The most important insight from Watson & Crick’s structure for DNA was that genetic information is...

download The most important insight from Watson & Crick’s structure for DNA was that genetic information is digitally encoded by lucky happenstance the genetics.

If you can't read please download the document

Transcript of The most important insight from Watson & Crick’s structure for DNA was that genetic information is...

  • Slide 1
  • the most important insight from Watson & Cricks structure for DNA was that genetic information is digitally encoded by lucky happenstance the genetics revolution has coincided with a revolution in our ability to process digital information 1953
  • Slide 2
  • computational algorithms to find and align DNA sequences Smith-Waterman is the ideal; BLAST is faster but less sensitive; the compromises continue with nextgen algorithms (e.g. SOAP) Query 554 TGGGGCTGGCAACAACTGGGCCAAAGGCCACTACACGGAGGGAGCCGAGCTGATCGAGAA 613 ||| || || || ||||||||||| ||||||||||| ||||||||||||||| |||| Sbjct 3095150 TGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTC 3095091 Query 614 TGTCCTAGAGGTGGTGAGGCACGAGAGT--GAGAGCTGTGACTGCCTGCAGGGCTTCCAG 671 ||||| || ||||||||| | | |||| |||||||||||||| || |||||||||||| Sbjct 3095090 GGTCCTGGATGTGGTGAGG-AAG-GAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAG 3095033 Query 672 ATCG-TCCACTCCCTGGGCGGG-GGCACAGGCTCCGGGATGGGCACTCTGCTCATGAACA 729 | | |||||| ||||| ||| ||||| || |||||||||||||| |||||||| | || Sbjct 3095032 CT-GACCCACTCTCTGGG-GGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCA 3094975 Query 730 AGATTAGAGAGGAGTACCCGGACCGGATCATGAATTCCTTCAGCGTCATGCCTTCTCCCA 789 |||| | || |||||||| ||||| |||||||| |||||||||||||||| || |||| Sbjct 3094974 AGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCA 3094915 Query 790 AGGTGTCGGACACGGTGGTGGAGCCCTACAACGCGGTTCTGTCTATCCACCAGCTGATTG 849 ||||||| |||||||||||||||||||||||||| || ||| ||||||||||| | | Sbjct 3094914 AGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGG 3094855
  • Slide 3
  • presidential announcement for sequencing of the human genome one year before its publication 26 Jun 2000: Craig Venter, Bill Clinton, Francis Collins CeleraIHGSC
  • Slide 4
  • open access has been official policy since 1996 Bermuda Rules UCSCs browser (US) http://genome.ucsc.edu/cgi-bin/hgTracks?org=human Ensembls contigView (UK) http://www.ensembl.org/Homo_sapiens/Location/View?r=X:151073054 -151383976 NCBIs mapViewer (US) http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?taxid=9606&CHR=X& BEG=151073054&END=151383976 Natures human genome http://www.nature.com/nature/supplements/collections/humangenome/ index.html
  • Slide 5
  • 2001: parameters for shotgun sequencing of the human genome 500-bp sequence read