The PAQ4 Data Compressor Matt Mahoney Florida Tech.
-
Upload
christian-small -
Category
Documents
-
view
219 -
download
0
Transcript of The PAQ4 Data Compressor Matt Mahoney Florida Tech.
The PAQ4 Data Compressor
Matt Mahoney
Florida Tech.
Outline
• Data compression background
• The PAQ4 compressor
• Modeling NASA valve data
• History of PAQ4 development
Data Compression Background
• Lossy vs. lossless
• Theoretical limits on lossless compression
• Difficulty of modeling data
• Current compression algorithms
Lossy vs. Lossless
• Lossy compression discards unimportant information– NTSC (color TV), JPEG, MPEG discard
imperceptible image details– MP3 discards inaudible details
• Losslessly compressed data can be restored exactly
Theoretical Limits on Lossless Compression
• Cannot compress random data
• Cannot compress recursively
• Cannot compress every possible message– Every compression algorithm must expand
some messages by at least 1 bit
• Cannot compress x better than log2 1/P(x) bits on average (Shannon, 1949)
Difficulty of Modeling
• In general, the probability distribution P of a source is unknown
• Estimating P is called modeling
• Modeling is hard– Text: as hard as AI– Encrypted data: as hard as cryptanalysis
Text compression is as hard as passing the Turing test for AI
• P(x) = probability of a human dialogue x (known implicitly by humans)
• A machine knowing P(A|Q) = P(QA)/P(Q) would be indistinguishable from human
• Entropy of English ≈ 1 bit per character (Shannon, 1950)– Best compression: 1.2 to 2 bpc (depending on input size)
Computer
Q: Are you human?
A: Yes
Compressing encrypted data is equivalent to breaking the
encryption
• Example: x = 1,000,000 0 bytes encrypted with AES in CBC mode and key “foobar”
• The encrypted data passes all tests for statistical randomness (not compressible)
• C(x) = 65 bytes using English
• Finding C(x) requires guessing the key
Nevertheless, some common data is compressible
Redundancy in English text
• Letter frequency: P(e) > P(q)– so “e” is assigned a shorter code
• Word frequency: P(the) > P(eth)
• Semantic constraints: P(drink tea) > P(drink air)
• Syntactic constraints: P(of the) > P(the of)
Redundancy in images (pic from Calgary corpus)
Adjacent pixels are often the same color, P(000111) > P(011010)
Redundancy in the Calgary corpusDistance back to last match of length 1, 2, 4, or 8
Redundancy in DNA
tcgggtcaataaaattattaaagccgcgttttaacaccaccgggcgtttctgccagtgacgttcaagaaaatcgggccattaagagtgagttggtattccatgttaagcatccacaggctggtatctgcaaccgattataacggatgcttaacgtaatcgtgaagtatgggcatatttattcatctttcggcgcagaatgctggcgaccaaaaatcacctccatccgcgcaccgcccgcatgctctctccggcgacgattttaccctcatattgctcggtgatttcgcgggctacc
P(a)=P(t)=P(c)=P(g)=1/4 (2 bpc) e.coli (1.92 bpc?)
Some data compression methods
• LZ77 (gzip) – Repeated strings replaced with pointers back to previous occurrence
• LZW (compress, gif) – Repeated strings replaced with index into dictionary– LZ decompression is very fast
• PPM (prediction by partial match) – characters are arithmetic encoded based on statistics of longest matching context– Slower, but better compression
LZ77 Example
the cat in the hat
...a...a...a...or?
Sub-optimal compression due to redundancy in LZ77 coding
LZW Example
the cat in the hat
atthein
Sub-optimal compression due to parsing ambiguity
...ab...bc...abc...
aabbbcc ab+c or a+bc?
Predictive Arithmetic Compression (optimal)
Predict next symbol
ArithmeticCoder
input p
ArithmeticDecoder
Predict next symbol
p output
compresseddata
Compressor
Decompressor
Arithmetic Coding
• Maps string x into C(x) [0,1) represented as a high precision binary fraction
• P(y < x) < C(x) < P(y ≤ x)– < is a lexicographical ordering
• There exists a C(x) with at most a log2 1/P(x) + 1 bit representation– Optimal within 1 bit of Shannon limit
• Can be computed incrementally– As characters of x are read, the bounds tighten– As the bounds tighten, the high order bits of C(x) can
be output
Arithmetic coding example• P(a) = 2/3, P(b) = 1/3
– We can output “1” after the first “b”
a
b
aa
ab
ba
bb
aaa = “”
aba = 1
baa = 11
bbb = 11111
0.1
0.01
0.11
0aaa
aab
aba
abb
baababbbabbb
Prediction by Partial Match (PPM) Guess next letter by matching longest context
the cat in the ha?
Longest context match is “a”Next letter in context “a” is “t”
the cat in th?
Longest context match is “th”Next letter in context “th” is “e”
How do you mix old and new evidence?
..abx...abx...abx...aby...ab?
P(x) = ?P(y) = ?
How do you mix evidence from contexts of different lengths?
..abcx...bcy...cy...abc?
P(x) = ?P(y) = ?P(z) = ? (unseen but not impossible)
PAQ4 Overview
• Predictive arithmetic coder
• Predicts 1 bit at a time
• 19 models make independent predictions– Most models favor newer data
• Weighted average of model predictions– Weights adapted by gradient descent
• SSE adjusts final probability (Osnach)
• Mixer and SSE are context sensitive
PAQ4
Model
Model
Model
Model
Mixer SSEArithmetic
Coder
p
p p
Input Data
Compressed Data
context
19 Models
• Fixed (P(1) = ½)• n-gram, n = 1 to 8 bytes• Match model for n > 8• 1-word context (white space boundary)• Sparse 2-byte contexts (skips a byte) (Osnach)• Table models (2 above, or 1 above and left)
• 8 predictions per byte– Context normally begins on a byte boundary
n-gram and sparse contexts
.......x? .....x.x?
......xx? ....x..x?
.....xxx? ....x.x.?
....xxxx? x...x...?
...xxxxx? .....xx.?
..xxxxxx? ....xx..?
.xxxxxxx? ... word? (begins after space)
xxxxxxxx? xxxxxxxxxx? (variable length > 8)
Record (or Table) Model
• Find a byte repeated 4 times with same interval, e.g. ..x..x..x..x
• If interval is at least 3, assume a table
• 2 models:– first and second bytes above
– bytes above and left
...x...
...x...
...?
.......
...x...
..x?
Nonstationary counter model
• Count 0 and 1 bits observed in each context
• Discard from the opposite count:– If more than 2 then discard ½ of the excess
• Favors newer data and highly predictive contexts
Nonstationary counter exampleInput (in some context) n0 n1 p(1)----------------------- -- -- ----0000000000 10 0 0/1000000000001 6 1 1/7000000000011 4 2 2/60000000000111 3 3 3/600000000001111 2 4 4/6000000000011111 2 5 5/70000000000111111 2 6 6/8
Mixer
• p(1) = i win1i / i ni
– wi = weight of i’th model– n0i, n1i = 0 and 1 counts for i’th model– ni = n0i + n1i
• Cost to code a 0 bit = -log p(1)• Weight gradient to reduce cost = ∂cost/∂wi =
n1i/jwjnj – ni/jwjn1j
• Adjust wi by small amount (0.1-0.5%) in direction of negative gradient after coding each bit (to reduce the cost of coding that bit)
Secondary Symbol Estimation (SSE)
• Maps P(x) to P(x)
• Refines final probability by adapting to observed bits
• Piecewise linear approximation
• 32 segments (shorter near 0 or 1)
• Counts n0, n1 at segment intersections (stationary, no discounting opposite count)
• 8-bit counts are halved if over 255
SSE example
0 Input p 1
Output p
0
1 Initial function
Trained function
Mixer and SSE are context sensitive
• 8 mixers selected by 3 high order bits of last whole byte
• 1024 SSE functions selected by current partial byte and 2 high order bits of last whole byte
Experimental Results on Popular Compressors, Calgary Corpus
Compressor Size (bytes) Compression Time, 750 MHz
Original data 3141622
compress 1272772 1.5 sec.
pkzip 2.04e 1032290 1.5
gzip -9 1017624 2
winrar 3.20 754270 7
paq4 672134 166
Results on Top Compressors
Compressor Size Time
ppmn 716297 23 sec.
rk 1.02 707160 44
ppmonstr I 696647 35
paq4 672134 166
epm r9 668115 54
rkc 661602 91
slim 18 659358 153
compressia 1.0b 650398 66
durilca 0.3a 647028 35
Compression for Anomaly Detection
• Anomaly detection: finding unlikely events
• Depends on ability to estimate probability
• So does compression
Prior work
• Compression detects anomalies in NASA TEK valve data– C(normal) = C(abnormal)– C(normal + normal) < C(normal + abnormal)– Verified with gzip, rk, and paq4
NASA Valve Solenoid Traces
• Data set 3 solenoid current (Hall effect sensor)
• 218 normal traces
• 20,000 samples per trace
• Measurements quantized to 208 values
• Data converted to a 4,360,000 byte file with 1 sample per byte
Graph of 218 overlapped traces data (green)
Compression ResultsCompressor Size
Original 4360000
gzip -9 1836587
slim 18 1298189
epm r9 1290581
durilca 0.3a 1287610
rkc 1277363
rk4 –mx 1275324
ppmonstr Ipre 1272559
paq4 1263021
PAQ4 Analysis
• Removing SSE had little effect
• Removing all models except n=1 to 5 had little effect
• Delta coding made compression worse for all compressors
• Model is still too large to code in SCL, but uncompressed data is probably noise which can be modeled statistically
Future Work
• Compress with noise filtered out
• Verify anomaly detection by temperature, voltage, and plunger impediment (voltage test 1)
• Investigate analog and other models
• Convert models to rules
History of PAQ4Date Compressor Calgary Size
Nov. 1999 P12 (Neural net, FLAIRS paper in 5/2000)
831341
Jan. 2002 PAQ1 (Nonstationary counters)
716704
May 2003 PAQ2 (Serge Osnach adds SSE)
702382
Sept. 2003 PAQ3 (Improved SSE) 696616
Oct. 2003 PAQ3N (Osnach adds sparse models)
684580
Nov. 2003 PAQ4 (Adaptive mixing) 672135
Acknowledgments
• Serge Osnach (author of EPM) for adding SSE and sparse models to PAQ2, PAQ3N
• Yoockin Vadim (YBS), Werner Bergmans, Berto Destasio for benchmarking PAQ4
• Jason Schmidt, Eugene Shelwien (ASH, PPMY) for compiling faster/smaller executables
• Eugene Shelwien, Dmitry Shkarin (DURILCA, PPMONSTR, BMF) for improvements to SSE contexts
• Alexander Ratushnyak (ERI) for finding a bug in an earlier version of PAQ4