubated at 37°C and 5% CO2 for36 to 48 h, at which time colonies were counted to determine transformationefficiency.

Assay for S. mutans metal ion incorporation during growth. Overnight culturesof UA159 and GMS584 were grown to stationary phase, in the presence of 7.4 104 Bq 55FeCl3 (3 �M) or 54MnCl2 (0.03 �M), and then washed twice in freshTHB supplemented with 2 �M MnSO4. Radioactivity associated with bacterialcell pellets and culture supernatants, combined with successive washes, wasmeasured with a scintillation counter calibrated for 55Fe or 54Mn. The bacterial

incorporation of 55Fe and 54Mn was determined by dividing the radioactivityassociated with the cell pellet (in counts per minute) by the total radioactivityassociated with the bacterial cell pellet plus the culture supernatant/washes (incounts per minute).

Assay for oxidative stress tolerance. S. mutans overnight cultures grown inTHYE with appropriate antibiotic selection were diluted 1:15 in more of thesame fresh medium. Mid-logarithmic-phase cells (OD600 � 0.4 to 0.6) wereharvested by centrifugation and washed in 0.1 M glycine (pH 7.0), from which100-�l aliquots were further diluted 1:10 in 0.1 M glycine and stored on ice. Thecell suspensions were exposed to oxidative stress upon addition of 30% H2O2

(final concentration, 58.8 mM) and mixed by inversion. At 20, 40, 60, and 80 min,100 �l of cells was removed and diluted 1:10 in glycine buffer containing 5 mg/mlcatalase (Sigma-Aldrich). Cells from UA159 and GMS584 suspensions weresubsequently plated on THYE agar and THYE agar supplemented with eryth-romycin, respectively, and grown at 37°C and 5% CO2 for 36 to 48 h. Colonieswere counted and percent survivorship quantified as the number of CFU thatsurvived exposure to H2O2 per number of CFU that were not exposed to thestressor.

RESULTS

Confirmation of the knockout mutation in S. mutans GMS584.PCR analysis with primers dlg.LR.P1 and dlg.LR.P4 (Table 2)was used to confirm disruption of the sloR locus on the S.mutans GMS584 chromosome (Fig. 1). Nucleotide sequenceanalysis of GMS584 chromosomal DNA with dlg.LR.P1, dlg.LR.P2, dlg.LR.P3, and dlg.LR.P4 primers (Table 2) also con-firmed incorporation of the 860-bp erythromycin cassette intothe sloR coding sequence by allelic exchange (Fig. 1). More-over, the expression of sloR in GMS584 was 230-fold less thanin the wild type, as determined by real-time qRT-PCR exper-iments (Table 3), consistent with sloR inactivation in GMS584.In addition, the CT values we noted for the mutant and theno-template control were comparable (29.26 and 29.5, respec-tively), indicating that little if any sloR-specific mRNA ispresent in GMS584.

Complementation of GMS584. We confirmed the sloR-spe-cific mutation in GMS584 by complementation in trans inpER4-containing transformants. The expression of sloR wasrestored to near-wild-type levels in these transformants, asrevealed by real-time qRT-PCR. Specifically, sloR-specific ex-pression in the GMS585 complemented strain was amplified inreal time at nearly the same cycle number as for the wild type(CT � 22.74 and 21.28, respectively), compared to the GMS584mutant strain (CT � 29.26), in which sloR expression is dimin-ished. In addition, sloC-specific expression was restored tonear-wild-type levels in the complemented GMS585 strain,(CT � 23.04 and 22.28 in GMS585 and UA159, respectively),with sloC amplification occurring considerably earlier (CT �16.97) in GMS584, where sloC expression is heightened. Takencollectively, these findings support complementation of theGMS584 sloR-specific mutation in trans.

Identification of candidate genes subject to SloR control insilico. In silico analysis of the S. mutans genome revealedpalindromic SloR consensus sequences in the promoter re-gions of multiple genes, including sloABC, ropA, and spaP.Genes whose levels of expression were differentially expressedin real-time qRT-PCR experiments and which shared se-quence identity with putative metal ion transporters and me-diators of S. mutans virulence were selected for further analysisby gel mobility shift assays.

Gel mobility shift assays. To confirm that disruption of thesloR coding sequence in GMS584 rendered the resulting SloR


protein dysfunctional, we conducted gel mobility shift experi-ments with S. mutans GMS584 and UA159 whole-cell lysates.The results of these studies revealed a shift for the sloABCpromoter region when reacted with the wild-type repertoire ofproteins but no shift when proteins from the mutant werepresent in the reaction mixture (data not shown). In separateassays, the presence of increasing concentrations of the SloRfusion protein increased the magnitude of the band shift, con-sistent with SloR oligomerization (Fig. 2). This supports thework of others, who described the oligomerization of the DtxRmetalloregulator in Corynebacterium diphtheriae (31).

The results of gel shift assays performed with a SloR fusionprotein that we purified from S. mutans UA159 revealed SloRbinding to the promoter regions of the sloABC, sloR, comDE,ropA, sod (superoxide dismutase), and spaP genes, the prod-ucts of which likely contribute to S. mutans virulence (Fig. 3).Binding of the SloR metalloregulator to the sloR-specific pro-moter sequence was also noted, although no palindromic con-sensus sequence was identified in this region. Addition ofEDTA to the gel shift reaction mixtures abrogated the bandshift, and substitution of the SloR:MBP fusion protein withpurified MBP yielded no shift. Binding assays performed withup to 10-fold excess cold noncompeting recA DNA confirmedthe specificity of SloR binding to the test promoter regions(Fig. 3).

Real-time PCR. The results of real-time qRT-PCR experi-ments revealed differential expression levels in GMS584 andUA159 for several genes identified in silico and for other genesidentified as possible targets of SloR control by gel shift assays.For instance, the expression levels of ropA, spaP, comDE, sod,sko6, and sko9 were down-regulated in GMS584 relative towild-type levels (Table 3). Importantly, reverse transcriptasenegative-control reactions confirmed the absence of contami-

nating DNA from the RNA templates. Moreover, analysis ofmelting curves revealed specific primer annealing and lack ofprimer secondary structure, and relative standard curvesshowed acceptable primer pair efficiency.

Western blotting. Immunoblotting of S. mutans UA159,GMS584, and GMS585 whole-cell lysates reacted with a poly-clonal antiserum directed against the S. mutans SloC proteinrevealed derepression of a 34-kDa band in GMS584 relative towild-type levels (Fig. 4). This is consistent with compromisedbinding of an altered SloR protein to the SloR consensussequence located upstream of the sloABC operon on the S.mutans chromosome. Furthermore, these results corroboratesuccessful complementation of the sloR mutation in GMS585transformants.

Characterization of S. mutans biofilms. To define a putativerole for SloR in S. mutans biofilm formation, crystal violetrelease assays and growth determination experiments wereperformed. The results of these studies revealed similar dou-bling times and biofilm biomasses (data not shown) for S.mutans UA159 and GMS584. Despite these similarities, thesestrains demonstrated notably different biofilm architectures onscanning electron micrographs (Fig. 5). For S. mutans biofilmsgrown in the presence of dextrose, GMS584 behaved much likean aggregation mutant, with cells demonstrating considerablymore clumping than wild-type cells. However, morphometricanalysis of GMS584 biofilms grown in the presence of sucroserevealed significantly larger water channels in the mutant (onaverage, 57.7 �m in GMS584 versus 36.6 �m in UA159, inde-pendent-samples t test, P 0.01).

Genetic competence in GMS584. To determine if alteredbiofilm formation in GMS584 has any impact on genetic com-petence, we determined the transformation efficiencies of themutant and wild-type strains upon transformation with 1 �g of

FIG. 2. The results of gel mobility shift assays are consistent witholigomerization of SloR. The 310-bp promoter region of S. mutanssloABC was PCR amplified and end labeled with [-32P]ATP. A gelmobility shift assay was performed with an MBP or a SloR fusionprotein provided in increasing concentrations (2.5, 5, 10, and 20 �g).As shown, increasing concentrations of SloR increase the magnitude ofthe band shift. The addition of EDTA abrogated the band shift and isconsistent with metal ion-dependent SloR binding.

TABLE 3. Impact of SloR inactivation on S. mutans gene expression

Gene(s) Gene product(s)Type of changein expression in

GMS584

Foldchangea

sloR Metal ion-dependenttranscriptional regulator

Decrease 230

sloABC Metal ion transporter,surface adhesion protein

Increase 29

comD Histidine kinase sensorprotein

Decrease 1.6

comE Cognate response regulator Decrease 1.7ropA Trigger factor, surface

protein biogenesis,chaperone protein

Decrease 6.0

sod Superoxide dismutase(oxidative stress defense)

Decrease 2.2

spaP Cell surface antigen, saliva-interacting protein

Decrease 6.0

gbpB Glucan binding protein Decrease 1.5gtfB Glucosyltransferase Decrease 2.6sko6 Hypothetical putative

gramicidin synthetaseenzyme

Decrease 3.4

sko9 Hypothetical putativeintegral membraneprotein

Decrease 2.9

a Expression relative to that in UA159 and normalized to an S. mutans hk11endogenous control.


plasmid pDL277 in the presence of CSP. The results of theseexperiments (n � 9) confirm that genetic competence is com-promised nearly threefold in GMS584 relative to the wild type(data not shown). Consistent with these findings are the resultsof real-time qRT-PCR experiments, which revealed a 1.7-folddecrease in expression for the comE response regulator and itscognate comD histidine kinase in GMS584 compared to levelsfor the wild type.

Metal ion incorporation by GMS584. To determine whethermetal ion transport is compromised in GMS584, we monitoredthe accumulation of 55FeCl3 and 54MnCl2 in S. mutansGMS584 and UA159 cultures grown in THYE (Fig. 6). Wenoted significantly increased 55Fe incorporation in the mutant(5.56% in GMS584 and 1.92% in UA159, independent-sam-ples t test, P � 0.050). 54Mn incorporation in the mutant wasalso increased, although this difference was only trending to-ward significance (35.53% in GMS584 and 20.5% in UA159,independent-samples t test, P � 0.127).

Resistance to oxidative stress in GMS584. To determine thesensitivity of GMS584 to oxidative stress and to discoverwhether SloR might be involved in the S. mutans oxidativestress response, we compared the levels of resistance of theGMS584 and UA159 strains to challenge with sublethal con-centrations of H2O2 [58.8 mM]. Surprisingly, survivorship of

the mutant was nearly threefold greater than that of the wildtype after a 20-min exposure to the hydrogen peroxide stressor(data not shown). This finding is consistent with the results ofpreliminary experiments performed in our laboratory whichused paraquat as the stressor, for which the mutant also dem-onstrated a heightened tolerance to oxidative stress (data notshown).

DISCUSSION

In the present study, we characterized an S. mutans sloR-deficient mutant (GMS584) that was compromised for geneticcompetence relative to the UA159 wild type but that demon-strated increased incorporation of iron and manganese andheightened resistance to oxidative stress. GMS584 also formedaltered biofilms, with pronounced cell aggregation for culturesgrown in the presence of dextrose and enlarged water channelsfor cultures supplemented with sucrose. These phenotypic as-says were performed in rich THB or THYE media, however,which we propose might have an inhibitory effect on bacterialgene expression and cell signaling. Specifically, the results ofreal-time qRT-PCR experiments revealed differences in S. mu-tans gene expression levels that were less pronounced whencells were grown in THYE than when cells were grown in SDM

FIG. 3. Gel shift assays confirm SloR targets in the S. mutans genome. The promoter regions of S. mutans genes targeted for SloR binding werePCR amplified and end labeled with [-32P]ATP. Gel mobility shift assays were performed with a SloR fusion protein or an MBP. A 212-bpamplicon containing the recA promoter region that is devoid of a SloR consensus sequence was used as a negative control. In competition assays(shown here for sloABC), addition of up to 10-fold excess cold recA DNA had no effect on the band shift. Taken collectively, these results indicatethat SloR binds specifically to the sloABC, sloR, comDE, ropA, sod, and spaP promoters and that, upon addition of EDTA to the reaction mixture,binding is metal ion dependent.


(unpublished observations). This is consistent with work con-ducted by Merritt et al., who reported inhibition of the S.mutans luxS gene expression for cells grown in rich mediacontaining glucose and sucrose (29). To address this putativemedium effect, we performed all of our real-time qRT-PCRexperiments, as well as scanning electron microscopy biofilmvisualization, in an SDM that contains iron and manganeseconcentrations commensurate with those we noted in humansaliva (0.1 to 10 �M [unpublished observations]).

The incorporation of 55Fe was increased in S. mutansGMS584 (Fig. 6a), indicating that SloR functions as a repres-sor of S. mutans iron transporters under the wild-type condi-tion. This is consistent with real-time qRT-PCR experimentsthat support derepression of the sloC metal ion transporter inGMS584. We believe 54Mn transport is also subject to repres-sion by SloR, since incorporation of this metal ion in GMS584was consistently greater than that of the wild type across bio-logical replicates. However, considerable variation in 54Mntransport, recorded in counts per minute, across replicate ex-periments gave rise to a data set with high standard error (Fig.6b), which is the reason these data were only trending towardsignificance.

The results of gel mobility shift assays confirmed the metalion-dependent binding of SloR to DNA containing a con-served 32-bp SloR palindrome (CTAATATAAAAATTAACTTGACTTAATTTTTATATTAG) in the sloABC promoter re-

gion, as well as to a 184-bp intervening region that is devoid ofthis sequence and located immediately downstream of sloCand upstream of the sloR gene on the S. mutans chromosome.This finding supports autoregulation of SloR. The absence of aconventional SloR consensus sequence from the sloR promoterregion, however, suggests that SloR may also bind to uniquesequences to regulate downstream genes. Alternatively, theconsensus sequence for SloR binding may be degenerate inthis intergenic region, further confounding the identification ofan AT-rich consensus sequence in an S. mutans genome withless than 40% GC content. Abrogation of the band shifts in thepresence of EDTA supports a SloR-DNA interaction that ismetal ion dependent. Additionally, substitution of the SloR:MBP fusion protein with purified MBP in the gel shift reactionmixture gave rise to no band shift, indicating that the notedprotein-DNA interaction is mediated by the SloR (and not theMBP) portion of the fusion protein. We did not use a pureSloR protein in our gel shift experiments because repeatedattempts to cleave the MBP tag from the fusion construct wereunsuccessful, even when performed under a variety of testconditions. In summary, our findings support dual control ofthe sloR gene from the sloABC promoter as well as from anindependent promoter and suggest an essential role for SloRin S. mutans.

The results of gel mobility shift assays also revealed bindingof the SloR-MBP fusion protein to the promoter regions of theS. mutans sloABC, comDE, ropA, sod, and spaP genes (Fig. 3).SloC is an LraI lipoprotein adhesin that comprises part of anABC-type operon on the S. mutans chromosome (14) andfunctions as a transporter of iron and manganese (10, 19).Previous work conducted in our laboratory revealed sloC de-repression in a UA130 sloR-deficient mutant, called GMS800(38). The results of real-time qRT-PCR performed in thepresent study confirmed derepression of sloC expression in theUA159-derived GMS584 mutant (Table 3), thereby supportingSloR as a repressor of S. mutans sloC expression. Indeed, ourresults are consistent with reports in the literature that de-scribe a repressor role for SloR homologues in metalloregula-tion (16, 40). In contrast to the repressor effect of SloR onsloC, the results of real-time qRT-PCR studies implicate SloRmetalloregulation in maintaining expression of comDE, ropA,sod, spaP, gbpB, gtfB, sko6, and sko9 (Table 3). This is consis-tent with the reported role for the IdeR metalloregulator inMycobacterium tuberculosis, which likewise promotes the ex-pression of some genes, while repressing the expression ofothers (34).

The comC and comDE genes encode a competence-stimu-lating peptide and a histidine kinase sensor protein and itscognate response regulator, respectively, and act in concert toregulate competence in S. mutans (23). Previous studies reportthat S. mutans strains deficient in any component of the comCDEpathway are significantly compromised for genetic competence(22). Moreover, S. mutans strains with defects in comD orcomE were unable to produce bacteriocin, a class of moleculesinvolved in DNA release from neighboring bacteria, andformed thin biofilms with reduced biomass compared to thoseof the wild type. Since the phenotype of GMS584 is consistentwith that of a comCDE mutant, we decided to investigate theregulation of the com genes in this mutant. The results ofqRT-PCR experiments revealed repression of comDE expres-

FIG. 4. Immunoblots with an anti-SloC antibody support disrup-tion of SloR in GMS584. Western blotting of S. mutans UA159,GMS584, and GMS585 protein extracts reveals the presence of a34-kDa SloC protein in all strains, the expression of which is up-regulated considerably in GMS584, consistent with disruption of thesloR gene in this strain. Conversely, down-regulation of SloC in thepER4-transformed GMS585 strain supports reversion of this mutantto the wild type, owing to complementation of the sloR defect in thisstrain in trans. Partial repression of sloC in the wild-type UA159 strainis likely due to the presence of exogenous Mn (1.75 �M), which weconfirmed in SDM by inductively coupled argon plasma analysis.


FIG. 5. Scanning electron micrographs of S. mutans UA159 and GMS584 biofilms formed on polystyrene coverslips. Shown are representativeregions of UA159 and GMS584 biofilms. GMS584 biofilms grown in the presence of dextrose demonstrate pronounced cellular aggregation (whitearrows) relative to wild-type biofilms. Morphometric analysis of GMS584 biofilms grown in the presence of sucrose reveals significantly larger waterchannels (white dotted lines) than those present in UA159 biofilms (mean diameter, 57.7 �m for GMS584 versus 36.6 �m for UA159,independent-samples t test, P 0.01).

5041

sion in GMS584, consistent with the noted decrease in geneticcompetence in the mutant and with maintenance of comDEexpression by SloR in the wild type. However, the biomasses ofGMS584 and UA159 biofilms were similar, indicating thatdecreased comDE expression in GMS584 is not sufficient toimpact accumulation of the biofilm on an abiotic surface.

The ropA gene product is a trigger factor and critical stressresponse element in S. mutans (45). Reports in the literaturedescribe an S. mutans ropA-deficient mutant, TW90, that dem-onstrates altered biofilm architecture on scanning electron mi-crographs and increased sensitivity to acid and oxidative stressin vitro (45). The altered biofilm architecture and down-regu-lation of ropA we observed for GMS584 in this study reinforcethe reported role for ropA in mediating appropriate formationof the S. mutans biofilm. Taken collectively, these findingsimplicate the ropA gene product in S. mutans disease, althoughto our knowledge in vivo studies have not yet been performedto define a specific role for ropA in cariogenesis.

The superoxide dismutase gene (sod) encodes an enzymethat plays a major role in bacterial defense against oxidativestress. The sod gene product promotes the conversion of dam-aging superoxides into harmless by-products. S. mutans har-bors a single manganese-dependent superoxide dismutase, andmutants deficient in this activity grow more slowly under aer-obic conditions than the wild type (32). In the present study, wenoted sod expression that was down-regulated twofold in

GMS584 compared to expression in UA159. However, theresults of hydrogen peroxide challenge assays revealed that themutant has increased tolerance to oxidative stress. It is possiblethat the pronounced aggregation we noted in GMS584 bio-films, while having an as-yet-undetermined effect in vivo, mayserve to protect S. mutans from the deleterious effects of rad-ical oxygen species. Wen and Burne (44) describe a similarphenotype for a luxS knockout mutant that demonstratesheightened resistance to oxidative stress. It is also possible thatother S. mutans oxidative stress genes are up-regulated in themutant and thereby compensate for sod repression. There isprecedent in the literature for this, in light of redundant oxi-dative stress response genes, the expression levels of which canvary widely (11). In summary, these findings underscore thefact that oxidative stress defense is a very high priority for thebacteria.

The spaP gene encodes an antigen I/II polypeptide called P1that is involved in sucrose-independent adherence (7). Mu-tants deficient in spaP are nonadherent in vitro and give rise tosignificantly fewer carious lesions on the molar surfaces ofgerm-free rats (7). In fact, the spaP gene product contributes toS. mutans virulence by facilitating the formation of the plaquebiofilm, which creates a microenvironment suitable for theprogression of carious lesions.

Among the genes we identified as targets of SloR control byreal-time qRT-PCR are gtfB and gbpB, which encode a glu-cosyltransferase and a glucan binding protein, respectively.Glucosyltransferase B synthesizes insoluble glucans from su-crose, which, in turn, associate with glucan binding proteinssuch as gbpB in sucrose-dependent adherence. It has beenshown that gtfB expression is up-regulated in S. mutans cellsgrown as biofilms but not when grown planktonically. More-over, the production of GbpB protein has been positivelycorrelated with the ability of S. mutans to grow in biofilms.Taken collectively, these genes are among the most signifi-cant contributors to S. mutans colonization and subsequentdisease (28, 48).

A hypothetical gene that we call sko6 is as yet uncharacter-ized in S. mutans but shares amino acid identity with gramici-din synthetase enzymes from Bacillus subtilis and Bacillusbrevis. Another hypothetical gene, sko9, encodes a putativeintegral membrane protein containing domains that have beenimplicated in membrane transport. A putative Sko9 homo-logue in Pyrococcus abyssi has been implicated in glucose-dependent multidrug resistance through efflux transport. TheS. mutans sko6 and sko9 genes are located within a 13-genecluster flanked by putative transposons, the organization ofwhich is consistent with a polycistronic operon. At least fiveadditional genes within this cluster also encode proteins puta-tively associated with antibiotic regulation. Further character-ization of the regulation and function of this group of putativeantibiotic regulatory genes is ongoing in our laboratory.

Taken collectively, the SloR metalloregulator functions in S.mutans as a positive regulator of virulence gene expression,including comDE, ropA, sod, spaP, sko6, sko9, gbpB, and gtfBexpression, and a negative regulator of metal ion transporters,such as sloC. Such control is consistent with the principles ofevolution and bacterial virulence, that is, intermediate viru-lence is often the preferred strategy for successful pathogens,since it serves to sustain both host and microbe over time (13).

FIG. 6. 55Fe and 54Mn incorporation is greater in GMS584 than inthe wild-type progenitor. The results of 55Fe and 54Mn incorporationassays are represented as counts per minute associated with the bac-terial cell pellet divided by the total counts per minute associated withthe bacterial cell pellet plus the culture supernatant/washes multipliedby 100. (a) 55Fe incorporation was significantly greater in GMS584than in the UA159 wild-type progenitor (independent-samples t test,P � 0.05). (b) 54Mn incorporation was greater in GMS584 than in thewild type, although this difference only approaches statistical signifi-cance (independent-samples t test, P � 0.127).


Ultimately, such an evolutionary detente can promote bacte-rial persistence within a host, as well as dissemination of apathogen from one host to another. S. mutans is a primeexample of this infection model, given that it persists in thetransient conditions of the human oral cavity over the lifetimeof the host and is transmitted from the dentition of one host toanother almost ubiquitously. To strike a delicate balance withits host, we believe S. mutans depends on metalloregulation tofine-tune the expression of its virulence attributes. Specifically,when metal ions are limiting in the oral cavity (such as betweenmealtimes), the SloR metalloregulator cannot readily bind toDNA, and hence the expression of S. mutans virulence genesthat are otherwise “off” is derepressed. When metal ions be-come plentiful (such as during or shortly after mealtimes),metal ion transport genes that are normally “on” are repressedso as to protect the microbe from metal ion toxicity. The resultis to promote S. mutans-induced cariogenesis as the microbeactively scavenges essential micronutrients and to down-regu-late cariogenesis as transport proteins readily bind metal ionsfor incorporation. Ultimately, intermediate pathogenicity isachieved; the payoff is a dentition that can sustain S. mutans fora lifetime and a pathogen that can successfully promote itstransmission to new hosts.

In summary, the importance of metal ions in modulating aputative S. mutans regulon that contributes to virulence ishighlighted by the increased incorporation of metal ions notedfor the SloR-deficient GMS584 mutant in this study, togetherwith the multiple S. mutans virulence attributes we report assubject to SloR control. We expect microarray studies underway in our laboratory will support the putative relationships weobserved in this study between SloR, metal ion availability, andS. mutans virulence and will identify other targets of SloRcontrol. We acknowledge that the SloR effects reported hereinmay be the result of direct or indirect impact on gene expres-sion. Continued investigations will address probable cross talkbetween and among members of the SloR regulon.

REFERENCES

1. Adkins, B. L., and F. L. Losee. 1970. A study of covariation of dental cariesprevalence and multiple trace element content of water supplies. N. Y. StateDent. J. 36:618–622.

2. Aranha, H., R. C. Strachan, J. E. L. Arceneaux, and B. R. Byers. 1982. Effectof trace metals on growth of Streptococcus mutans in a Teflon chemostat.Infect. Immun. 35:456–460.

3. Bates, C. S., C. Toukoi, M. N. Neely, and Z. Eichenbaum. 2005. Character-ization of MtsR, a new metal regulator in group A streptococcus, involved iniron acquisition and virulence. Infect. Immun. 73:5743–5753.

4. Bauer, P. D., C. Trapp, D. Drake, K. G. Taylor, and R. J. Doyle. 1993.Acquisition of manganous ions by mutans group streptococci. J. Bacteriol.175:819–825.

5. Beighton, D. 1982. The influence of manganese on carbohydrate metabolismand caries induction by Streptococcus mutans strain Ingbritt. Caries Res.16:189–192.

6. Bhagwat, S. P., J. Nary, and R. A. Burne. 2001. Effects of mutating putativetwo-component systems on biofilm formation by Streptococcus mutansUA159. FEMS Microbiol. Lett. 205:225–230.

7. Crowley, P. J., L. J. Brady, S. M. Michalek, and A. S. Bleweis. 1999. Viru-lence of a spaP mutant of Streptococcus mutans in a gnotobiotic rat model.Infect. Immun. 67:1201–1206.

8. Dale, S. E., M. T. Sebulsky, and D. E. Heinrichs. 2004. Involvement ofSirABC in iron-siderophore import in Staphylococcus aureus. J. Bacteriol.186:8356–8362.

9. Dall, L. H., and B. L. Herndon. 1990. Association of cell-adherent glycocalyxand endocarditis production by viridans group streptococci. J. Clin. Micro-biol. 28:1698–1700.

10. Dintilhac, A., and J. P. Claverys. 1997. The adc locus, which affects compe-tence for genetic transformation in Streptococcus pneumoniae, encodes an

ABC transporter with a putative lipoprotein homologous to a family ofstreptococcal adhesions. Res. Microbiol. 148:119–131.

11. Eriksson, S., S. Lucchini, A. Thompson, M. Rhen, and J. C. Hinton. 2003.Unravelling the biology of macrophage infection by gene expression profilingof intracellular Salmonella enterica. Mol. Microbiol. 47:103–118.

12. Evans, S. L., J. E. L. Arceneaux, B. R. Byers, M. E. Martin, and H. Aranha.1986. Ferrous iron transport in Streptococcus mutans. J. Bacteriol. 168:1096–1099.

13. Ewald, P. 1994. Evolution of infectious disease. Oxford University Press,New York, N.Y.

14. Fenno, J. C., A. Shaikh, G. Spatafora, and P. Fives-Taylor. 1995. The fimAlocus of Streptococcus parasanguis encodes an ATP-binding membrane trans-port system. Mol. Microbiol. 15:849–863.

15. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

16. Hill, P. J., A. Cockayne, P. Landers, J. A. Morrisey, C. A. Sims, and P.Williams. 1998. SirR, a novel iron-dependent repressor in Staphylococcusepidermidis. Infect. Immun. 66:4123–4129.

17. Jakubovics, N. S., A. W. Smith, and H. F. Jenkinson. 2000. Expression of thevirulence-related Sca (Mn2�) permease in Streptococcus gordonii is regulatedby a diphtheria toxin metallorepressor-like protein ScaR. Mol. Microbiol.38:140–153.

18. Kitten, T., C. L. Munro, S. M. Michalek, and F. L. Macrina. 2000. Geneticcharacterization of a Streptococcus mutans LraI family operon and role invirulence. Infect. Immun. 68:4441–4451.

19. Kolenbrander, P. E., R. N. Anderson, R. A. Baker, and H. F. Jenkinson.1998. The adhesion-associated sca operon in Streptococcus gordonii encodesan inducible high-affinity ABC transporter for Mn2� uptake. J. Bacteriol.189:290–295.

20. Lau, P. C. Y., C. K. Sung, J. H. Lee, D. A. Morrison, and D. G. Cvitkovitch.2002. PCR ligation mutagenesis in transformable streptococci: applicationand efficiency. J. Microbiol. Methods 49:193–205.

21. Lee, J. H., T. Wang, K. Ault, J. Liu, M. P. Schmitt, and R. K. Holmes. 1997.Identification and characterization of three new promoter/operators that areregulated by the diphtheria toxin repressor (DtxR) and iron. Infect. Immun.65:4273–4280.

22. Li, Y. H., P. C. Y. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2001.Natural genetic transformation of Streptococcus mutans growing in biofilms.J. Bacteriol. 183:897–908.

23. Li, Y. H., P. C. Y. Lau, N. Tang, G. Svensater, R. P. Ellen, and D. G.Cvitkovitch. 2002. Novel two-component regulatory system involved in bio-film formation and acid resistance in Streptococcus mutans. J. Bacteriol.184:6333–6342.

24. Loo, C. Y., K. Mitrakul, I. B. Voss, C. V. Hughes, and N. Ganeshkumar.2003. Involvement of the adc operon and manganese homeostasis in Strep-tococcus gordonii biofilm formation. J. Bacteriol. 185:2887–2900.

25. Lu-Lu, J. S. Singh, M. Y. Galperin, D. Drake, K. G. Taylor, and R. J. Doyle.1992. Chelating agents inhibit activity and prevent expression of streptococ-cal glucan-binding lectins. Infect. Immun. 60:3807–3813.

26. Madigan, M. T., J. M. Martinko, and J. Parker. 2000. Brock biology ofmicroorganisms. Prentice Hall, Upper Saddle River, N.J.

27. Manabe, Y. C., B. J. Saviola, L. Sun, J. R. Murphy, and W. R. Bishai. 1999.Attenuation of virulence in Mycobacterium tuberculosis expressing a consti-tutively active iron repressor. Proc. Natl. Acad. Sci. USA 96:12844–12848.

28. Mattos-Graner, R. O., S. Jin, W. F. King, T. Chen, D. J. Smith, and M. J.Duncan. 2001. Cloning of the Streptococcus mutans gene encoding glucanbinding protein B and analysis of genetic diversity and protein production inclinical isolates. Infect. Immun. 69:6931–6941.

29. Merritt, J., F. Qi, S. D. Goodman, M. H. Anderson, and W. Shi. 2003.Mutation of luxS affects biofilm formation in Streptococcus mutans. Infect.Immun. 71:1972–1979.

30. Miguel, J. C., W. H. Bowen, and S. K. Pearson. 1997. Effects of iron salts insucrose on dental caries and plaque in rats. Arch. Oral Biol. 42:377–383.

31. Murphy, J. 2006. Personal communication.32. Nakayama, K. 1992. Nucleotide sequence of Streptococcus mutans superox-

ide dismutase gene and isolation of insertion mutants. J. Bacteriol. 174:4928–4934.

33. Pope, C. D., W. A. O’Connel, and N. P. Cianciotto. 1996. Legionella pneu-mophila mutants that are defective for iron acquisition and assimilation andintracellular infection. Infect. Immun. 64:629–636.

34. Rodriguez, G. M., M. I. Voskuil, B. Gold, G. K. Schoolnik, and I. Smith.2002. ideR, an essential gene in Mycobacterium tuberculosis: role of ideR iniron-dependent gene expression, iron metabolism, and oxidative stress re-sponse. Infect. Immun. 70:3371–3381.

35. Rosalen, P. L., S. K. Pearson, and W. H. Bowen. 1996. Effects of copper, ironand fluoride cocrystallized with sugar on caries development and acid for-mation in desalivated rats. Arch. Oral Biol. 41:1003–1010.

36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Harbor Laboratory Press, Cold SpringHarbor, N.Y.

37. Schmitt, M. P., and R. K. Holmes. 1994. Cloning, sequence, and footprintanalysis of two promoter/operators from Corynebacterium diphtheriae that


are regulated by the diphtheria toxin repressor (DtxR) and iron. J. Bacteriol.176:1141–1149.

38. Spatafora, G., M. Moore, S. Landgren, E. Stonehouse, and S. Michalek.2001. Expression of Streptococcus mutans fimA is iron-responsive and regu-lated by a DtxR homologue. Microbiology 147:1599–1610.

39. Stamer, J. R., M. N. Albury, and C. S. Pederson. 1964. Substitution ofmanganese for tomato juice in the cultivation of lactic acid bacteria. Appl.Microbiol. 12:165–168.

40. Tao, X., and J. R. Murphy. 1992. Binding of the metalloregulatory proteinDtxR to the diphtheria tox operator requires a divalent heavy metal ion andprotects the palindromic sequence from DNase I digestion. J. Biol. Chem.267:21761–21764.

41. Towbin, H., T. Staehlin, and J. Gordon. 1979. Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets: procedure andsome applications. Proc. Natl. Acad. Sci. USA 76:4350–4354.

42. Weinberg, E. D. 1978. Iron and infection. Microbiol. Rev. 42:45–66.43. Wen, Z. T., and R. A. Burne. 2002. Functional genomics approach to iden-

tifying genes required for biofilm development by Streptococcus mutans.Appl. Environ. Microbiol. 68:1196–1203.

44. Wen, Z. T., and R. A. Burne. 2004. LuxS-mediated signaling in Streptococcus

mutans is involved in regulation of acid and oxidative stress tolerance andbiofilm formation. J. Bacteriol. 186:2682–2691.

45. Wen, Z. T., P. Suntharaligham, D. G. Cvitkovitch, and R. A. Burne. 2005.Trigger factor in Streptococcus mutans is involved in stress tolerance,competence development, and biofilm formation. Infect. Immun. 73:219–225.

46. Wooldridge, K. G., and P. H. Williams. 1993. Iron uptake mechanisms ofpathogenic bacteria. FEMS Microbiol. Rev. 12:325–348.

47. Yellboina, S., J. Seshadri, M. S. Kumar, and A. Ranjan. 2004. PredictRegu-lon: a web server for the prediction of regulatory protein binding sites andoperons in prokaryote genomes. Nucleic Acids Res. 32:W318–W320.

48. Yoshida, A., and H. K. Kuramitsu. 2002. Streptococcus mutans biofilm for-mation: utilization of a gtfB promoter–green fluorescent protein (PgtfB::gfp)construct to monitor development. Microbiology 148:3385–3394.

49. Zhao, Q., and K. Poole. 2002. Differential effects of mutations in tonB1 onintrinsic multidrug resistance and iron acquisition in Pseudomonas aerugi-nosa. J. Bacteriol. 184:2045–2049.

50. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridizationprediction. Nucleic Acids Res. 31:3406–3415.


The SloR/Dlg Metalloregulator Modulates …dzumenvis.nic.in/Microbes and Metals...

Documents

Transcript of The SloR/Dlg Metalloregulator Modulates …dzumenvis.nic.in/Microbes and Metals...