The Monophyly of Brachyuran Crabs: A Phylogenetic Study ...questions of crustacean phylogeny. Sero...

The Monophyly of Brachyuran Crabs: A Phylogenetic Study Based on 18S rRNA

Trisha Spears; Lawrence G. Abele; Won Kim

Systematic Biology, Vol. 41, No. 4. (Dec., 1992), pp. 446-461.

Stable URL:

http://links.jstor.org/sici?sici=1063-5157%28199212%2941%3A4%3C446%3ATMOBCA%3E2.0.CO%3B2-P

Systematic Biology is currently published by Society of Systematic Biologists.

Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/about/terms.html. JSTOR's Terms and Conditions of Use provides, in part, that unless you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you may use content in the JSTOR archive only for your personal, non-commercial use.

Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at http://www.jstor.org/journals/ssbiol.html.

Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission.

JSTOR is an independent not-for-profit organization dedicated to and preserving a digital archive of scholarly journals. For more information regarding JSTOR, please contact [email protected].

http://www.jstor.org Fri Dec 15 20:47:03 2006

http://links.jstor.org/sici?sici=1063-5157%28199212%2941%3A4%3C446%3ATMOBCA%3E2.0.CO%3B2-P

http://www.jstor.org/about/terms.html

http://www.jstor.org/journals/ssbiol.html

mailto:[email protected]

http://www.jstor.org

Syst. Biol. 41(4):446-461, 1992

THE MONOPHYLY OF BRACHYURAN CRABS: A PHYLOGENETIC STUDY BASED ON 18S rRNA

TRISHA SPEARS,1 LAWRENCE G. ABELE,1 AND W O N KIM2

department of Biological Science B-142, Florida State University, Tallahassee, Florida 32306, USA

department of Zoology, College of Natural Sciences, Seoul National University, Seoul 151-742, Korea

Abstract.—A molecular approach was used to test hypotheses about the phylogeny of selected brachyuran crabs. Partial 18S ribosomal (r) RNA and rDNA sequences, ranging in length from 950 to 1,779 nucleotides, were obtained for 12 decapod crustaceans, 10 of which are generally considered to be brachyurans. Pairwise sequence-divergence estimates ranged from 0.5% to 3.9% among the so-called "true" crabs (i.e., excluding dromiids) and from 1.1% to 15.5% among the infraorders that were studied. The smallest infraorder divergence occurred between an anomuran and a dromiid crab, which suggested a dromiid-anomuran rather than a dromiid-brachyuran relationship. Results from sequence-divergence estimates and phylogenies inferred by maximum parsimony analyses of aligned sequences suggest that (1) the Raninidae demarcate the lower limit of the Brachyura and form a distinct lineage that diverged early from the lineage leading to other members of this infraorder, as indicated by a number of autapomorphic characters in the 18S rRNA molecule; (2) the Dromiidae should be removed from the Brachyura; (3) there is little support for either the family Dromiidae or the section Oxystomata as a monophyletic group; (4) there is an average substitution rate of roughly l%/50 million years, which results in insufficient sequence variation within the 18S molecule to resolve relationships among brachyurans that share a post-Cretaceous divergence; and (5) the 18S ribosome-based brachyuran phylogeny is concordant with findings on spermatozoan ultrastructure and on larval rather than adult morphology. [Brachyura; phylogeny; ribosomal RNA (rRNA); ribosomal DNA (rDNA); molecular systematics.]

Brachyuran crabs, which originated in the Jurassic, have undergone an extensive radiation and today are extremely diverse both morphologically and ecologically. Marine, freshwater, and terrestrial forms exist among almost 6,000 species, which are widely distributed from tropical mountain streams to deep-sea hydrothermal vents. Efforts to understand the evolution and phylogenetic relationships of this diverse group have been plagued by what appears to be extensive convergence in adult morphology. Attempts to circumvent this problem of homoplasy have focused on analysis of larval features (Gurney, 1942; Williamson, 1976; Rice, 1980; Martin, 1991), spermatozoan ultrastructure (Jamieson, 1989, 1990), and the fossil record (Glaess-ner, 1969; Schram, 1982). Molecular approaches have also been used to address questions of crustacean phylogeny. Serological techniques were refined by Boy den (1926) and applied to issues in crustacean systematics (Boyden, 1939; Leone, 1949,

1954). More recently, Vaughn and Traeger (1976) found a close correspondence between the percentage of hybridized repetitive DNA and evolutionary divergence as estimated from the fossil record for selected decapod crustaceans.

The present study examines certain questions of brachyuran phylogeny using 18S ribosomal RNA and DNA (18S rRNA and rDNA) sequences and compares relationships revealed by this type of molecular data with those inferred from prior morphological studies on brachyuran adults, larvae, and spermatozoa. The reasons for selecting 18S rRNA as an evolutionary marker are its ubiquity and homology in all cell types and its structural and functional constancy (Woese, 1987). Sequence data from this molecule have been effective in resolving relationships among crustacean taxa at the infraorder level (Kim and Abele, 1990); in the present study we used the same line of evidence for phylogenetic inference among families

446

1992 BRACHYURAN CRAB PHYLOGENY 447

TABLE 1. Crustacean species used in this study and presented in the classification scheme of Bowman and Abele (1982). Earliest fossil record for each taxon is given in parentheses.

GenBank accession

na no. Classification Species

Suborder Pleocyemata

I. Infraorder Caridea (Middle Jurassic)

II. Infraorder Anomura (Lower Jurassic)

III. Infraorder Brachyura (?Mississippian, Lower Jurassic) A. Section Dromiacea (?Mississippian, Lower

Jurassic) Family Dromiidae (Cretaceous)

B. Section Archaeobrachyura (Lower Jurassic) Family Raninidae (Lower Cretaceous)

C. Section Oxystomata (Lower Cretaceous) Family Calappidae (Lower Cretaceous) Family Leucosiidae (Middle Eocene)

D. Section Oxyrhyncha (?Upper Cretaceous, Eocene)

Family Majidae (?Upper Cretaceous, Eocene) Family Parthenopidae (Eocene)

E. Section Cancridea (Eocene) Family Cancridae (Eocene)

F. Section Brachyrhyncha (Cretaceous) Family Xanthidae (Upper Cretaceous)

Palaemonetes kadiakensis (Pk) 1,380 M34359

Clibanarius vittatus (Cv) 992 M91051

Dromidia antillensis (Da) Hypoconcha arcuata (Ha)

Ranilia muricata (Rm) Raninoides louisianensis (Rl)

Hepatus epheliticus (He) Iliacantha subglobosa (Is)

Libinia emarginata (he) Parthenope serrata (Ps)

Cancer irroratus (Ci)

Menippe mercenaria (Mm)

1,112 1,227

1,127 1,779

1,041 1,151

950 1,223

1,008

1,151

M91052 M91054

M91059 M91060

M91053 M91055

M91056 M91058

M91050

M91057

1 Number of bases sequenced.

of brachyuran crabs. We obtained either 18S rRNA or 18S rDNA sequences for representatives of all six brachyuran (sensu lato) sections and two related decapod taxa to investigate (1) whether the Brachyura as currently defined (i.e., including the Dromiacea) is a monophyletic assemblage and if so, which taxon demarcates its lower limit; (2) whether raninids are part of a monophyletic Oxystomata; and (3) whether the substitution rate for brachyuran 18S rRNA and rDNA is sufficient to resolve relationships among crabs that have recently diverged.

BRACHYURAN SYSTEMATICS

The taxa used in this study are presented in Table 1 according to the classification of Bowman and Abele (1982). This arrangement of brachyuran taxa is one of many that have been suggested, and Rice (1980) identified several "outstanding problems" that have prevented systematists from

reaching a consensus on a monophyletic classification for brachyurans. In particular, the taxonomic arrangement of dromiid and raninid crabs has long been an unresolved issue (Fig. 1). Some authors (Milne Edwards, 1834-1840; Dana, 1852; Miers, 1886; Henderson, 1888; Gordon, 1963) removed both of these from the "true" crabs of the Brachyura and placed them among pagurids, hippids, and porcellanids in a separate infraorder, Anomura (Fig. la). In contrast, others (Haan, 1833-1849; Boas, 1880; Ortmann, 1896; Borradaile^ 1907; Bouvier, 1940; Glaessner, 1969; Stevcic, 1973; Guinot, 1977, 1978; Balss [1957] in Guinot, 1979; Saint Laurent, 1980a, 1980b; Burkenroad, 1981; Bowman and Abele, 1982; Schram, 1986) grouped these as primitive forms with all other crabs (Fig. lc). These latter schemes primarily differed in the status of the brachyuran taxon Oxystomata and whether raninids should be included with calappids and leucosiids rather than with dromiids.

448 SYSTEMATIC BIOLOGY VOL. 4 1

true" crabs

dromiids

? raninids

(b)

Brachyura

Anomura

"higher" crabs

' raninids

dromiids

"higher" crabs

FIGURE 1. Generalized representations of three alternative hypotheses relating dromiid and raninid crabs to brachyurans. (a) Both raninids and dromiids (grouped together or not) are excluded from the Brachyura (e.g., Milne Edwards, 1834-1840; Dana, 1852; Miers, 1886; Henderson, 1888; Gordon, 1963). (b) Raninids are included within the Brachyura; dromiids are not (e.g., Bourne, 1922; Lebour, 1934; Gurney, 1942; Williamson, 1976; Rice, 1980; Jamieson, 1989,1990). (c) Both raninids and dromiids (grouped together or not) are included within the Brachyura (e.g., Haan, 1833-1849; Boas, 1880; Ortmann, 1896; Borradaile, 1907; Bouvier, 1940; Glaessner, 1969; Stev-cic, 1971, 1973; Guinot, 1977, 1978; Balss [1957] in Guinot, 1979; Saint Laurent, 1980a, 1980b; Burken-road, 1981; Bowman and Abele, 1982; Schram, 1986).

Taxonomic revisions by Gordon (1963), Guinot (1977, 1978), and Saint Laurent (1980a, 1980b) sought to classify crabs on the basis of gonopore location. Gordon (1963) separated dromiids, raninids, and tymolids from all other crabs on the basis of a coxal female gonopore (Fig. la), whereas Guinot (1977, 1978) used the same feature to group these taxa as brachyurans (Fig. lc), albeit in their own section, Podotremata. She placed raninids in a subsection, Archaeobrachyura, and dromiids in another subsection, Dromiacea; higher crabs with either coxal or sternal gonopores were placed in the section Het-erotremata, and those with only sternal gonopores were placed in the section Tho-racotremata. Saint Laurent (1980a, 1980b) slightly modified this scheme by combining the Heterotremata and Thoracotremata into the Eubrachyura.

Suspicions of convergent evolut ion prompted several phylogenetic studies based on comparisons of larval characters. A number of interesting developmental hypotheses have been proposed to explain the mix of apomorphic and plesiomorphic character states observed for many crab larvae and adults. Among these are the notions of abbreviated and accelerated development among larval (Rabalais and Gore, 1985) and postlarval (Felder et al., 1985) decapods, as well as Williamson's (1988a, 1988b) unusual and highly speculative hypothesis of larval capture (i.e., the interspecific transfer of large amounts of genetic material). On the basis of larval features, Lebour (1934) and Gurney (1942) excluded all dromiaceans (i.e., dromiids, homolodromiids, and homolids) but not raninid crabs from the Brachyura, placing the dromiaceans among the Anomura (Fig. lb). Similarly, both Williamson (1976,1982) and Rice (1980, 1983) concluded that the zoeal stages of certain dromiaceans (i.e., dromiids and homolodromiids) showed a greater affinity with anomuran than with brachyuran zoeae and suggested that these two groups be excluded from the Brachyura (Fig. lb). However, a recent description of certain homolodromiid larvae (Martin, 1991) revealed both similarities to (e.g., an-omuran-like antennal scale) and differ-


ences from (e.g., lack of a hairlike second telson process) the larvae of two other dromiacean families (Dromiidae and Dy-nomenidae), which suggested an unresolved intermediate posit ion for this primitive dromiacean taxon. Different interpretations of larval studies have likewise led to different views on the position of the family Raninidae relative to the higher crabs. Rice (1980) considered ranin-ids to be distantly yet directly related to higher crabs, whereas Williamson (1976) suggested that they arose independently from a homolid ancestor.

Recent evidence based on spermatozoan ultrastructure (Jamieson, 1989,1990) seems to corroborate the view of raninids but not dromiids as primitive members of the Brachyura (Fig. lb), although Jamieson noted that dromiid sperm, like some dro-miid larvae, exhibit a perplexing mix of ancestral and derived features.

PALEONTOLOGICAL RECORD

Fossil evidence is an important and useful supplement to systematic studies and can be used to test phylogenetic hypotheses and to estimate times and even rates of evolutionary divergence, regardless of whether morphological or molecular data are used to infer relationships among modern taxa. For example, the fossil record has been used to estimate the rate of change within 16S and 18S rRNA molecules (Och-man and Wilson, 1987).

Table 1 lists the earliest fossil records for the taxa considered in the present study (compiled from Glaessner, 1969; Wright and Collins, 1972; Feldmann, 1981; Bishop, 1986; Schram, 1986). In general, the fossil record reveals a decapod fauna that is already highly diverse at the infraorder level by the Jurassic, at least 200 million years ago (MYA). According to Schram (1982), the fossil record for brachyurans (sensu lato) reveals three waves of radiation that occurred in the Jurassic, Cretaceous, and Eocene and provides paleontological support for the three main brachyuran divisions suggested by Guinot (1977, 1978), namely, the Podotremata, Heterotremata, and Thoracotremata. Dromiaceans are the first crabs to appear, with two families rep

resented at least 200 MYA in Lower Jurassic sediments, but the discovery of the Mis-sissippian fossil Imocaris tuberculata, assigned to the Dromiacea by Schram and Mapes (1984), extends the occurrence of this group even further, to 350 MYA, or 175 MY prior to the appearance of any other group of crabs. The only other fossil crabs appearing in this first wave are the homolid archaeobrachyurans (sensu Guinot) in Upper Jurassic strata that are roughly 175 MY old. The second evolutionary wave, beginning in the Cretaceous (approximately 150 MYA), reveals further diversification of the Archaeobrachyura with the appearance of raninids and oxysto-matous crabs. The third and final wave occurred in the Eocene (about 50 MYA) and was characterized by the rise and rapid radiation of the three remaining brachyuran sections, Oxyrhyncha, Cancridea, and Brachyrhyncha.

MATERIALS AND METHODS

Taxa

Specimens for this study (Table 1) were either caught in the Gulf of Mexico or purchased from the Department of Marine Resources, Marine Biological Laboratory, Woods Hole, Massachusetts. Representatives from each of the six major crab sections were selected to address issues of brachyuran monophyly and the lower limit of this group. We selected two dromiids (Hypoconcha arcuata and Dromidia antillen-sis) and two raninids (Raninoides louisianen-sis and Ranilia muricata) as representatives of taxa that have been variously included within the Brachyura or not; two oxy-rhynch taxa (a majid, Libinia emarginata, and a parthenopid, Parthenope serrata) and two putative oxystomes (Hepatus epheliticus and Iliacantha subglobosa) were chosen, as were the cancrid Cancer irroratus and the brachy-rhynch Menippe mercenaria. An anomuran (the hermit crab Clibanarius vittatus) was included because dromiids and raninids have sometimes been placed with this group as well. The caridean shrimp Palaemonetes ka-diakensis was used as an outgroup. The two oxystomes were included to allow investigation of the molecular support for a


TABLE 2. List of primers

Primer

Forward amplification Reverse amplification Forward sequencing

Reverse sequencing

used to amplify and sequence crustacean 18S rRNA and rDNA.

Sequence3

5' TAATGATCCTTCCGCAGGTT 3' 5' CCTGGTTGATCCTGCCAG 3' 5' ACCTTGTTACGACTT 3' 5' ACGGGCGGTGTGTAC 3' 5' TCTAAGGGCATCACA 3' 5' AATTCCTTTRAGTTT 3' 5' GCATCGTTTAHGGTT 3' 5' GWATTACCGCGGCKGCTG 3' 5' ATTCCCCGTTACCCG 3' 5' AGCTCTAGAATTACC 3' 5' GTACACACCGCCCGT 3' 5' AAACTCAAAGGAATTGACGG 3' 5' AACCDTAAACGATGC 3' 5' CAGCMGCCGCGGTAATWC 3' 5' CGGGTAACGGGGAAT 3' 5' GGTAATTCTAGAGCT 3'

Position**

1 1,808

32 162 356 655 767

1,221 1,438 1,646

176 669 781 '

1,222 1,452 1,660

a Nucleotide ambiguities are represented by letter codes proposed by the International Union of Biochemistry. b Indicates the position of each primer's 5' base on the Artemia salina (Nelles et al., 1984) 18S ribosomal gene.

monophyletic Oxystomata and whether raninids share an affinity with this group.

Methods

Our investigation was a stepwise process that included (1) extraction of nucleic acid (either genomic DNA or cellular RNA) from living, frozen, or preserved specimens; (2) determination of the 18S rRNA or rDNA nucleotide sequences for these specimens; (3) computation of estimates of sequence divergence between pairs of taxa; and (4) preparation of a multiple alignment of homologous nucleotide positions to be used in phylogeny reconstruction.

The rRNA extraction, purification, and sequencing methods used in the present study closely follow those of Lane et al. (1985) and are described in detail by Kim and Abele (1990). The sequencing process involves base-specific dideoxy chain-terminating nucleotides (Sanger et al., 1977) and reverse transcriptase for synthesizing cDNA fragments of various lengths by extension of radioactively end-labeled oligonucleotide primers (Table 2) that hybridize to complementary regions of template 18S rRNA. Alternatively, for one species (Raninoides louisianensis), genomic DNA was phenol extracted (Carothers et al., 1989), and the 18S gene region was symmetrically amplified by the polymerase chain reaction (Saiki et al., 1988). Am

plification primers (Table 2) and excess nucleotides were removed from the amplified gene fragments by Centricon-30 microcon-centrators (Amicon, Beverly, Massachusetts). Cycle sequencing was performed as described by Carothers et al. (1989) with radioactively end-labeled oligonucleotide primers, dideoxy chain-terminating nucleotides, and Taq polymerase (Promega, Madison, Wisconsin). Electrophoresis of sequencing reactions was carried out on 6% and 8% denaturing polyacrylamide gels that were fixed, dried, and exposed to X-ray film at room temperature. A sonic digitizing device (Science Accessories Corp.) was used to enter nucleotide data from auto-radiograms directly into computer files through the Microgenie sequence analysis program, version 6.0 (Queen and Korn, 1988). Unreadable and missing data were replaced by the letter "N." The cDNA files were altered into a 5'-to-3' RNA format and used in subsequent pairwise and multiple alignments.

Alignment requires identification of nucleotide positions that are homologous among different sequences and is perhaps the most critical and problematic aspect of sequence analysis (Swofford and Olsen, 1990). The reliability of a molecule-based phylogeny is contingent upon nucleotide differences within an aligned set of sequences that reflect evolutionary change


across truly homologous characters (i.e., nucleotide sites). The ALIGN option of the FASTA program (Pearson and Lipman, 1988), which is based on a matrix scoring system, was used to align sequences for all pairs of taxa. Sequences were checked to insure that the primer sequences, as regions of presumed homology, aligned perfectly. The number of transition and transversion substitutions and the number of "base positions shared" (Miyamoto et al., 1989) were determined and used to compute pairwise sequence divergence estimates, which were corrected for multiple substitution events (Jukes and Cantor, 1969) and expressed as percentages (Table 3). Unknown bases (N) were excluded from these calculations.

To construct a multiple alignment of all sequences, we identified the two taxa exhibiting the least divergence based upon the FASTA-generated pairwise alignments and designated the one with the longest sequence the reference sequence, making it the first taxon in the ensuing multiple a l ignment ; remaining sequences were added one at a time in decreasing order of similarity to the reference sequence, and alignment gaps were inserted to maintain regions of homology. Taxa in this multiple alignment were analyzed with Swofford's (1990) PAUP computer package (version 3.0s) using the branch-and-bound algorithm to find all most-parsimonious trees. Bootstrap analyses (Felsenstein, 1985) were performed on these data with PAUP using the following heuristic search options: simple addition sequence (reference taxon = Menippe), tree-bisection-reconnection branch swapping, MAXTREES = 1,000, and steepest descent option not in effect.

RESULTS

Sequence Divergence

Sequences ranged in length from 950 to 1,779 nucleotides, excluding gaps and unknown bases (Table 1). Pairwise estimates of sequence divergence across all taxa ranged from 0.5% (between two crabs, M. mercenaria and Hepatus epheliticus) to 15.5% (between the caridean shrimp Palaemonetes kadiakensis and one of the dromiid crabs,

T3 cu -d

g H o u u * o> o *> u ^ P-<

8)1 a CU CU CD

T3 O f t

w _

cu £

a & o CU CU ,

* > & CO S » "

co c5 PQ cu • - • —

« ; s<*>

CU

.§ 29 o 3 vp ON MM % <U CO M

* * s ̂ o> o> •>• o>

T>b o 13 .S S o 3 ~" •fi S y to

W)2 o g

3 » § C CU CO '£ O

•5 I * o

E , CU £ CU

00 co o ^ (« CO

; MM co £ > O CU -e

C7< I 6 a

* C a; 3

* & ^ CO CD co «C 0 0 nrt CO U

^ s a s « * &< a S» co X 3 cu d cu C

i f sa w w O N r * vw ^ vo • - • O 3 ON co co <—'

9 d >j ii fie

" H . C O

CU 3^

*-i cu

* .2 .. £ *

co . .2 -1

(fl co H J

a u

C O r j l c O l O t N C O O H H O O

r j H t V j O N c o c ^ o q c ^ c o i n v q

00

f O v o i n H v o i s f O H o q | _ „ C O r J H C O V O C N o i r H o i r H W O

vOvOOO(N(Ntv,t>:'*

O O ON t N v O O ON 00 ON

CN CO C^ ^ CO ON ^

uS uS ̂ vd co co »-<

H H s C C 0 v O N H O N H

CO bs ON CN bs ^

CO1 ̂ CO vd H CO

ON VO H O 00 ON 00 *-H ON ON

^ U"> CO H U">

v O N O ^ O O rji rji rji uS H

t o « N . L ^ O -ON V *-H v LQ v. O N T—1 O N *—1 O N »—1

ITi bs 00 ^

CN CO CO 16

T—I O N i H O N T—I O N T—I

.3, in i-j co

uS T-i uS

^ ^ ° j , « g > f e ^ > o H H O \ H O O H O \ H

C O C O O O v O c O b s l O v O

ON ON

CN CO

bs °v °v ̂ v 00 °v CO ON O N H H O \ H 0 0 H O \ O \

O K M \£ ) H rj< T f l O v£)

m c o ^ c o ^ c ^ c o c o c o I D C O N r t N C O C O O M H O N C O ^ ^ O O C O C O ^ C O C ^

,_ , I O O O N O N O N O O O N O O O N O O O N

CO ^ O ^ t n O C O N c N O O H T-H C O * - I C \ J ' « t f ' « t f ' , t f C O ' , t f C O ' , t f

rt< vO 00 vO

O N d N v - C v - C ' - , < m v - C i o K O N v <

O O O N H H H O N H C O H C O H

b s b s O N v O C O v O ^ O N C O O C ^ O H T j i H N H ^ O r t H t N

« 'U ,U « g

5 ' 5 « S 1 5 S-

*J2 O

< CQ U Q W I


Hypoconcha arcuata; Table 3). The average percent divergence between the outgroup P. kadiakensis and the other taxa was 13.6% (SE = 0.31); the range was 12.5-15.5% (Table 3). The two dromiid crabs in section IIIA (roman numerals designate taxonomic headings listed in Table 1) were, on average, considerably more divergent from brachyurans in sections I I IOF than were the two raninids in section IIIB (4.9%, SE = 0.39; compared with 2.8%, SE = 0.15, respectively; Table 3). The sequences of these two dromiid crabs, which are currently classified in the same family, Dromiidae, are quite different (5.3%, Table 3), and one of them, H. arcuata, is almost five times more similar to an anomuran hermit crab, Clibanarius vittatus (1.1%, Table 3), than to the other dromiid. Hepatus epheliticus and I. subglobosa typically are placed within the Oxystomata (group IIIC, Table 3), yet the divergence between these two taxa (1.4%, Table 3) can exceed that observed between these species and other groups. In fact, the least sequence divergence observed among all taxa occurs between a brachyrhynch and one of the oxystomatous crabs (0.5% for M. mercenaria and H. epheliticus, Table 3).

Multiple Alignment

A multiple alignment generated from the 12 sequences selected for investigation of brachyuran monophyly contained 380 variable sites; 104 of these were phyloge-netically informative. The 3' region of the molecule (base positions 1767-1860 in our multiple alignment) typically undergoes a more rapid rate of change than other more conserved areas (Gutell et al., 1985), and 36 of the informative sites are found in this region (10 of which are autapomorphic for the family Raninidae). The homology of base positions becomes questionable when it is difficult to align sequences in variable regions such as this, so phylogenetic analyses were carried out on data that both included and excluded informative sites from this region.

The sequences of the six taxa representing brachyuran sections that have arisen since the Cretaceous (groups IIIC-F, Table 1) contain 11 informative characters, 7 of

which occur in the 3' variable region. The low number of informative characters and their distribution within the molecule reflects the relatively recent divergence of these higher brachyuran taxa and the conservative substitution rate for 18S rRNA.

Parsimony Analysis

There are three equally most-parsimonious trees based on the 12 aligned sequences, one of which is shown in Figure 2. The first branch in all three trees was relatively long (34 steps) and led to a node joining an anomuran hermit crab (C. vittatus) and one of the dromiids {Hypoconcha arcuata). This result was unexpected and was explored further. The other dromiid, D. antillensis, came off next, followed by a clade placing the two raninid crabs as the sister group of the higher Brachyura. The next two branches led to the oxyrhynchs L. emarginata and Parthenope serrata. The only topological variation among the three trees occurred above the node found in 53% of the bootstrap replicates, wherein the remaining four taxa were arranged in two clades (as in Fig. 2), or with Hepatus epheliticus branching off before the Cancer irroratus/L subglobosa clade, or with C. ir-roratus coming off before I. subglobosa. There were 12 trees that were one step longer, the strict consensus of which is shown in Figure 3. This topology differs from that of the most-parsimonious tree shown in Figure 2 in that the dromiid D. antillensis joined the Clibanarius vittatus I Hypoconcha arcuata clade in 3 of the 12 trees. However, most of the differences among the longer trees were among the so-called "higher" crabs, as seen by their unresolved node.

A bootstrap analysis of 1,000 sampling replicates for the same data showed strong support for three clades (Fig. 2): a raninid clade (100%), a C. vittatus IH. arcuata clade (100%), and a clade grouping all the higher brachyura (98%). The node placing the Raninidae as a sister taxon to higher crabs was supported in 96% of the sampling replicates. It is at this node (or, more accurately, just below it) that we set the lower limit of the Brachyura (Fig. 2).


i M. mercenaria

j & ,I"F,

r-®

16

14

4L. H. epheliticus

(IIIC)

— C. irroratus (HIE)

subglobosa (IIIC)

1 — P. serrata (HID)

Brachyura

23

13 /K

— ®

L emarginata ("ID)

24

R muricata (IIIB)

R louisianensis (IIIB)

18 0. antillensis

(IIIA)

34

P. kadiakensis (I)

FIGURE 2. Relationships inferred by parsimony analysis of 12 taxa based on 104 informative nucleotide positions (including gaps) using the caridean shrimp Palaemonetes kadiakensis as an outgroup. Roman numerals and capital letters in parentheses refer to classification scheme given in Table 1. One of three equally most-parsimonious alternative phylogenies is shown; total length = 202 steps; consistency index (Kluge and Farris, 1969) = 0.748; retention index (Farris, 1989) = 0.715. Circled numbers indicate the percentage of 1,000 bootstrapped replicates that support the nodal relationships shown; our view of the lower limit of the Brachyura is indicated. (Drawings modified from Smith, 1886; Rathbun, 1925,1933,1937; Garth, 1939; Holthuis, 1955; Williams, 1965; Hart, 1982; Abele and Kim, 1989.)


M. mercenaria (i"F)

H. epheliticus (IIIC)

C. irroratus (HIE)

P. serrata (HID)

/. subglobosa (IIIC)

L emarginata ("ID)

R. muricata ("IB)

R. louisianensis ("IB)

D. antillensis (IIIA)

C. vittatus (II)

H. arcuata (IIIA)

I P. kadiakensis (i)

FIGURE 3. Strict consensus of 12 next-most-parsimonious trees. Total length = 203 steps; consistency index (Kluge and Farris, 1969) = 0.744; retention index (Farris, 1989) = 0.709-0.715.

When alignment gaps were omitted as characters, a parsimony analysis of the reduced set of 73 informative characters produced 20 trees, for which the strict consensus was similar to that seen in Figure 3, with the exception that in some trees Ranilia muricata came off the main branch before the other raninid, Raninoides louisi

anensis. The breakup of this clade is most probably due to the fact that these two taxa lose 9 of their 10 autapomorphic characters at the 3' end of the molecule when alignment gaps are deleted from the analysis. The branching order in the tree produced by bootstrapping (Fig. 4) was almost identical to that in Figure 2 when gaps were included as characters, except one of the dromiids, D. antillensis, joined the C. vittatus/H. arcuata clade. As expected with fewer data, the bootstrap values are lower in Figure 4 than in Figure 2, but the consistencies lend additional support for setting the lower limit of the Brachyura below the node leading to the raninid clade. Deleting characters in the variable 3' region raised the consistency index (Kluge and Farris, 1969) from 0.748 to 0.804 and increased the number of trees from 3 to 36, but the strict consensus of these was identical in topology to that shown in Figure 2 below the node with a 68% bootstrap value. As stated above, this variable region contains 10 autapomorphic characters for the two raninid crabs used in our study, so the deletion of these characters resulted in shortening the branch between the raninid clade (Ranilia muricata and Raninoides louisianensis) and the main stem in Figure 2 from 24 steps to 3.

The close association of the hermit crab C. vittatus with one of the dromiid crabs, H. arcuata, was unsuspected, and yet the bootstrapped parsimony analysis (Fig. 2) indicated very strong support (100%) for the node shared by these two taxa. This result led us to explore the possibility that this association was the result of systematic error (i.e., a case where two divergent taxa are erroneously grouped together because the parsimony method failed to detect high levels of homoplasy; Felsenstein, 1978). For this investigation we employed strategies suggested by Swofford and Olsen (1990) for the detection and minimization of systematic error effects. We used the parsimony method to reanalyze the data after (1) deleting nucleotide positions that were difficult to align with certainty, as discussed above; (2) recoding nucleotide character states A and G as purine (R) and C and U as pyrimidine (Y), so as to analyze


M. mercenaria ("IF)

- — H. epheliticus (1110)

C. irroratus (HIE)

12

Brachyura

/. subglobosa (MIC)

L emarginata (HID)

—— ft muricata (MB)

ft louisianensis (1MB)

11

10

22

D. antillensis (IIIA)

24

C. vittatus (II)

ft arcuata (HIA)

P. kadiakensis (I)

FIGURE 4. Phylogeny inferred by bootstrapped parsimony analysis based on 1,000 sampling replicates of 73 informative characters (gaps excluded). Circled numbers indicate the percentage of replicates that support the nodal relationships shown; our view of the lower limit of the Brachyura is indicated. Total length = 138 steps; consistency index (Kluge and Farris, 1969) = 0.725; retention index (Farris, 1989) = 0.705.


only the more conservative transversions (e.g., purine to pyrimidine) and ignore transitions (e.g., purine to purine and pyrimidine to pyrimidine), which can contribute to high levels of homoplasy in divergent taxa (Brown et al., 1982; Miyamoto and Boyle, 1989; Kraus and Miyamoto, 1991); and (3) deleting first C. vittatus then H. arcuata from the analysis. In cases (1) and (2), the consistency index remained high and the C. vittatus/H. arcuata clade persisted with strong support (bootstrap values of 100%); in case (3), each of these two taxa maintained a basal position on the tree, coming off first and never grouping with the other dromiid, D. antillensis.

None of the above analyses indicate strong support for a monophyletic Oxysto-mata or a close association of the Raninidae with this group, whether gaps are included as characters or not. In all cases (Figs. 2 -4), the two raninids either form a clade or come off the tree individually, separated from the other brachyurans by relatively long branch lengths (e.g., 24 -h 16 = 40 steps, Fig. 2). In two of the three most-parsimonious trees, the brachyrhynch (M. mercenaria) and one of the oxystomes (He-patus epheliticus) group together, and the other oxystome (2. subglobosa) groups with a cancrid (Cancer irroratus) (Fig. 2). However, the relatively low bootstrap values for these upper nodes in Figure 2 and the unresolved node in Figure 3 suggest that the phylogenetic relationships among these higher crabs (groups IIIC-F, Table 1) are variable and unresolved given the present data.

DISCUSSION

Sequence data from the relatively conserved 18S rRNA molecule can be used to resolve early relat ionships among the Brachyura (sensu lato) and to address the controversial phylogenetic placement of primitive crab taxa. Pairwise sequence-divergence estimates and phylogenetic analyses of the brachyurans and related decapods s tudied here lead us to several conclusions.

1. The Raninidae is a member of the Brachyura (sensu stricto) that diverged early from the

main brachyuran lineage.—The sequence data show that the two raninid taxa are more closely allied with the so-called higher crabs than with other crustacean taxa, and we place the lower limit of the Brachyura at the base of the stem that unites the Raninidae to their sister group. This decision rejects the view depicted in Figure la, which places raninids among the Ano-mura, as well as that shown in Figure lc, which places them with dromiids as fellow brachyurans. There is no molecular support, therefore, for the division Podotre-mata (sensu Guinot), which groups raninids and dromiids together on the basis of a similar gonopore location. Our data are consistent with spermatozoan ultrastruc-ture evidence (e.g., a spherical and differentiated acrosome embedded in the nucleus; Jamieson, 1989) and zoeal morphology (e.g., ventrally directed rostral spine, paired lateral carapace spines, and lack of setation on the third maxilliped; Williamson, 1965; Rice, 1980) indicative of a raninid-brachyuran relationship that excludes dromiids. The phylogenetic position of the raninid clade in Figure 2, the relatively long branch lengths between raninids and the node common to the higher Brachyura (Figs. 2, 4), and the molecular apomorphies shared by the two raninids in the 3' region of the multiple alignment suggest an early divergence of the Raninidae from the higher Brachyura and a long period of independent evolution for this group. This idea is consistent with the fossil record (e.g., diverse raninids by the early Cretaceous; Glaessner, 1969), with autapomorphies observed for raninid sperm (e.g., longitudinal corrugations in the subacrosomal chamber wall; Jamieson, 1989), and with an array of larval features suggestive of an independent (Williamson, 1965, 1976) or at least very early (Rice, 1980) origin for the raninid line.

2. Dromiid crabs should be removed from the Brachyura (sensu stricto).—The molecular data presented here clearly contradict the phylogenetic position of dromiids depicted in Figure lc, which places them among the true crabs. The exclusion of dromiids


from the Brachyura is consistent with the findings of Jamieson (1990), based on sper-matozoan ultrastructure, and those of Le-bour (1934), Gurney (1942), Kircher (1970), Williamson (1976), and Rice (1980, 1983), based on comparative larval morphology. Dromiid spermatozoa possess, plesiomor-phically, a disc-shaped and rather undifferentiated acrosome that is not embedded in the nucleus and an autapomorphic capitate perforatorium (Jamieson, 1990). Other features (e.g., reduced lateral nuclear arms, absence of a posterior median nuclear process, and a reduced number of organelles) could be viewed either as plesiomorphies that set dromiids apart from the Brachyura or as apomorphic losses of brachyuran characteristics (Jamieson, 1990). Dromiid zoeae possess a number of anomuran features not found in brachyurans (e.g., a hairlike second telson process, uropods on later stages, a lack of dorsolateral knobs or spines on abdominal segments, and setose endopods of the first and second maxilli-peds; Rice and Provenzano, 1966; Kircher, 1970; Williamson, 1976; Rice, 1980). Van Dover et al. (1982) showed that dromiid larvae possess a type of zoeal scaphog-nathite similar to that of tymolids but distinct from those of other anomuran and brachyuran families. Even data from pair-wise serological tests measuring the degree of correspondence among hemocyanins for various decapods indicate that certain oxy-stomatous crabs have no closer relationship to the Dromiacea than to other reptant decapods such as the American lobster (Homarus americanus), the spiny lobster (Panulirus argus), or pagurid hermit crabs (Leone, 1954).

3. The family Dromiidae is not monophylet-ic.—lt seems unlikely that Dromidia and Hy-poconcha, the two dromiid genera used in this study, are as closely related as previously thought. Morphologically, adults of the taxa in this family can be highly variable (e.g., in carapace shape), and the outward similarity between D. antillensis and H. arcuata may be a case of convergence in response to the shared habit of carrying an object (e.g., a sponge or lamellibranch valve) over the dorsal surface. Kircher

(1970) detailed the anomuran-like similarities between the larvae of these two species, which distinguish them from the Brachyura (sensu stricto), but she also noted a number of differences between them (e.g., fewer zoeal stages and lack of a stage I third maxilliped in H. arcuata) that are consistent with our reported sequence divergence (Table 2). Bootstrapped parsimony analysis shows such strong support (100%, Fig. 2) for a clade consisting of the dromiid crab H. arcuata and the hermit crab Clibanarius vittatus and excluding the other dromiid, D. antillensis, that a polyphyletic view of the Dromiidae in particular, and the Dromiacea in general, must be seriously reconsidered. The long branch (34 steps, Fig. 2) leading to this clade and the low estimate of sequence divergence (1.1%, Table 2) between its two members lend additional support to this view. Carcinol-ogists have variously proposed a homarid (Bouvier, 1896), glypheoid (Glaessner, 1969), or thalassinid (e.g., Gurney, 1942; Williamson, 1976; Rice, 1980) origin for brachyurans (including dromiaceans). This lack of consensus may indicate dromiid polyphyly. Clearly, sequences from additional dromiaceans (e.g., dynomenids and homolodromiids) and other reptant taxa (e.g., Anomura, Palinura, Astacidea, and Thalassinidea) must be considered before questions of dromiid and brachyuran monophyly and origins can be properly addressed.

4. The Oxystomata is an artificial assemblage.—Systematists have for the most part abandoned a monophyletic view of the Oxystomata, and the molecular evidence based on 18S sequences supports this decision. For example, pairwise estimates of sequence divergence among the four oxy-stomatous (sensu lato) crabs studied here (Ranilia muricata, Raninoides louisianensis, Hepatus epheliticus, and I. subglobosa; Table 3) range from 1.4% to 3.9% and appear large relative to the divergences of these taxa from other crabs. Furthermore, the parsimony results shown in Figures 2-4 support the ideas of others (Bourne, 1922; Guinot, 1978; Rice, 1980) who have suggested removing raninid crabs from this group. Wil-


liamson (1965, 1976), Rice (1980), and Van Dover et al. (1982) pointed out that raninid larvae are more similar to homolid crab larvae than to any other brachyurans, and Van Dover et al. (1982) even noted certain similarities between the zoeal scaphog-nathites of raninids and those of certain anomurans. Jamieson (1989) outlined key differences in raninid sperm that distinguish them from what he termed the Oxy-stomata-Cancridea-Brachyrhyncha (OCB) assemblage.

5. Substitution rate averages l%/50 MY (SE = 0.17%).—A consideration of sequence divergence in light of the fossil record for the study taxa (Table 1) permits estimation of the rate of change in the 18S rRNA molecule. Al though the fossil record for brachyurans extends back at least 200 MY to the Lower Jurassic and reveals significant diversity by the Cretaceous, roughly 150 MY A, detailed comparisons of familial appearances are difficult because the tax-onomic limits of many families of crabs are poorly understood (Guinot, 1979; Rice, 1980). Two of the families of crabs we examined (Leucosiidae and Cancridae) have fossil records that began during the Eocene, about 50 MYA. The pairwise divergence between these families is 1.3% (I. subglobsa vs. Cancer irroratus-, Table 3), indicating a substitution rate of 1.3%/50 MY. The Cretaceous record of crabs (Glaessner, 1969; Wright and Collins, 1972; Bishop, 1986; Schram, 1986) is not as clear with respect to the taxa studied here. Raninids (group IIIB, Table 3) are well represented, and there are records of xanthids and ca-lappids (groups IIIF and IIIC, respectively), but the Cretaceous record of majids (group HID, Table 3) is questionable. Inclusion of calappids and xanthids is somewhat problematic because the limits of these families are particularly poorly defined (Guinot, 1966-1967; Martin, 1988). Nonetheless, an average divergence of 2.4% (SE = 0.31) between the Cretaceous families mentioned above (excluding the poorly represented Majidae) yields a substitution rate of 0.8%/ 50 MY. The crayfish Procambarus leonensis and another reptant, the spiny lobster Pan-ulirus argus (unpublished sequence data),

belong to families that occurred 200 MYA in the Jurassic. A sequence divergence of 2.9% between these two taxa results in a substitution rate of about 0.7%/50 MY. Abele et al. (1989) estimated a higher rate of 1.9%/50 MY for the crustacean taxa Pen-tastomida and Branchiura on the basis of a divergence estimated to have occurred 287 ± 62 MYA. Recent fossil evidence suggests, however, that pentastomes were present dur ing the Lower Ordovician (Andres, 1989), which would reduce their estimate to about l%/50 MY. These estimates, which are consistent with those of Ochman and Wilson (1987) for other small-subunit ribosomal RNAs, suggest that 18S rRNA and rDNA sequences are extremely conserved and may be of limited use in resolving brachyuran lineages with post-Cretaceous divergences. Recognizing that the majority of extant crabs are from taxa that underwent an explosive and extremely rapid radiation within the past 50 MY, we caution against using such data to make strong inferences regarding relationships among these taxa.

6. The results of molecular, sipermatozoan, and larval studies are consistent with one another.—These diverse approaches to extracting phylogenetic information from a group of organisms exhibiting convergence on the scale seen among brachyuran crustaceans have produced highly concordant findings that at long last are beginning to resolve many contentious issues in brachyuran systematics. In light of these corroborative findings, we propose (1) abandoning the taxon Podotremata proposed by Guinot (1977) to accommodate the Dromia-cea and Archaeobrachyura because it groups organisms according to grade of evolution rather than common ancestry (see Guinot, 1978); (2) setting the lower limit of the Brachyura at the base of the branch that unites the section Gymnople-ura (Bourne, 1922; as represented here by the family Raninidae) with its sister group; and (3) excluding the family Dromiidae from the Brachyura and placing it within the infraorder Anomura. Additional studies of spermatozoa, larvae, and ribosomal sequences are needed to reinforce our pre-


liminary conclusion of extensive divergence within the Dromiidae and to complete the systematic classification of this and other dromiacean taxa (e.g., Dyno-menidae and Homolodromiidae). Also, whether or not the Archaeobrachyura (e.g., families Homolidae, Latreilliidae, Tymo-lidae, and Raninidae) of Guinot (1977) is monophyletic will have to await further data.

ACKNOWLEDGMENTS

We thank Marcia Applegate, Daniele Guinot, Joel Martin, Michael Miyamoto, Anne Thistle, Austin Williams, and three anonymous reviewers for thoughtfully reading an earlier draft of this manuscript and for their many valuable comments. We also thank William Herrnkind and Bruce Felgenhauer for providing some of the specimens used in this study and Robert H. Reeves for technical advice. A computer program for counting nucleotide substitutions written by Michelle Taylor at FSU saved us a great deal of time and effort, as did the word-processing skills of Travis Boline. We owe a special debt to F. Spears. This work was supported by NSF grant numbers BSR8717169 and BSR8822540 to L.G.A.

REFERENCES

ABELE, L. G., AND W. KIM. 1989. The decapod crustaceans of the Panama Canal. Smithson. Contrib. Zool. No. 482.

ABELE, L. G., W. KIM, AND B. E. FELGENHAUER. 1989. Molecular evidence for inclusion of the phylum Pehtastomida in the Crustacea. Mol. Biol. Evol. 6:685-691.

ANDRES, D. 1989. Phosphatisierte fossilien aus dem uteren Ordoviz von Siidschweden Vorlaufige Mit-teilung. Berl. Geowiss. Abh. A 106:9-19.

BISHOP, G. A. 1986. Occurrence, preservation, and biogeography of the Cretaceous crabs of North America. Pages 111-142 in Crustacean biogeography (K. L. Heck, Jr. and R. H. Gore, eds.), Crustacean issues, Volume 4 (F. R. Schram, gen. ed.). Balkema, Rotterdam, The Netherlands.

B O A S J . E . V . 1880. Studier over Decapodernes Slaeg-tskabsforhold. Vidensk. Selsk. Skr. Ser. 6 1:25-210.

BORRADAILE, L. A. 1907. On the classification of the Decapoda. Ann. Mag. Nat. Hist. Ser. 7 19:457-486.

BOURNE, G. C. 1922. The Raninidae: A study in car-cinology. J. Linn. Soc. Lond. Zool. 35:25-79.

BOUVIER, E.-L. 1896. Sur l'origine homarienne des crabes: Etude comparative des Dromiaces vivants et fossiles. Bull. Soc. Philomath. Paris Ser. 8 8:34-110.

BOUVIER, E.-L. 1940. Decapodes marcheurs. Faune Fr. 37:1-404.

BOWMAN, T. E., AND L. G. ABELE. 1982. Classification of the Recent Crustacea. Pages 1-27 in Systematics, the fossil record, and biogeography (L. G. Abele,

ed.), The biology of Crustacea, Volume 1 (D. E. Bliss, gen. ed.). Academic Press, New York.

BOYDEN, A. A. 1926. The precipitin reaction in the study of animal relationships. Biol. Bull. 50:73-107.

BOYDEN, A. A. 1939. Serological study of the relationships of some common Invertebrata. Pages 219-220 in Annual report of the Tortugas Laboratory. Carnegie Inst. Washington Year Book No. 38.

BROWN, W. M., E. M. PRAGER, A. WANG, AND A. C.

WILSON. 1982. Mitochondrial DNA sequences of primates: Tempo and mode of evolution. J. Mol. Evol. 18:225-239.

BURKENROAD, M. D. 1981. The higher taxonomy and evolution of Decapoda (Crustacea). Trans. San Diego Soc. Nat. Hist. 19:251-268.

CAROTHERS, A. M., G. URLAUB, J. MUCHA, D. GRUNBER-

GER, AND L. A. CHASIN. 1989. Point mutation analysis in a mammalian gene: Rapid preparation of total RNA, PCR amplification of cDNA, and Taq sequencing by a novel method. BioTechniques 7:494-499.

DANA, J. D. 1852. Crustacea. United States exploring expedition during the years 1838,1839,1840,1841, 1842 under the command of Charles Wilkes, U.S.N. 13:1-1620.

FARRIS, J. S. 1989. The retention index and the re-scaled consistency index. Cladistics 5:417-419.

FELDER, D. L., J. W. MARTIN, AND J. W. GOY. 1985.

Patterns in early postlarval development of decapods. Pages 163-226 in Larval growth (A. M. Wen-ner, ed.), Crustacean issues, Volume 2 (F. R. Schram, gen. ed.). Balkema, Rotterdam, The Netherlands.

FELDMANN, R. M. 1981. Paleobiogeography of North American lobsters and shrimps (Crustacea, Decapoda). Geobios 14:449-468.

FELSENSTEIN, J. 1978. Cases in which parsimony or compatibility methods will be positively misleading. Syst. Zool. 27:401-410.

FELSENSTEIN, J. 1985. Confidence limits on phylog-enies: An approach using the bootstrap. Evolution 39:783-791.

GARTH, J. S. 1939. New Brachyuran crabs from the Galapagos Islands. Univ. South. Calif. Publ. (Allan Hancock Pacific Expeditions) 5(2): 1-638.

GLAESSNER, M. F. 1969. Decapoda. Pages R339-R533 in Treatise on invertebrate palaeontology, Part R, Arthropoda 4, Volume II (R. C. Moore, ed.). Geological Society of America, Boulder, Colorado, and Univ. Kansas Press, Lawrence.

GORDON, I. 1963. On the relationship of the Dro-miacea, Tymolinae and Raninidae to the Brachyura. Pages 51-57 in Phylogeny and evolution of Crustacea (H. B. Whittington and W. D. I. Rolfe, eds.). Museum of Comparative Zoology, Harvard Univ., Cambridge, Massachusetts.

GUINOT, D. 1966-1967. Recherches preliminaires sur les groupements naturels chez les Crustaces Decapodes Brachyoures. I. Les affinites des genres Aethra, Osachila, Hepatus, Hepatella et Actaeomorpha. Bull. Mus. Natl. Hist. Nat. Ser. 2 38:744-762, 828-845.

GUINOT, D. 1977. Propositions pour une nouvelle classification des Crustaces Decapodes Brachy-


oures. C. R. Hebd. Seances Acad. Sci. Ser. D 285: 1049-1052.

GUINOT, D. 1978. Principes d'une classification evolutive des Crustaces Decapodes Brachyoures. Bull. Biol. Fr. Belg. 112:211-292.

GUINOT, D. 1979. Morphology et phylogenese des brachyoures. Mem. Mus. Natl. Hist. Nat. Ser. A 112: 1-354.

GURNEY, R. 1942. Larvae of decapod Crustacea. Ray Society, London.

GUTELL, R. R., B. WEISER, C. R. WOESE, AND H. F. NOLLER. 1985. Comparative anatomy of 16-S-like ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. 32:155-216.

HAAN, W. DE. 1833-1849. Crustacea. Pages 1-243 in Fauna Japonica (P. F. von Siebold, ed.). Lugdunum Batavorum.

HART, J. F. L. 1982. Crabs and their relatives of British Columbia. Br. Columbia Prov. Mus. Handb. No. 40.

HENDERSON, J. R. 1888. Report on the Anomura collected by H.M.S. Challenger during the years 1873-1876. Rep. Sci. Res. Explor. Voyage H.M.S. Challenger, Zool. 27(1):1-221.

HOLTHUIS, L. B. 1955. The recent genera of caridean and stenopodidean shrimps (class Crustacea, order Decapoda, supersection Natantia) with keys for their determination. Zool. Verh. (Leiden) 26:1-157.

JAMIESON, B. G. M. 1989. Ultrastructural comparison of the spermatozoa of Ranina ranina (Oxystomata) and of other crabs exemplified by Portunus pelagicus (Brachygnatha) (Crustacea, Brachyura). Zoomor-phology 109:103-111.

JAMIESON, B. G. M. 1990. The ultrastructure of the spermatozoa of Petalomera lateralis (Gray) (Crustacea, Brachyura, Dromiacea) and its phylogenetic significance. Invertebr. Reprod. Dev. 17:39-45.

JUKES, T. H., AND C. R. CANTOR. 1969. Evolution of protein molecules. Pages 21-132 in Mammalian protein metabolism (H. N. Munro, ed.). Academic Press, New York.

KIM, W., AND L. G. ABELE. 1990. Molecular phylog-eny of some decapod crustaceans based on 18S rRNA nucleotide sequences. J. Crustacean Biol. 10:1-13.

KIRCHER, A. B. 1970. The zoeal stages and glaucothoe of Hypoconcha arcuata Stimpson (Decapoda: Dromii-dae) reared in the laboratory. Bull. Mar. Sci. 20:769-792.

KLUGE, A. G., AND J. S. FARRIS. 1969. Quantitative phyletics and the evolution of anurans. Syst. Zool. 18:1-32.

KRAUS, F., AND M. M. MIYAMOTO. 1991. Rapid clado-genesis among the pecoran ruminants: Evidence from mitochondrial DNA sequences. Syst. Zool. 40: 117-130.

LANE, D. J., B. PACE, G. J. OLSEN, D. A. STAHL, M. L. SOGIN, AND N. R. PACE. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA 82:6955-6959.

LEBOUR, M. V. 1934. The life history of Dromia vulgaris. Proc. Zool. Soc. Lond. 1934:241-249.

LEONE, C. A. 1949. Comparative serology of some brachyuran Crustacea and studies in hemocyanin correspondence. Biol. Bull. 97:273-286.

LEONE, C. A. 1954. Further serological data on the relationships of some decapod Crustacea. Evolution 8:192-205.

MARTIN, J. W. 1988. Phylogenetic significance of the brachyuran megalopa: Evidence from the Xanthi-dae. Symp. Zool. Soc. Lond. 59:69-102.

MARTIN, J. W. 1991. Crabs of the family Homolodro-miidae, III. First record of the larvae. J. Crustacean Biol. 11:156-161.

MIERS, E. J. 1886. Report on the Brachyura collected by H.M.S. Challenger during the years 1873-1876. Rep. Sci. Res. Explor. Voyage H.M.S. Challenger, Zool. 17(2):l-362.

MILNE EDWARDS, H. 1834-1840. Histoire naturelle des Crustaces, comprenant l'anatomie, la physio-logie et la classification de ces animaux, Volumes 1-3. Librairie Encyclopedique de Roret, Paris.

MIYAMOTO, M. M., AND S. M. BOYLE. 1989. The po

tential importance of mitochondrial DNA sequence data to eutherian mammal phylogeny. Pages 437-450 in The hierarchy of life: Molecules and morphology in phylogenetic analysis (B. Fernholm, K. Bremer, and H. Jornvall, eds.). Elsevier, Amsterdam.

MIYAMOTO, M. M., S. M. TANHAUSER, AND P. J. LAIPIS.

1989. Systematic relationships in the artiodactyl tribe Bovini (family Bovidae), as determined from mitochondrial DNA sequences. Syst. Zool. 38:342-349.

NELLES, L., B.-L. FANG, G. VOLCKAERT, A. VANDEN-

BERGHE, AND R. DE WACHTER. 1984. Nucleotide

sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs. Nucleic Acids Res. 12:8749-8768.

NUTTALL, G. H. F. 1904. Blood immunity and blood relationship. Cambridge Univ. Press, Cambridge, England.

OCHMAN, H., AND A. C. WILSON. 1987. Evolution in

bacteria: Evidence for a universal substitution rate in cellular genomes. J. Mol. Evol. 26:74-86.

ORTMANN, A. E. 1896. Das System der Decapoden-Krebse. Zool. Jahrb. Syst. 9:409-453.

PEARSON, W. R., AND D. J. LIPMAN. 1988. Improved

tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448.

QUEEN, C , AND L. KORN. 1988. Microgenie® se

quence analysis program, version 6.0. Computer program distributed by Beckman Instruments, Palo Alto, California.

RABALAIS, N. N., AND R. H. GORE. 1985. Abbreviated

development in decapods. Pages 67-126 in Larval growth (A. M. Wenner, ed.), Crustacean issues, Volume 2 (F. R. Schram, gen. ed.). Balkema, Rotterdam, The Netherlands.

RATHBUN, M. J. 1925. The spider crabs of America. U.S. Natl. Mus. Bull. No. 129.

RATHBUN, M. J. 1933. Scientific survey of Porto Rico and the Virgin Islands, Volume XV, Part 1. Brachyuran crabs of Porto Rico and the Virgin Islands. New York Academy of Sciences, New York.

RATHBUN, M. J. 1937. The oxystomatous and allied crabs of America. U.S. Natl. Mus. Bull. No. 166.

RICE, A. L. 1980. Crab zoeal morphology and its


bearing on the classification of the Brachyura. Trans. Zool. Soc. Lond. 35:271-424.

RICE, A. L. 1983. Zoeal evidence for brachyuran phy-logeny. Pages 313-339 in Crustacean phylogeny (F. R. Schram, ed.), Crustacean issues, Volume 1 (F. R. Schram, gen. ed.). Balkema, Rotterdam, The Netherlands.

RICE, A. L., AND A. J. PROVENZANO. 1966. The larval development of the West Indian sponge crab Dromi-dia antillensis (Decapoda: Dromiidae). J. Zool. 149: 297-319.

SAIKI, R., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, R. HIGUCHI, G. T. HORN, K. B, MULLIS, AND H. A. ER-LICH. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.

SAINT LAURENT, M. DE. 1980a. Sur la classification et la phylogenie des Crustaces Decapodes Brachy-oures. I. Podotremata Guinot, 1977, et Eubrachyura sect. nov. C. R. Hebd. Seances Acad. Sci. Ser. D 290: 1265-1268.

SAINT LAURENT, M. DE. 1980b. Sur la classification et la phylogenie des Crustaces Decapodes Brachy-oures. II. Heterotremata et Thoracotremata Guinot, 1977. C. R. Hebd. Seances Acad. Sci. Ser. D 290: 1317-1320.

SANGER, F., S. NICKLEN, AND A. R. COULSON. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5436-5467.

SCHRAM, F. R. 1982. The fossil record and evolution of Crustacea. Pages 94-147 in Systematics, the fossil record, and biogeography (L. G. Abele, ed.), The biology of Crustacea, Volume 1 (D. E. Bliss, gen. ed.). Academic Press, New York.

SCHRAM, F. R. 1986. Crustacea. Oxford Univ. Press, New York. >

SCHRAM, F. R., AND R. H. MAPES. 1984. Imocaris tuber-culata, n. gen., n. sp. (Crustacea: Decapoda) from the Upper Mississippian Imo Formation, Arkansas. Trans. San Diego Soc. Nat. Hist. 20:165-168.

SMITH, S. I. 1886. XXI. Report of the decapod Crustacea of the "Albatross" dredgings off the east coast of the United States during the summer and autumn of 1884. Pages 605-705 [1-101] (22 plates) in United States Commission of Fish and Fisheries, Part XIII. Report of the Commissioner for 1885. Government Printing Office, Washington, D.C.

STEVCIC, Z. 1971. The main features of brachyuran evolution. Syst. Zool. 20:311-340.

STEVCIC, Z. 1973. The systematic position of the family Raninidae. Syst. Zool. 22:625-632.

SWOFFORD, D. L. 1990. PAUP: Phylogenetic analysis using parsimony, version 3.0s. Computer program distributed by the Illinois Natural History Survey, Champaign.

SWOFFORD, D. L., AND G. OLSEN. 1990. Phylogeny reconstruction. Pages 411-501 in Molecular systematics (D. M. Hillis and C. Moritz, eds.). Sinauer, Sunderland, Massachusetts.

VAN DOVER, C. L., J. R. FACTOR, AND R. H. GORE. 1982. Developmental patterns of larval scaphognathites: An aid to the classification of anomuran and brachyuran Crustacea. J. Crustacean Biol. 2:48-53.

VAUGHN, J. C , AND F. J. TRAEGER. 1976. Conservation of repeated DNA base sequences in the Crustacea: A molecular approach to decapod phylogeny. J. Mol. Evol. 7:111-131.

WILLIAMS, A. B. 1965. Marine decapod crustaceans of the Carolinas. Fishery Bull. 65(l):l-298.

WILLIAMSON, D. I. 1965. Some larval stages of three Australian crabs belonging to the families Homo-lidae and Raninidae, and observations on the affinities of these families (Crustacea, Decapoda). Aust. J. Mar. Freshwater Res. 16:369-398.

WILLIAMSON, D. I. 1976. Larval characters and the origin of crabs. Thalassia Jugosl. 10:401-414.

WILLIAMSON, D. I. 1982. Larval mophology and diversity. Pages 43-110 in Embryology, morphology, and genetics (L. G. Abele, ed.), The biology of Crustacea, Volume 2 (D. E. Bliss, gen. ed.). Academic Press, New York.

WILLIAMSON, D. I. 1988a. Evolutionary trends in larval form. Symp. Zool. Soc. Lond. 59:11-25.

WILLIAMSON, D. I. 1988b. Incongruous larvae and the origin of some invertebrate life-histories. Prog. Oceanogr. 19:87-116.

WOESE, C. R. 1987. Macroevolution in the microscopic world. Pages 176-202 in Molecules and morphology in evolution: Conflict or compromise? (C. Patterson, ed.). Cambridge Univ. Press, Cambridge, England.

WRIGHT, C. W., AND J. S. H. COLLINS. 1972. British Cretaceous crabs. Palaeontogr. Soc. Monogr. (Lond.) 533:1-114.

Received 29 October 1991; accepted 18 March 1992

The Monophyly of Brachyuran Crabs: A Phylogenetic Study ...questions of crustacean phylogeny. Sero...

Documents

Transcript of The Monophyly of Brachyuran Crabs: A Phylogenetic Study ...questions of crustacean phylogeny. Sero...