THE JOURNAL OF BIOLOGICAL CHEMISTRY Q 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 21, Issue of July 25, pp. 15689-15695,1993 Printed in U. S. A.

Both the Basal and Inducible Transcription of the Tyrosine Hydroxylase Gene Are Dependent upon a cAMP Response Element*

(Received for publication, September 9, 1992, and in revised form, March 22, 1993)

Kwang-Soo Kim, Myung K. Lee, Joanne Carroll, and Tong H. JohS From the Laboratory of Molecular Neurobiology, Cornell University Medical College, Burke Medical Research Institute, White Plains, New York 10605

The cAMP response element (CRE) mediates cAMP responsiveness in many eukaryotic genes (Roesler, W. J., Vandenbark, G. R., and Hansen, R. W. (1988) J. Biol. Chem. 263, 9063-9066). The tyrosine hydrox- ylase gene (TH) contains a single copy of a consensus CRE at -45 to -38 base pair (bp) upstream of the transcription initiation site. Deletional and mutational analyses of the upstream 2400-base pair region of the rat TH gene using transient transfection assay dem- onstrated that the CRE was essential for both CAMP- mediated induction and basal transcription of the TH gene. Another domain between -365 and -151 bp, containing the AP1 site, contributed to transcription to a smaller degree. Thus, the CRE appears to play an important dual role as a basal promoter element and an inducible enhancer for TH transcription. Interac- tions between the DNA binding factors in nuclear ex- tract and CRE-containing oligonucleotides were inves- tigated by gel retardation and competition assays. 01- igonucleotides corresponding to the CRE regions of the TH or somatostatin gene gave rise to a pair of distinct protein-DNA complexes with identical mobilities in the gel retardation assay, suggesting that similar nuclear factor(s) might bind to the CREs of the TH and so- matostatin genes. This study emphasizes a fundamen- tal role of the CRE in transcriptional activation of the TH gene in catecholaminergic cells.

Eukaryotic gene transcription is controlled by interactions between sequence-specific transcription factors (trans-acting elements) and specific DNA sequences (cis-acting elements) that serve as their binding sites (Ptashne, 1988; Mitchell and Tjian, 1989; Struhl, 1991; He and Rosenfeld, 1991). In neu- rons, interactions between transcription factors and cis-acting elements mediate changes in gene expression ultimately ca- pable of regulating important synaptic functions such as long term potentiation (Dash et al., 1990) or neurotransmitter biosynthesis (Black et al., 1987). In catecholaminergic neu- rons, tyrosine hydroxylase (TH)’ mediates the first and rate-

* This work was supported by National Institutes of Health Grants MH 24285 (to T. H. J.) and MH 48866 (to K. S. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduer- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed Dr. Tong H. Joh, Laboratory of Molecular Neurobiology, Cornell University Medical College, Burke Medical Research Institute, 785 Mamaroneck Ave., White Plains, NY 10605. Tel.: 914-948-0050 ext. 2152; Fax: 914-

The abbreviations used are: TH, tyrosine hydroxylase; CRE, cAMP response element; CREB, cAMP response element-binding protein; PKA, CAMP-dependent protein kinase; CAT, chloramphen- icol acetyltransferase; IMX, 3-isobutyryl-l-methylxanthine; kb, kil- obase(s); bp, base pair(s).

948-9541.

limiting step in the biosynthetic pathways for dopamine, norepinephrine, and epinephrine by catalyzing the conversion of L-tyrosine to 3,4-dihydroxy-~-phenylalanine (Nagatsu et al., 1964). A variety of trans-synaptic and hormonal stimuli, acting via different signal transduction pathways, can produce acute (minutes to hours) increases in TH activity or somewhat delayed (one to several days) elevations in levels of TH (Thoenen et al., 1969; Black et al., 1987; Zigmond et al., 1989). The latter changes correlate with elevations in mRNA for TH, indicating that transcriptional regulation of TH gene expression plays an important role in the long term regulation of catecholaminergic transmission.

Among the important regulators of TH, cAMP has been shown to stimulate increases in T H activity by promoting phosphorylation of T H enzyme by CAMP-dependent protein kinase (PKA) (Joh et al., 1978). More recently, cAMP has also been shown to mediate increased transcription of mRNA for T H (Lewis et al., 1987). cAMP induces the transcription of a variety of genes via a consensus octamer, 5‘- TGACGTCA-3’, the cAMP response element (CRE), found in the 5”upstream regions of genes regulated by cAMP (Roes- ler et al., 1988; Goodman, 1990). The protein that binds the CRE of the somatostatin gene has been characterized and cloned (Montminy and Bilezikjian, 1987; Gonzalez et al., 1989). This protein, known as CRE-binding protein (CREB), activates the transcription of responsive genes after it is phosphorylated by PKA (Yamamoto et al., 1988; Gonzalez and Montminy, 1989; Lee et al., 1990). Inspection of the TH gene and functional analysis of fusion gene constructs have identified a putative CRE at -45 to -38 bp upstream of the transcription initiation site (Harrington et al., 1987; Lewis et al., 1987; Fader and Lewis, 1990; Carroll et al., 1991). However, the function of this element in the context of the TH upstream region has been questioned. Indeed, some investigators have suggested that the CRE plays a relatively minor role in TH gene transcription (Cambi et al., 1989; Fung et al., 1992).

The present article presents data characterizing the up- stream promoter region of the rat TH gene using the highly transfectable human neuroblastoma SK-N-BE(2)C cell line (Ross et al., 1981) and the less transfectable rat PC12 cell line (Green and Tischler, 1976). Both cell lines express high levels of T H endogenously. Functional analysis of fusion gene con- structs, containing deletion mutations of the 5”upstream region of TH, localizes the minimal promoter elements to within 60 bp of the transcription initiation site (CAP), a region which includes the CRE. Deletion of the 5”region to -39, which removes 6 bp of the CRE, results in a dramatic loss of transcriptional activity. Furthermore, site-directed mu- tational analyses indicate that the TH CRE, in the proximal region of the TH upstream sequence (-45 to -38), is not only responsible for CAMP-mediated gene induction but is essen- tial for the basal transcription of the T H gene in these catecholaminergic cell lines. In vitro binding studies detect

15689

15690 CAMP Response Element in the Tyrosine Hydroxylase Gene Transcription

two nuclear protein-DNA complexes of similar size using the CREs of the TH gene and somatostatin gene. In addition, the interaction of nuclear factors is analyzed further by competi- tion assay using wild type and mutant oligonucleotides.

EXPERIMENTAL PROCEDURES

Cell Culture-Human neuroblastoma SK-N-BE(2)C cells were pas- saged in Dulbecco’s modified Eagle’s medium supplemented with 10% newborn calf serum. PC12 cells were grown in RPMI 1640 medium supplemented with 10% horse serum and 5% fetal calf serum. Each serum was used after heat inactivation. All culture media contained 100 units/ml penicillin and 100 pg/ml streptomycin.

Construction of Reporter Plasmids-TH(-503/+27)CAT plasmid was constructed in the pOCAT vector (Carroll et aL, 1991). This construct contains 503 bp of the 5“flanking sequence of the rat TH gene, the transcription initiation site, and the first 27 bases of untranslated sequence of the TH transcript. To facilitate further constructions, the plasmid backbone was replaced with that of pBLCAT3 (Luckow and Schutz, 1987) by ligating the 4.0-kb BamHI- EcoRI fragment of pBLCAT3 with the 800-bp BamHI-EcoRI frag- ment of TH(-503/+27)CAT plasmid. Then, BglII-BamHI genomic fragment ranging from -2400 to -503 was inserted into the BamHI site of TH503CAT, resulting in TH2400CAT. A series of deletion constructs were made utilizing the unique PstI site in the pBLCAT3 and appropriate restriction sites in the upstream region of the T H gene. The junctions between TH upstream region and CAT gene of the fusion constructs were confirmed by sequencing analysis. To introduce mutations into the TH CRE, oligonucleotide-derived site- directed mutagenesis was performed. An M13 mp19 subclone con- taining the 700-nucleotide BamHI-EcoRI fragment of TH2400CAT plasmid was used as a template. Two 23-mer oligonucleotides of the sequence 5’ AGGCCAGGCTGAAAGCCCCTCTG 3’ and 5’ GCCAGGCTGACCTCAAAGCCCCT 3’ were utilized as described to produce deletion and point substitution mutations (Nakamaye and Ekstein, 1986). The presence of mutations was confirmed by sequence analysis. The same 700-bp BamHI-EcoRI fragments containing mu- tations were used to reconstitute the final mutant reporter plasmids. For this step, the additional EcoRI site present in the 3”polylinker site of TH2400CAT and TH503CAT plasmids was removed by partial digest and fill-in reaction. This step did not affect the expression of CAT.

Transfection and CAT Assay-Transfection of reporter plasmids into SK-N-BE(2)C and PC12 was performed by the calcium phos- phate co-precipitation method (Gorman et al., 1983). In all experi- ments, pRSV8gal plasmid containing the @-galactosidase gene linked to the RSV promoter/enhancer (Edlund et al., 1985) was included as an internal control for the different transfection efficiencies between experiments. When cells reached approximately 50% confluency, each 6-cm Falcon tissue culture dish received 4 pg of TH2400CAT plasmid and 1 pg of pRSVPgal plasmid. For shorter reporter plasmids, the amount of DNA was adjusted to the same molar ratio, and the total amount was maintained at 5 pg by supplementing with PUC19 DNA. Cells were exposed to the precipitate for 16 h and media was replaced with Dulbecco’s modified Eagle’s medium, 10% newborn calf serum. After a further 24-h incubation, cells were harvested by scraping with a rubber policeman in phosphate-buffered saline. Forskolin and 3- isobutyryl-1-methylxanthine (IMX) were added directly into media 16 h prior to harvest. Extracts were prepared by resuspending cells in 200 pl of 0.25 M Tris-HC1 (pH 8.0), exposure to three freeze-thaw cycles, and then heating at 60 “C for 10 min to inactivate endogenous acetylase. All plasmid DNA was separated on CsCl gradients by ultracentrifugation twice and further purified by phenolchloroform extraction twice and by EtOH precipitation twice in the presence of 2.5 M ammonium acetate. CAT activity was measured using 0.5 pCi of [14C]chloramphenicol, n-butyryl coenzyme A (200 p ~ ) , and 10-20 p1 of cell extracts at 37 “C for 30 min. Expression of pRSVPgal did not vary with forskolin treatment and was used to correct for any variations in transfection efficiency. Cell extracts corresponding to the same 8-galactosidase activity were used in the CAT assay. In most experiments, the variation of 8-galactosidase activity was within the range of 20%. Butyrylated reaction products were separated on TLC plates, exposed overnight at -7O’C with intensifying screen, and visualized by autoradiography.

Gel Retardation Assay-Nuclear extracts were made from SK-N- BE(2)C and PC12 cells based on described procedure (Dignam et al., 1983). The pellet was resuspended in Dignam’s Buffer D and quick-

to 50% saturation with (NH4),S04. In PC12 cells, this step made the frozen in liquid N1. In certain cases, the prepared extract was brought

formation of complex I1 more apparent. Sense and antisense strands of oligonucleotide (Fig. 4A) were annealed and labeled using T4 polynucleotide kinase and [w32p]ATP. Alternatively, oligonucleotides were labeled by fill-in reaction using Klenow and [y-3$]dCTP. Nu- clear protein-DNA binding was carried out at room temperature for 20 min. Nuclear extract (1-4 pg of protein) was incubated with 20,000-40,000 cpm of labeled probe (0.04-0.1 ng) and 1 pg of poly(d1-dC) .poly(dI-dC) in binding buffer (10 mM Tris (pH 7.5), 100 mM NaCl, 1 mM dithiotbreitol, 1 mM EDTA, 4% glycerol). The complexes were resolved on nondenaturing 6% polyacrylamide gels. Gels were prewarmed by electrophoresis for 1 h at 10 V cm” prior to loading samples. Samples containing bromphenol blue and xylene cyano1 were electrophoresed for 2 h. Gels were dried and visualized by autoradiography.

RESULTS

TO study T H gene regulation, rat T H genomic clones con- taining 5”flanking sequences were isolated (Carroll et al., 1991). Potential cis-acting motifs such as AP1, AP2, POU/ OCT, SP1, and CRE are located in the 5’-proximal region of the rat (Harrington et al., 1987; Carroll et al., 1991) and the human genes (Kobayashi et al., 1988) (Fig. L4). Both the nucleotide sequences of these motifs (under boxes) and their relative distance (numbers above boxes) from the CAP site are highly conserved in both species. The 5‘-proximal se- quence contains a single copy of the palindromic consensus CRE (5’-TGACGTCA-3’); located only 7 and 8 base pairs upstream of the TATA box in the human and rat genes, respectively (Fig. lA). To localize important cis-acting ele- ments, a series of plasmids were constructed containing dif- ferent lengths of the rat TH upstream region fused to the bacterial CAT gene as a reporter gene (Fig. 1B). SK-N- BE(2)C cell line expresses levels of TH message similar to those of human adrenal medulla, as assessed by Northern blot analysis (Carroll et al., 1991). The Capo4 co-precipitation method reproducibly provided a high transfection efficiency in the SK-N-BE(2)C cell line as quantitated by the /3-galac- tosidase histochemistry (>20%; data not shown). Although PC12 cells were transfected with a much lower efficiency (1- 2%) than SK-N-BE(B)C, this was still significantly higher

B

-uno -366 -161 - 1 0 4059 +1 +27

”+’ - M24WCAT

-I51

- 1 0 M lDBCAT

-60 - M 6oCAT - M 39CAT

-39

FIG. 1. Rat TH-CAT fusion genes and determination of transcription initiation site in the fusion gene construct. A, schematic diagram of putative cis-acting elements residing in the upstream region of the rat and human TH genes. Nucleotide se- quences and the relative position of the proximal nucleotide in each motif in relation to the transcription initiation are shown below and above each box, respectively. B, CAT fusion constructs containing different length of TH 5”upstream region. Restriction enzymes which were used for deletion construction are indicated above. Arrow rep- resents the transcription initiation site.

CAMP Response Element in the Tyrosine Hydroxylase Gene Transcription 15691

than the transfection efficiency reported previously (0.1%) in PC12 cells (Gandelman et al., 1990). Primer extension analy- sis using poly(A+) RNA prepared from SK-N-BE(2)C cells transfected with TH2400CAT fusion construct verified that the CAT activity measured in our transient transfection assay resulted from proper transcription initiation (data not shown; Fig. L4).

Deletional Analysis of 5"Flanking Sequence Reveals Two Potentially Important Regions for TH Gene Transcription- The expression of different fusion constructs was compared using the transient transfection method in SK-N-BE(2)C cells. Deletions from the -2400-bp region to the -773-, -503-, or to -365-bp region did not influence CAT activity (data not shown). Thus, upstream sequences ranging from -2400 to -365 bp exerted no significant influence on basal transcrip- tion as measured by this transient transfection assay. When the upstream sequence was trimmed down further to -151 bp, a 30-40% drop in CAT activity was observed, suggesting the presence of a positive regulatory element or elements in the region spanning -365 to -151 bp. As depicted in Fig. l.4, several putative cis-acting elements such as AP2, AP1, and POU/OCT are located here. Further deletion to -108 or to -60 bp had little effect on residual transcriptional activity. Thus, the TH60 CAT construct, containing only 60 bp of proximal sequence, retained approximately 60% of the activ- ity observed with the 2400-base pair construct, localizing the minimal upstream promoter to within -60 bp of the CAP site. Further deletion of 21 bp to -39 bp, however, abolished all remaining transcriptional activity, indicating that impor- tant basal promoter element(s) reside between -60 and -39 bP.

The response of these fusion constructs to forskolin treat- ment was tested in the presence of the phosphodiesterase inhibitor, IMX. In the SK-N-BE(2)C cell line, all fusion constructs except TH39CAT demonstrated approximately 3- fold stimulation of CAT activity, localizing cAMP responsive- ness to the proximal 60 bp (Fig. 2). TH39 CAT and the promoterless plasmid, pBLCAT3 (Luckow and Schutz, 1987), showed negligible basal expression and minimally responded to forskolin treatment. These data strongly indicate that the CRE, located a t -45 to -38 bp, is necessary and sufficient for forskolin induction.

It is possible that differences across species could influence the expression of the rat upstream region in the human cell line. To address this issue, the promoter analysis was repli- cated using rat PC12 cells as the host. Overall, a very similar profile of CAT activities was observed using the same series of deletional constructs in PC12 cell line. Again, removal of the -365 to -151 upstream regions decreased expression by 30-4096, TH6OCAT expressed approximately 60% of TH2400CAT activity, and further deletion to -39 bp de- creased the CAT activity to the level of pBLCAT3 (data not shown). Also, forskolin treatment stimulated the transcrip- tional activity of all fusion constructs, with an exception of TH39CAT, by 3-4-fold (data not shown).

The TH CRE Is an Essential Promoter Element of TH Gene Transcription-The TH39CAT fusion construct is transcrip- tionally silent and unresponsive to cAMP induction. In the -60 to -39-bp region, there is no identifiable cis-acting motif besides the CRE. The fact that the TH39CAT lacks 6 out of 8 bases of the CRE motif led to the hypothesis that the CRE may not only be a CAMP-response element but also a core promoter element for T H gene transcription. To test this possibility, we constructed deletion as well as base substitu- tion mutants in the CRE and compared them with wild type constructs using transient transfection assays (Fig. 3). Strik- ingly, deletion of 5 internal bases of the TH CRE (GACGT out of TGACGTCA) abolished all transcriptional activity

Conversion% 0.4 0.7 14.8 46.1 16.1 43.2 12.2 33.6 11.3 26.7 4.4 20.7 0.4 0.5

FIG. 2. Comparison of transcriptional activities of TH-CAT reporter plasmids by the transient transfection analyses in SK-N-BE(2)C cell line. Reporter plasmids tested are indicated above each lane. Euen-numbered lanes (numbers are shown below the histogram) represent the transfection experiments where cells are treated with 10 PM forskolin in the presence of 0.5 mM phosphodies- terase inhibitor, IMX. An autoradiogram of a representative TLC is presented in the upperpanel. The conversion of chloramphenicol into the acetylated forms (the upper two spots) was determined by cutting the spots and scintillation counting and shown below the upperpanel. Each bar of histogram of the lower panel represents the average of triplicate samples from a single transfection experiment. The exper- iment has been repeated eight times with identical results utilizing plasmid DNAs that were independently prepared at least two times. The -fold induction by forskolin treatment is indicated above black bars.

from the rat 2400 and 503-bp upstream regions both in SK- N-BE(2)C (Fig. 3 B ) and PC12 cell line (data not shown). Furthermore, these mutant constructs were not responsive to forskolin treatment. Thus, the T H CRE appears essential both for basal transcription and induction in response to elevated CAMP. The effect of a single base change within the CRE was tested while maintaining the spatial and contextual surroundings of the TH upstream region. Based on the pre- vious observation that two guanosines on the sense strand (-42 and -39 bp) and a third guanosine on the opposite strand (-43 bp) of T H CRE motif are protected from meth- ylation by dimethyl sulfate through the interaction with the CRE-binding protein (ATF) (Lin and Green, 1988), we mu- tagenized one of these residues. TH2400(42C + G)CAT, which has a single base substitution mutation a t -42 position in the context of the whole 2400 bp upstream, displayed a dramatic loss of transcriptional activity when assayed by transient transfection in SK-N-BE(2)C cell line (Fig. 3B). First, the basal transcription was profoundly decreased (>80%). Second, induction by forskolin treatment was sub- stantially reduced when compared with wild type constructs (from 3.0 x down to 1.6 x). In PC12, TH2400(42C + G)CAT appeared to be as inactive as pBLCAT3 (data not shown).

Binding of Nuclear Proteins to the Wild Type and Mutant CRE in the TH Gene-The interaction between the DNA binding factors in crude nuclear proteins and CRE-containing oligonucleotides was investigated by gel retardation assay. Oligonucleotides (23-mer) corresponding to the CRE of the rat T H ( W T oligo) and rat somatostatin genes (SOM oligo) were synthesized (Fig. 4A). These oligonucleotides do not

15692 CAMP Response Element in the Tyrosine Hydroxylase Gene Transcription

A

TH 2400 CAT 5 ' ... GCTTTGACGTCAGCCTGGCC TTTAAAGA... 3'

TH 2400 (,A,CRE) CAT 5 I . . .GCTTT CACCCTGGCCTTTAAAGA.. .3 '

TH 2400 (42C-G) CAT 5 ' . . .GC"GAGGTCAGCCTGGCCmAAAGA.. .3'

TH 503 CAT S'.,.GCTTTGACGTCAGCCTGGCCTTTAAAGA...3'

TH 503 (.\CRE) CAT 5 ' . . . G C l T T CAGCCTGGCCTTTAAAGA...3'

-,5 - 3 8 .29 -24

Conversion(%) 0.4 0.6 14.6 44.8 0 4 0.8 2.8 4.4 156 46.0 0 4 0.7

1 : . 3 ' . t ? " P 1; ii

FIG. 3. Site-directed mutational analysis of TH CRE in the context of 2400- and 503-bp TH upstream sequences. A, nu- cleotide sequence of mutants of the region surrounding the CRE and TATA box. TH CRE and TATA sequences are shaded. R, effect of CRE mutations on the CAT transcriptional activity in SK-N-RE(2)C cell line. Each mutant construct was confirmed by sequencing analysis and restricting mapping and independently prepared three times. Transient transfection assays were performed six times in triplicate with identical results. The data are presented in the same manner as in Fig. 2.

share any apparent homologies except an identical octamer CRE motif. TH CRE oligonucleotides containing deletions ( D E L oligo) as well as point mutations were also made (Fig. 4A). Both the wild type oligonucleotide and the somatostatin oligonucleotide formed two distinct protein-DNA complexes ( I and I I ) with identical mobility in the gel shift assay (Fig. 4 B ) , suggesting that the same protein factor(s) may bind to the CRE in each gene. The same pattern of complex formation was observed when the probe was labeled by kinase or by fill- in reactions, indicating that these two complexes were not related to single strand DNA binding activities. Deletion of 5 out of 8 bases in the TH CRE motif substantially reduced the affinity to nuclear proteins. Intriguingly, the same complexes re-emerged when excess amounts of crude nuclear proteins were used (Fig. 4 R ) . The relative affinity of wild type and mutant oligonucleotides was assessed by incubating with mo- lar excess of unlabeled DNA in a parallel competition exper- iment using crude nuclear extracts isolated from PC12 cells (Fig. 4 C ) and SK-N-BE(2)C cells (Fig. 4 0 ) . In both experi- ments, it appears that approximately 25-fold excess of unla- beled deletion oligonucleotides over wild type oligonucleotides is required to displace the same amount of nuclear proteins- wild type oligonucleotide complex, indicating that approxi- mately 95% of the relative binding affinity is lost by the deletion mutation (Bokar et al., 1988). Thus, the in vitro binding assay of the deletion mutant is consistent with the in vivo transfection analysis (Figs. 3 and 4). When the point mutation oligonucleotide ( M 4 2 ) was employed as a competi-

I -

l l -

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4

"" ---

FIG. 4. Gel mobility shift assays. A, sequence of oligonucleo- tides used to detect specific interactions between CRE-containing DNAs and nuclear proteins from SK-N-BE(2)c and PC12 cells. Sequences of CRE motif are indicated in bold. SOM o/igo S and A represent the sense and antisense nucleotide sequences (-56 to -34) from the rat somatostatin gene (38), respectively. All other nucleo- tides represent the rat TH CRE region in wild type, deletion mutation, or point mutation. H, gel mobility shift assay showing the formation of complex I and 11. Oligonucleotides shown above each lane were labeled using T4 nucleotide kinase and [-y-"$]ATP. 1.2 pg (odd- numbered lanes) or 3.6 pg (even-numbered lanes) of nuclear proteins from PC12 cells are employed in binding reactions. Unbound probe (F) and two distinct DNA-protein complexes ( I and II) are indicated. C, competition comparison between wild t-ype and mutant oligonucle- otides using nuclear proteins from PC12 cells. 4 pg of nuclear proteins was incubated with y-:"P-labeled wild type oligonucleotide in the presence of the indicated molar excess of unlabeled wild type oligo- nucleotide, deletion oligonucleotide, M42 oligonucleotide, or 1-kb ladder DNA (Life Technologies, Inc.). Lane 1, no nuclear extracts; lane 2, no competitor DNA. 11, competition comparison between wild type oligonucleotide and deletion oligonucleotide using nuclear pro- tein from SK-N-RE(2)C. Gel was run for a longer period of time to facilitate the separation of complexes I and 11.

cAMP Response Element in the Tyrosine Hydroxylase Gene Transcription 15693

tor, 2-3-fold excess was required, which represents a moderate decrease (50-70%) in the binding affinity (Fig. 4C; data not shown).

DISCUSSION

Using transient transfection assay, several investigators have suggested that the upstream region of the rat TH gene can drive transcription in a cell type-specific manner (Har- rington et al., 1987; Cambi et al., 1989; Gandelman et d., 1990). Recently, Kaneda et al. (1991) showed that an 11-kb DNA isolate of the human T H gene containing the 2.5-kb upstream region, the entire exon-intron structure, as well as the 0.5-kb 3“flanking region can direct expression of human TH mRNA in the brains and adrenal glands of transgenic mice in a tissue-specific manner. This result indicates that the 5”upstream sequences involved in tissue specificity may largely reside within -2500 bp of the CAP site. In fact, detailed functional analyses of the 5”flanking region of the TH gene from different laboratories have produced conflicting results, leaving this issue unresolved. Chikaraishi and her colleagues (Cambi et al., 1989; Yoon and Chikaraishi, 1992) proposed that the AP1-surrounding domain was essential for rat TH gene transcription by showing a dramatic decrease of expression (>go%) upon removal or mutation of sequences between -212 and -187 bp. However, other investigators have detected no decrease in basal expression after deletion of this AP1-surrounding region as measured by RNase pro- tection or CAT assay (Gizang-Ginsburg and Ziff, 1990; Fader and Lewis, 1990). In addition, Gandelman et al. (1990) re- ported that the upstream sequence between -749 and -505 bp of the rat TH gene was also important for transcriptional activity in PC12 cells.

We examined expression driven by the 2.4-kb upstream region of the rat TH gene in both the human SK-N-BE(2)C and rat PC12 cell lines. The human neuroblastoma cell line, SK-N-BE(2)C, was reproducibly transfected with extremely high efficiency (>20%) and provided statistically reliable transfection analysis. Primer extension analysis demon- strated that CAT activity in SK-N-BE(2)C human cell line arises from correctly initiated transcription by the rat up- stream sequence (data not shown). When the upstream se- quence was deleted up to -365, no discernable effect on transcriptional activity was observed. Further deletion to -150 bp resulted in a 30-40% decrease in CAT activity in both the human SK-N-BE(2)C and the rat PC12 cells, sug- gesting the presence of positive element(s) between -365 and -150 bp. Our data are thus qualitatively consistent with those of other groups which showed that the AP1 site, located in this region (Fig. lA), is an important cis-acting element in TH gene transcription (Gizang-Ginsberg and Ziff, 1990; Yoon and Chikaraishi, 1992). Quantitatively, however, our results differed from some previously reported results (Cambi et al., 1989).

In our experiments, shorter constructs containing 108- or 60-bp upstream regions still retained 60% transcriptional activity compared with the 2400-bp construct in both the SK- N-BE(2)C and PC12 cells, thus localizing the minimal up- stream promoter of the TH gene to the 60-bp region. Further deletion down to -39 bp abolished all residual activity, indi- cating the presence of critical basal regulatory elements in the region between -60 and -39 bp. Our deletional analysis therefore indicated that the consensus CRE, located between -45 and -38, might be crucial for both basal and inducible transcription of the TH gene. We tested this dual role of the CRE further by performing oligonucleotide-derived site-di- rected mutagenesis of the CRE motif in the context of intact 2400-bp and 503-bp upstream sequences. Deletion of 5 bases

out of the octamer CRE motif rendered the entire 2400-bp upstream sequence as silent as the promoterless plasmid both for basal and inducible transcription. Even a single base substitution (42C + G) within the TH CRE severely reduced basal transcription (>80%) and forskolin induction. Previous investigators have suggested that the TH CRE may function only as a CAMP-inducible element (Lewis et al., 1987; Fader and Lewis, 1990; Huang et al., 1991; Fung et al., 1992). Our data, for the first time, clearly implicate the CRE as an essential basal element for TH gene transcription. All fusion constructs except TH39CAT showed about 3-fold induction by forskolin treatment. Notably, deletion of the AP1 and AP2 sites did not influence the inducibility of the upstream region in response to forskolin treatment. In contrast, Fung et al. (1992) showed that either the AP1 or the CRE would confer cAMP responsiveness when placed in front of the TATA box. One possible explanation for their observation is that the APl motif can function as a CRE-like element under certain circumstances (Comb et al., 1990). Clearly, our results show that in the native context, the CRE suffices for cAMP re- sponsiveness of the TH gene. Thus, our deletional and mu- tational analyses indicate that the TH CRE is crucial for both basal and CAMP-inducible transcription of the TH gene in TH-expressing cells. These data clearly contrast with previous reports by other investigators which suggested that the CRE contributes little to basal transcription of the TH gene (Cambi et al., 1989; Yoon and Chikaraishi, 1992; Fung et al., 1992).

The CRE motif has been found in the upstream regions of many genes, including neuropeptide genes, which are tran- scriptionally inducible by the elevation of intracellular cAMP concentration (Table I). Most CREs are located within the first 170 bp of the upstream region of their respective genes (the tyrosine aminotransferase gene being an exception), sug- gesting that the CRE may also function as a basal transcrip- tion element. Indeed, the dual role of the CRE as a basal and inducible transcription element has been suggested in several genes (Short et al., 1986; Andrisani et al., 1987; Roesler et al., 1988). While it remains to be determined how commonly the CRE performs a dual role in basal and inducible expression, our recent study on gene regulation of dopamine P-hydroxyl- ase, which converts dopamine to norepinephrine, indicated that the CRE plays a similar dual role in transcriptional regulation of this gene (Ishiguro et al., 1993).

Gel shift assays demonstrated that the CREs of the so- matostatin (SOM oligo) or T H genes ( WT oligo) incubated with crude nuclear extract of PC12 cells form similar patterns of DNA/protein complexes (Fig. 4B). These oligonucleotides do not share any sequence identities beyond the CRE and are presumably the targets of the same or similar CRE-binding proteins. Yamamoto et al. (1988) previously observed the same pattern of complex formation using the somatostatin CRE and nuclear extracts of PC12 cells. Hyman et al. (1988) suggested that several neuronally expressed genes, i.e. so- matostatin, tyrosine hydroxylase, vasoactive intestinal poly- peptide, and proenkephalin genes, might be co-regulated by a common trans-acting element. At present, definite identifi- cation of the specific transcription factor involved in TH gene regulation, via the CRE, awaits further investigation. IR vitro competition experiments showed that >95% of the relative affinity is lost by deletion mutation, in general agreement with the in vivo transfection result (Figs. 3 and 4). Neverthe- less, it was rather surprising to observe that the deletion oligonucleotide retained some binding activity (Fig. 4B). In the deletion oligonucleotide, 5 out of the 8 bp in the CRE motif are missing. The resulting oligonucleotide contains an almost intact half-site of the palindromic octamer (3 out of 4 bp) as well as identical surrounding sequences. Yamamoto et al. (1988) showed previously that the half-site of the CRE

15694 CAMP Response Element in the Tyrosine Hydroxylase Gene Transcription

TABLE I Nucleotide sequences surrounding the consensus CRE in different genes

Sequences of the CRE region of genes which are known to be transcriptionally regulated by CAMP. Boldface sequences represent CRE motifs aligned to show homologies. Neighboring sequences do not demonstrate any significant homologies with each other. The position of the 5'-most nucleotide of the CRE is shown in regard to the CAP site.

Gene

Tyrosine hydroxylase Somatostatin Phosphoenolpyruvate carboxykinase c-fos Chorionic gonadotropin (a-subunit)

Vasoactive intestinal peptide Fibronectin Lactate dehydrogenase (A subunit) VGF(a2/NGF33.1) Proenkephalin Tyrosine aminotransferase

Sequence (5' to 3')

GGGCTTTGACGTCAGCCTGG CTTGGCTGACGTCAGAGAGA CGGCCCTTACGTCAGAGGCG AGCCCGTGACGTTTACACTC AAAAATTGACGTCATGGTAA AGCCCGTGACGTCAACACAC ATACTGTGACGTCTTTCAGA CCCCCGTGACGTCACCCGGG CCACTCTGACGTCAGCGCGG GAACATTGACGTCAATGGGG AGGGCCTG CGTCAGCTGCA AGCTTCTG CGTCAGCGCCA

the CAP site Distance to

-45 -48 -90 -66 -123 -143 -76 -173 -48 -82 -91 -3650

~

Ref.

Lewis et al. (1987) Montminy et al. (1986) Short et al. (1986) Fisch et al. (1989) Bokar et al. (1988)

Tsukada et al. (1987) Dean et al. (1989) Short et al. (1991) Hawley et al. (1992) Comb et al. (1986) Boshart et al. (1990)

retained some binding affinity to the CREB protein. We surmise, thus, that it is possible that the deletion oligonucle- otide retains <5% binding affinity. The point mutation oli- gonucleotide (M42 oligo) represented a 50-70% decrease in the relative affinity. This contrasts with the more severe loss of transcriptional activity detected by the transfection analy- sis (Fig. 3). This may be due to the fact that the oligonucleo- tides used in the gel shift assays lack the functional context of the promoter region. For instance, the unusual structure of the TATA box of the TH gene (Fig. lA) might render its transcription more dependent upon the intact CRE sequence. Thus, in the native context, a point mutation of the CRE could lead to a profound impairment of transcriptional acti- vation due to a lack of proper interactions with basic tran- scription factors, e.g. TFIID (Horikoshi et al., 1988).

We propose that the TH CRE is a key mediator for tran- scriptional activation of the TH gene. First, the TH CRE appears to be crucial for basal transcription in TH-expressing cells, since the transcriptional activity of the upstream se- quence of the TH gene was severely impaired by deletion or single-base mutation of the CRE motif. Second, the TH CRE could mediate altered expression of the TH gene by activated neuronal signal transduction pathways which regulate the transcriptional activity of CRE-binding protein(s). Consid- ering the essential role of the CRE for basal and CAMP- inducible expression of the TH gene, it is tempting to specu- late that the CAMP-dependent protein kinase (PKA)-signal- ing pathway might exert a dual role for TH gene regulation. Indeed, our recent analyses of several PKA-deficient PC12 cell lines demonstrate that the PKA system regulates both the basal and CAMP-inducible expression of the TH gene (Kim et al., 1993). Finally, the CRE might contribute to the tissue-specific transcription of the TH gene via interactions with other DNA-binding proteins at further upstream or downstream regions, as has been suggested for the a-gonad- otropin gene (Delegeane et al., 1987). It was noteworthy that deletion of the TH CRE did not leave any transcriptional activity despite the presence of all the other 2400-bp upstream sequences (Fig. 3). Thus, the protein factor(s) that binds to the putative positive element(s) residing at -365 to -150 bp, e.g. AP1, might contribute to TH transcription in concert with CRE-binding protein (Gizang-Ginsberg and Ziff, 1990).

Acknowledgments-We gratefully appreciate Dr. Robert Ross (De- partment of Biology, Fordham University) for SK-N-BE(2)C cell line and helpful suggestions. We thank Drs. Thomas Wessel, Joseph Cubells, Harriet Baker, and colleagues in our laboratory for their comments on the manuscript. We also thank Charles Carver for the figures and Maureen McCrum for typing the manuscript.

REFERENCES Andrisani, 0. M., Hayes, T. E., Roos, B., and Dixon, J. E. (1987) Nucleic Acids

Res. 15.5715-5728 Black, I. B.,Adler, J.E., Dreyfus, C. F., Friedman, W. F., LaGamma, E. F., and

Bokar, J. A., Roesler, W. J., Vandenbark, G. R., Kaetzel, D. M., Hanson, R.

Boshart, M., Weih, F., Schmidt, A., Fournier, R. E. K., and Schutz, G. (1990)

Carroll, J. M., Kim, K. S., Kim, K. T., Goodman, H. M., and Joh, T. H. (1991) Cambi, F., Fung, B., and Chikaraishi, D. (1989) J. Neurochern. 53, 1656-1659

Comb, M., Birnberg, N. C., Seasholtz, A,, Herbert, E., and Goodman, H. (1986)

Dash, P. K., Hochner, B., and Kandel, E. R. (1990) Nature 345,718-721 Dean, D. C., Blakeley, M. S., Newby, R. F., Ghazal, P., Hennighausen, L., and

Delegeane, A. M., Ferland, L. H., and Mellon, P. L. (1987) Mol. Cell. Biol. 7,

Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res.

Edlund, T., Walker, M. D., Bar, P. J., and Rutter, W. J. (1985) Science 230,

Roach, A. H. (1987) Science 236,1263-1268

W., and Nilson, J. H. (1988) J. Biol. Chern. 263,19740-19747

Cell 61,905-916

J. Mol. Neurasci. 3,65-74

Nature 323,353-356

Bourgeois, S. (1989) Mol. Cell. Bcol. 9, 1498-1506

3994-4002

11,1475-1589

41 3-41 6 Fader, D., and Lewis, E. J. (1990) Mol. Brain Res. 8 , 25-29 Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G. (1989) Genes & Deu.

Fung, B. P., Yoon, S. O., and Chikaraishi, D. M. (1992) J. Neurochern. 58,

"" "I"

3,198-211

2044-2052 Gandelman, K.-Y, Coker, G. T., 111, Moffat, M., and O'Malle, K. L. (1990) J.

Gizane-Ginsberc. E.. and Ziff. E. B. (1990) Genes & Deu. 4.477-491 Neurochern. 55,2149-2152

Gonzdez, G. A,,-and Montminy, M. R. (1989) Cell 59,6751680 Gonzalez, G. A,, Yamamoto, K. K., Fischer, W. H., Karr, D., Menzel, P., Biggs,

W.. 111. Vale. W. W.. and Montminv. M. R. (1989) Nature 337. 749-752 Goodkan, R. H . (199Oj Annu. Reu. N&osci. i3, lil-127 Gorman, C., Padmanabhan, R., and Howard, B. H. (1983) Science 221, 551-

Greene, L. A,, and Tischler, A. S. (1976) Proc. Natl. Acad. Sei. U. S. A. 73, 553

2424-2428 Ha;ington,- C. A., Lewis, E. J., Krzemien, D., and Chikaraisbi, D. (1987)

Hawley, R. J., Scheibe, R. J., and Wagner, J. A. (1992) J. Neurosci. 12, 2573-

He, X., and Rosenfeld, M. G. (1991) Neuron 7, 183-196 Horikoshi, M., Hai, T., Lin, Y.-S., Green, M. R., and Roeder, R. G. (1988) Cell

Huang, Z., Thewke, D., Gong, Q., Schlichter, D., and Wicks, W. D. (1991) Mol. 54, 1033-1042

Hyman, S. E., Comb, M., Lin, Y.-S., Pearlberg, J., Green, M. R., and Goodman, Brain Res. 11, 309-319

Ishiguro, H., Kim, K. T., Joh, T. H., and Kim, K.-S. (1993) J. Biol. Chern., in H. M. (1988) Mol. Cell. Biol. 8,4225-4233

Joh, T. H., Park, D. H., and Reis, D. J. (1978) Proc. Natl. Acad. Sci. U. S. A. press

Kaneda, N., Sasaoka, T., Kobayashi, K., Kiuchi, K., Nagatsu, I., Kurosawa, Y., 75,4744-4748

Fusita, K.. Yokovama, M., Nomura, T., Katsuki, M., and Nagatsu, T. (1991)

Nucleic Acids Res. 15,2363-2384

2581

Neuron 6,583-594 Kim, K.-S., Park, D. H., Wessel, T. C., Song, B., Wagner, J. A., and Joh, T. H.

Kobayashi, K., Kaneda, N., Ichinose, H., Kishi, F., Nakazawa, A., Kurosawa, (1993) Proc. Natl. Acad. Sci. U. S. A. 90,3471-3475

Lee, C. Q., Yun, Y., Hoeffler, J. P., and Habener, J. F. (1990) EMBO J. 9, Y., Fujita, K., and Nagatsu, T. (1988) J. Biochern. (Tokyo) 103,907-912

Lewis, E. J., Harrington, C. A., and Chikaraishi, D. M. (1987) Proc. Natl. Acad.

Lin. Y.-S.. and Green. M. R. (1988) Proc. Natl. Acad. Sei. U. S. A. 85, 3396-

4455-4465

Sci. U. S. A. 84,3550-3554

3400 '

Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 15,5490 Mitchell, P. J., and Tyan, R. (1989) Science 245,371-378 Montminy, M. R., and Bilezikjian, L. M. (1987) Nature 328, 175-178 Montminy, M. R., Sevarino, K. A,, Wagner, J. A., Mandel, G., and Goodman,

R. H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6682-6686

CAMP Response Element in the Tyrosine Hydroxylase Gene Transcription 15695 Na atsu, T., Levitt, M., and Udenfriend, s. (1964) J. Biol. Chem. 239, 2910- Struhl, K. (1991) N~~~~~ 7,177-181

Nakamaye K. and Ekstein F. (1986) Nucleic Acids Res. 14,9679-9698 Thoenen, H., Muller, R. A., and Axelrod, J. (1969) J. Phrmocol. Exp. Ther. Ptashne hk i988) Nature 336,683-689 169,249-254 Rwsler,’W. f Vandenbark, G. R., and Hanson, R. W. (1988) J. Biol. Chem. Tsukada, T., Fink, J. S., Mandel, G., andGoodman, R. H. (1987) J. Biol. Chem.

ROSS, 6. 4. Bieder, J. L., SPengler, B. A., and Reis, D. J. (1981) Cell. Mol. Yamamoto, K. K., Gonzalez, G. A., Biggs, W. H., 111, and Montminy, M. R.

2%17

263 9063-3066

Neurobd 1 301-311 (1988) Nature 334,494-498

Bioi. Chem. 281 9721-9726

Chem. 266,22164-22172 Reu. Neurosci. 12, 415-461

262,8743-8747

Short J. M. fi nshaw-Bori5 A., Short, H. P., and Hanson, R. W. (1986) J . Yoon, s. o,, and Chikaraishi, D. M. (1992) Neuron 9, 55-67 Short, S., Short, d. L., Milkowski, D. M., and Jungmann, R. A. (1991) J. Biol. Zigmond, R. E., Schwarzschild, M. A., and Rittenhouse, A. R. (1989) Annu.