the molecules of life - NLT · The module The Molecules of Life was developed for the Dutch...

The Molecules of Life

Cystic Fybrosis unraveled on the molecular level

English edition 1.0

On the cover:

Waltz of the polypeptides

Installation by Mara Haseltine, 2006

for Cold Spring Harbor Laboratory

Photo Courtesy Stan Grandstein

Colophon

The module The Molecules of Life was developed for the Dutch ‘Nature Life and Technology’ curriculum, an advanced integrated science subject for senior secondary school. It can also be used for classes on the subjects of Biology and Chemistry. The module was certified on June 12, 2008 by the focus group NLT, specifically for usage in domain E (biophysics, biochemistry and bioinformatics). The certificate number is X204-039-VE. The original certified module (in Dutch) can be downloaded in pdf-format at http://www.betasteunpunt-utrecht.nl.

This module was designed by order of the Junior College Utrecht (www.uu.nl/jcu), and developed by a team lead by Ir. Marc van Mil (module coordinator).

The following people have contributed to this module:

Utrecht University, faculty of Science, department of Biology o dr. ir. A.F.M. Cremers

Cancer Genomics Centre, UMC Utrecht o ir. M.H.W. van Mil, Module Coordinator

Utrecht University, Junior College Utrecht o dr. A.E. van der Valk (Curriculum Coordinator) o Mrs. C. Francissen, M. Koren, Mrs. E. Staring (biology teachers) o T. Bogaers, H. Hummelen (chemistry teachers) o T. Quax; P. Krijgsheld, E. van der Vlist, S. de Jong (student assistants) o Mrs. S.H. Klaasing (layout) o K.J. Kieviet Msc (layout and editing supervisor)

JCU Partner Schools o Stedelijk Gymnasium Johan van Oldenbarnevelt, Amersfoort: G. de Kort o Leidsche Rijn College, Utrecht: P. Verkaaik, Mrs. C. Kleijer o Het Nieuwe Lyceum, Bilthoven: Mrs. M de Wekker-Smeets, B. Lefeber

Translation by B.L. van Albada BA.

The following license applies to this module: Attribution-NonCommercial-ShareAlike 3.0 Netherlands. http://creativecommons.org/licenses/by-nc-sa/3.0/nl/deed.en

Copyright on this module remains with Utrecht University and the Junior College Utrecht, P.O. box 80 000, 3508TA Utrecht, The Netherlands.

For this module a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License applies http://creativecommons.org/licenses/by-nc-sa/3.0/

Altered versions of this module may only be distributed if the fact that this is an altered version is clearly stated in the module, along with the name of the authors who made the modifications.

When developing this module, the authors have used material provided by third parties. In these cases, sources are mentioned where possible. Unless noted otherwise, these materials were released under a similar (or broader) license. If you somehow find materials inside this module where license, source material or both are not given properly, we request you contact the Junior College Utrecht.

This module was assembled with utmost care and precision. Utrecht University will not accept responsibility for any sort of damages resulting from (the usage of) this Guide.

English edition 1.0, 2011

Images used courtesy of Cell Biology Interactive for Molecular Biology of the Cell, 4th Edition. Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts, Peter Walter. Copyright © 2002 by Garland Science Publishing. Intended Use. All rights reserved. The contents, or parts thereof, may be reproduced for course and teaching use by any of the following means-printing of slides and transparencies or photocopying for course packages that are not offered for sale to the general public, or for display on a school Intranet site that is not accessible to the general World Wide Web public. Any other use requires prior written permission from the publisher.

The complete contents of Cell Biology, including images, can be accessed free of charge via the American National Center for Biotechnology Information (NCBI):

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.TOC&depth=2

http://www.betasteunpunt-utrecht.nl/

http://www.uu.nl/jcu

http://creativecommons.org/licenses/by-nc-sa/3.0/nl/deed.en

http://creativecommons.org/licenses/by-nc-sa/3.0/

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.TOC&depth=2

The Molecules of Life Contents

Contents Introduction 3

Cystic Fibrosis 5

Chapter 1. Where does it go wrong inside a CF-patient? 7

1.1 Organisation levels 7

1.2 The cell as a biochemical factory 7

1.3 Summary 7

1.4 Answer the CF-question using the sub-questions 8

Chapter 2. What causes a CF-patient to produce thick mucus? 9

2.1 The function of Proteins 9

2.2 Summary 11

2.3 What problem causes CF? 11

2.4 Answer the CF-question using the sub-questions 11

Chapter 3. What causes faulty chloride pumps to be built? 12

3.1 Gene > Protein > Function 12

3.2 The structure of DNA 13

3.3 The genome: the total DNA in a cell 15

3.4 Summary 15

3.5 Answer the CF-question 15

Chapter 4. How are faulty blueprints passed on? 16

4.1 DNA replication 16


Chapter 5. How does DNA mutation cause faulty ion pumps? 18

5.1 Transcription, from DNA to mRNA 18

5.2 RNA processing, modifying the RNA inside the nucleus 20

5.3 Translation, from mRNA to protein 21

5.4 Conclusion 23

5.5 Mutations 23


Chapter 6. Why isn’t the mutation expressed in every cell? 24

6.1 Gene regulation 24

1

Contents The Molecules of Life

2


Chapter 7. How does a chloride ion pump work? 26

7.1 Proteins 26

7.2 Amino acids 26

7.3 Linking amino acids 27

7.4 The structure of proteins 28

7.5 Enzymes 30

7.6 Influencing enzyme activity 31


Chapter 8. Why are the chloride ion pumps missing? 33

8.1 The teamwork of cell processes 33

8.2 Expert assignment 33

8.3 Answer the CF-question using the sub-question 33

Appendix A: Poster assignment 34

What is the poster assignment made up of? 34

The purpose of the poster assignment: 34

A thorough literature study 34

Possibilities 35

Grading the posters 35

Appendix B: Expert assignment Cystic Fibrosis 36

Introduction 36

Available sources 36

Execution 37

Appendix C: Final assignment Cystic Fibrosis 39

Appendix D: Starting assignment 40

Appendix E: Practice questions DNA 43

Appendix F: Practice questions proteins and enzymes 48

The Molecules of Life Introduction

Introduction

The Molecules of Life? The cell is alive... but it is made up of lifeless molecules. The combination of the right molecules in the right place creates a balanced system that is self-preserving and able to multiply: a living cell.

In this module you will study the smallest living unit, the cell. How do the ‘molecules of life’ ensure that a cell functions properly? What would the consequence be of molecules inside the cell malfunctioning? Molecular biologists and biochemists study the processes inside living cells on the smallest functional level, that of molecules.

Molecule malfunction inside a cell can have an enormous impact on the entire organism. Molecular defects lie at the heart of many ailments and diseases in the human body. To understand, cure and prevent diseases it is crucial to understand these defects on a molecular level. In recent years, enormous progress has been made in this field, due in part to new techniques that enable studying of DNA, RNA and proteins in both human cells and cells of other organisms.

But… will we ever discover precisely how a living cell works? And even if we do, will we understand how an organism, composed of billions of cells, functions? New research is published every day, but there is a lot still left to discover.

Cystic Fibrosis: an example of a molecular mistake in the human body In the module, the disease Cystic Fibrosis will serve as an example. Nowadays, we have a reasonable understanding of how one change in the genetic code can have disastrous results in the body of a patient. By using this disease as a model, you will encounter all fundamental molecular processes inside a cell. When you understand these processes, you can apply this knowledge to your understanding of other diseases on a molecular level.

The main question The main question of The Molecules of Life is

How do macromolecules inside a cell work and how can we use our knowledge of them to understand diseases and attempt to find cures?

Design of the module The concepts needed to understand the functioning of a cell on the molecular level are learnt by examining Cystic Fibrosis, also known as CF or mucoviscidosis. The title of every chapter consists of a question about Cystic Fibrosis. If you have mastered the contents of a chapter, you should be able to answer the ‘CF-question.’

The goal of this module is that you, by using CF as a model, discover how the molecules inside a living cell function. Every chapter will contain part of the theory behind these mechanisms.

3

Introduction The Molecules of Life

As you learn more about the subject matter, you will gather in groups of three to choose a subject that you will investigate further. The goal is to discover how your ‘subject’ functions on a molecular level. You will present your findings using a poster. For this assignment, you will apply the knowledge you have acquired to a subject of your choosing.

In groups of three, you will choose a topic that you will investigate further. The goal is to discover how your ‘topic’ functions on a molecular level. You will present your findings using a poster. For this assignment, you will apply the knowledge you have acquired to a subject of your choice.

4

The Molecules of Life Cystic Fibrosis

Cystic Fibrosis

How one mutation in the genetic code can have disastrous results In an episode of the Dutch television show ‘Je zal het maar hebben!’ (‘Imagine dealing with that!’), we meet Eline. She tells us about her life, and how it is influenced by Cystic Fibrosis. Despite the fact that all of the treatments she has to undergo and all of the medicine she has to take actively improve – and hopefully prolong – her life, they will not cure her.

In this module you will attempt to discover the molecular cause of Cystic Fibrosis. To fully understand the cause and effects of CF, you first have to understand how cells function on a molecular level; or, to put it differently: discover how these ‘molecules of life’ work. When you have mastered these concepts, you will also be able to understand the molecular mechanisms behind a host of other diseases, ailments and pharmaceutical drugs. Cystic Fibrosis will serve as a model to help you master the basic concepts; afterwards, you will use these concepts to examine other diseases or drugs more thoroughly during the poster assignment.

The module’s first question is:

What is the cause of Cystic Fibrosis?

The question you should be able to answer at the end of this module is

What could be a possible strategy for curing CF?

Each individual chapter will start with a question about Cystic Fibrosis. To clarify that the subject matter is not just solely applicable to CF, the CF-question will be used as a baseline for a more general question before the theoretical part of the chapter begins.

The final assignment is: produce a number of strategies that could lead to a cure for CF.

Questions to answer this question 1. Where does it go wrong inside a CF-patient? 2. What causes a CF-patient to produce thick mucus? 3. What causes faulty pumps to be built? 4. How can a mutation be passed on? 5. From DNA-mutation to faulty ion pumps: how? 6. Why does the mutation only influence some cell types? 7. How does a chloride-ion pump work? 8. Why are chloride-ion pumps missing?

5

Cystic Fibrosis The Molecules of Life

A congenital mistake

Via the following link, you can watch the episode of ‘Je zal het maar hebben’ where Eline talks about her disease (in Dutch).

Season 6 Episode 1 on Monday January 1 2007: Eline: Cystic Fibrosis

Watch the relevant part of the episode, starting 20 minutes and ending at 32 minutes.

http://sites.bnn.nl/page/jzhmh2010/archief/69279/

Eline has Cystic Fibrosis, also known as CF. In this module you will examine the cause of this disease on a molecular level. This means that in order to learn about molecules you will delve into the cells of a CF-patient’s body. When you understand the processes that should be taking place in a healthy cell, you can work out what goes wrong in the cells of a CF-patient. As a final assignment for this module, you will have to propose a possible strategy that could lead to a cure for Cystic Fibrosis.

Cystic Fibrosis will be the model disease for this module. The goal is that by using CF as an example you will discover how the molecules inside a living cell function – and what could be the consequences of them not functioning.

6

The Molecules of Life Chapter 1. Where does it go wrong inside a CF-patient?

Chapter 1. Where does it go wrong inside a CF-patient?

1.1 Organisation levels To find the cause of CF, you have to go down to the molecular level in the body’s cells.

Question 1-1 Where in the body do problems occur? Answer the following four questions using the doctor’s explanation featured in the video about Eline. a. Body: what signs might a patient have that indicates they could have CF? b. Organs: what organs are affected by CF? c. Tissue: in what organ tissue do the problems occur? d. Cells: what purpose do the cells inside this tissue serve?

1.2 The cell as a biochemical factory To understand CF you will study a specific type of cell. However, there is a wealth of other cell types inside the human body, each of them with a specific task and corresponding design. This means that different types of cells must have different types of macromolecules at their disposal to correctly carry out their tasks.

This is why the general question you have to answer in this chapter is:

What happens inside a cell?

Question 1-2 Different cell types have different tasks a. Name five different types of cells b. Name the task(s) of these cell types c. Describe what has to happen inside these cells in order for them to carry out their task(s).

You will see that to be able to answer the last question, you will already have to think about how a cell’s task could be carried out by molecules.

To complete the above assignment, you have to know what goes on inside a cell to be able to explain how a cell is capable of carrying out its tasks. The following animation shows you what happens inside a cell – in this case, a white blood cell is being transported through a blood vessel. When the cell touches an inflamed spot, it changes form and crawls through the vessel walls towards the inflammation. The processes that take place inside the white blood cell to accomplish this are shown in the animation.

Question 1-3 The inner life of the cell Watch ‘The inner life of the cell’ video online. The video attempts to portray what is actually going on inside a cell. Name three things you see in the movie that should be different in reality. http://www.youtube.com/watch?v=Mszlckmc4Hw

1.3 Summary The cell is a biochemical factory Molecules are built up and broken down Molecules are transported

7

Chapter 1. Where does it go wrong inside a CF-patient? The Molecules of Life

Signals are converted into actions Every process in the cell is caused by the interaction of molecules. Proteins are the ‘molecular machines’ involved in all cell processes! The code for these proteins is in the DNA!

1.4 Answer the CF-question using the sub-questions

Where does it go wrong inside a CF-patient?

What organs are affected?

What cells are affected?

8

The Molecules of Life Chapter 2. What causes a CF-patient to produce thick mucus?

Chapter 2. What causes a CF-patient to produce thick mucus? In the previous chapter, you learnt that CF-patients have problems with their lungs, intestines and pancreas. The cause of these problems seems to lie with the mucus-producing cells. These cells, which can be found in the lungs, intestines and pancreas, do not function properly. They produce inadequate amounts of mucus as well as sticky, thick mucus.

To understand precisely where the problem lies, we need to answer the following question: how does a healthy cell inside the lungs produce mucus? However, before we can answer that question we have to answer a much more general one.

Many different tasks have to be carried out inside a cell. You could compare a cell to a biochemical factory that builds and breaks down all sorts of molecules. The question we will answer in this chapter is:

How are different processes carried out inside a cell?

Nearly all of the processes inside a cell are performed by proteins. Here we will look at the different functions of proteins.

2.1 The function of Proteins Question 2-1: How do proteins carry out their tasks? a. In question 1-2 you described a number of cell tasks. Take another look at your group’s answers to this question. The tasks inside a cell are carried out by proteins. b. For every task you identify, try to understand how it is carried out by proteins.

In the theoretical explanation below, you will study the most important functions of proteins inside a cell. Examine the images and the text. Ask yourself the following questions: What is the function of these proteins inside a cell? What would happen if these proteins were missing? What would the consequences be for your cell(s)? And for your body?

9

Chapter 2. What causes a CF-patient to produce thick mucus? The Molecules of Life

10

Chapter 2. What causes a CF-patient to produce thick mucus? The Molecules of Life

10

The Molecules of Life Chapter 2. What causes a CF-patient to produce thick mucus?

2.2 Summary What are proteins used for?

Inside the membrane as receptors Inside the membrane as vessels Inside the membrane as pumps For transport and storage of small molecules inside the cell As a switch to turn genes on or off As a switch to turn other proteins on or off For transport inside the cell For rigidity and movement of the cell As a catalyst (enzyme) in chemical transformations

2.3 What problem causes CF? You now know the different functions of proteins, but we need to identify the fault in the proteins that causes the cells to produce a CF-patient’s characteristic thick mucus. We see from the overview of possible functions of proteins that proteins play a crucial role in the intake and secretion of substances (like nutrients and hormones, but also ions). For example, they function as the pumps that regulate transport of substances. The pumps play an important role in mucus-producing cells. Mucus consists of mostly water; to produce functioning and slippery mucus, mucus-producing cells must be able to secrete water. As you probably know, water can pass through cell membranes freely. There is a physical process that plays an important role in this: OSMOSIS

This process occurs because ions and large molecules of dissolved substances cannot pass through the cell membrane freely. The principle of osmosis can be summarised as follows: if there is a large concentration of dissolved substances (for example, ions) on one side of the cell membrane and a low concentration on the other, water molecules will travel through the membrane to the side that has the highest density of dissolved substances. On this side, because the concentration of dissolved substances is high, the concentration of water molecules is relatively low. The water molecules will therefore transport themselves to the side of the membrane that has the lowest level of water.

A mucus-producing cell uses this principle to pump out chloride-ions. Unlike osmosis, this pumping is an active process that requires energy be spent. As the concentration of chloride-ions outside the cell becomes higher than the concentration within, water moves through the cell membrane and exits the cell. Thus, by pumping out chloride-ions, the cell is able to excrete the water needed for slippery mucus inside the lungs.

To conclude: the crucial protein in mucus-producing cells is a chloride pump that pumps out chloride ions from the cell.

2.4 Answer the CF-question using the sub-questions

What causes a CF-patient to produce thick mucus?

What are the characteristics of healthy mucus?

What cells and what proteins play a part in producing mucus? How?

What are the characteristics of thick mucus?

11

Chapter 3. What causes faulty chloride pumps to be built? The Molecules of Life

Chapter 3. What causes faulty chloride pumps to be built? In the previous chapter, we determined that it is probable that the chloride pumps in a CF-patient’s mucus-producing cells do not function properly. What causes a cell to have these faulty pumps? Why are the wrong proteins built? What are the ‘blueprints’ for proteins, and how is this information stored? In other words: how is information about proteins coded? In this chapter we will answer this question.

How is information about proteins coded?

3.1 Gene > Protein > Function As you probably know, the blueprints for proteins are contained in the DNA (Deoxyribo Nucleic Acid) molecule. In this chapter, we will consider the structure and construction of DNA. The DNA molecule holds the universal code that can be used to produce every possible kind of protein. Because is is possible to produce all kinds of protein, this means that all different tasks inside a cell can be carried out.

Simply put, the concept is as follows: proteins are made by taking single building blocks, called amino acids, and linking them together. There are 20 different building blocks that can be used to produce protein. By combining these 20 different amino acids, a variety of different kinds of protein can be made. The question is how a cell ‘knows’ in what order amino acids need to be linked together in order to produce a certain kind of protein.

The blueprint of every protein is stored inside the DNA molecule, which is located inside the cell nucleus. The piece of DNA where the design for a protein is located is called a gene.

Question 3-1 Genes and proteins a. Write down five characteristics of your own body that are probably controlled by genes.

Name the corresponding genes. b. Next to every gene you wrote down for the previous question, write down the protein that

is coded by that gene (or could code for it). In other words, describe what task should be carried out to get the corresponding characteristic.

In the previous question, you have matched genes to the corresponding proteins. You can also work the other way around:

c. Write down the proteins you know, and write down the corresponding gene. For example: amylase amylase gene.

If you don’t remember any specific proteins, try to remember different purposes of proteins (see paragraph 2.1). Add these (for example: the gene for a hormone receptor) to the list of genes you already have.

There is a gene in the DNA for every protein you know. You can summarise this as follows:

Gene > Protein > Function

12

The Molecules of Life Chapter 3. What causes faulty chloride pumps to be built?

Alternatively, you can look at it in the following way: if there is something that needs to be done, the proteins do the job. For every protein, there is a gene in the DNA that contains the blueprint for this protein.

3.2 The structure of DNA The DNA molecule contains a code that can be used as a blueprint for proteins; it is similar to the way a file on a computer contains the code that is used to store a text or image file.

Unlike a computer, DNA does not contain a binary code, but instead uses a four-letter code that is composed of four different nitrogenous bases. These bases are linked by sugar and phosphate groups, like a daisy chain.

DNA contains the following bases:

A = Adenine

T = Thymine

G = Guanine

C = Cytosine

Question 3-2 Study the images below. Do you understand them? tion 3-2 Study the images below. Do you understand them?

13

Chapter 3. What causes faulty chloride pumps to be built? The Molecules of Life

Nucleotides can be connected to each other because the phosphate group of the fifth carbon atom can form an ester bond with the OH-group on the third carbon atom in another nucleotide. The figure explaining the carbon atoms’ numbering can be found in the below.

Every chain of nucleotides has a free OH-group on the third carbon atom on one end and a free phosphate group on the fifth carbon atom on the other end. The OH-end is called the 3’ OH end and the phosphate end is called the 5’ P end. Often, these abbreviations are further shortened to 3’ and 5’.

14

The Molecules of Life Chapter 3. What causes faulty chloride pumps to be built?

3.3 The genome: the total DNA in a cell Every cell in your body originates from a fertilised ovum. In every cell division, both daughter cells inherit a DNA packet that is identical to that of the original cell. This DNA packet is called the GENOME. The human genome contains approximately 21,000 genes. However, these genes make up only about 5 percent of all nucleotides. The different cells of your body all contain the same DNA. To make sure different genes are used within each cell, other parts of the cell have an important role to play. You will learn more about this in chapter six.

3.4 Summary How does a cell ‘know’ in what order amino acids need to be linked to get a certain kind of protein? This is coded in the corresponding gene. The gene contains the code, stored in long strings of nucleotides. Two nucleotides that are opposite each other are called base pairs. Thus, a part of a gene could look like this:

5’ ...TATAAACCTCGACAACCAATCGTAAAAACCACTGAAGATCT...3’ 3’ ...ATATTTGGAGCTGTTGGTTAGCATTTTTGGTGACTTCTAGA...5’

Some facts about the human genome

A human cell contains 3.2 × 109 base pairs – twice

The distance between two base pairs = 0.34 nm

The DNA in a single human cell, when stretched out, has a length of 2 metres.

Chromosomes are often pictured as in the picture on the left. However, chromosomes only manifest themselves in this extremely compact, rolled-up shape when the cell is preparing itself for cell division. If the cell is not at this stage, large pieces of DNA will not be not tightly lapped, and the nucleus will be practically filled with DNA. This allows the proteins that ‘read’ the DNA to bind to it.

You still do not know how to recognise a gene in a string of DNA (for example, where does a gene start and end?), or how a gene is turned into a protein. This will be covered in Chapter 5. However, based on what you now know, you can formulate a hypothesis as to why the body of a CF-patient does not produce properly functioning chloride pumps.

3.5 Answer the CF-question

Why do mucus-producing cells inside a CF-patient build faulty chloride pumps?

In your answer, use the following terms: DNA, protein, code, chloride pump, nucleus, blueprint.

15

Chapter 4. How are faulty blueprints passed on? The Molecules of Life

Chapter 4. How are faulty blueprints passed on? Whether or not someone will have CF, is determined before they are born. In Section 3.3 you learnt that all cells in a body contain the same DNA-packet: that person’s genome. This means that DNA mutation inside a fertilised ovum will be present in all cells that originate from that ovum.

Cystic Fibrosis is a hereditary disease. This means that the mutation in the associated gene is present in every single one of a patient’s cells. Even when new cells are made, and millions of new cells are produced every day, the mutation in the gene for chloride pumps will still be present.

Question 4-1 Where are cells made?

Name five places in an (adult) body where new cells are being produced continually.

Because every cell inherits the original DNA-packet, there has to be a mechanism inside the cell that copies the DNA before the cell is divided. The question we will answer is:

How is the information inside the DNA passed on to new cells?

The process where a copy is made of every original chromosome inside a cell is called DNA replication.

4.1 DNA replication Research in biochemistry and molecular biology has discovered what chemical processes take place inside a cell to copy the entire DNA-package. Enzymes catalyse the chemical reaction and thus play a crucial role. Study the figures below and answer the corresponding question to see if you understand the process of DNA replication.

Question 4-2 DNA replication A schematic overview of the principle of DNA replication is provided below. Write down, in two steps, what has to happen to turn one piece of double-stranded DNA into two identical pieces.

The basis of DNA replication is the taking apart of the two strands and building new nucleotides (A, T, C and G) on the two separate strands using the phenomenon known as base pairing. Thus, an A will always face a T and a C will always face a G.

However, the chemical structure of nucleotides means that new nucleotides can only be connected to the 3’ OH end of an already linked nucleotide.

This is because of the following chemical principle:

Solitary nucleotides are present inside the nucleus in a triphosphate form. For example, dATP: deoxyAdenosine TriPhosphate. Its three phosphate groups mean that the dATP molecule contains a lot of energy. This energy is used to bond to the free 3’ OH end of a nucleotide that has already been bonded. When this bond is established, two phosphate groups are removed and only one is

16

The Molecules of Life Chapter 4. How are faulty blueprints passed on?

bonded. Conclusion: the solitary nucleotide contains the energy needed for the bond in the form of two extra phosphate groups.

The bonding of single nucleotides to one that is already bonded is catalysed by the DNA polymerase enzyme.

deoxyAdenosine TriPhosphate (dATP)

An animation explaining the DNA replication process can be viewed at http://bit.ly/yFACx.


Why do all cells inside a CF patient have faulty blueprints for chloride pumps? How are the blueprints for these passed on?

In your answer, use the following terms: DNA replication, DNA polymerase, fertilised ovum, nucleotides, and base pairs.

17

Chapter 5. How does DNA mutation cause faulty ion pumps? The Molecules of Life

Chapter 5. How does DNA mutation cause faulty ion pumps? The faulty chloride pumps inside a CF patient are proteins. The blueprints for these proteins are stored in the corresponding gene. How does a mutation in the code (that is to say, inside the DNA), cause a defect in the protein?

Put into broader terms:

How is the information inside the DNA converted into proteins?

The transformation of a piece of DNA into a protein takes place in steps:

Step 1. A copy of the gene is made inside the nucleus. This process is called transcription.

Step 2. The transcription is read inside the cytoplasm causing the amino acids to be placed in the right order to make the protein. This process is called translation.

5.1 Transcription, from DNA to mRNA In chapter 3, you learnt that the code necessary for building a protein is stored in the corresponding gene. To turn a gene into a protein, that code will have to be read and translated in order to make a proper protein. In order to read the gene, a copy is made of it; this process is called transcription. You could view this transcript as a molecular copy of the gene, a copy of that piece of DNA. This copy is called messenger RNA, or mRNA. The building blocks of mRNA are comparable to that of DNA; however, there are some differences, which are outlined in the following figure.

In much the same way as the DNA is replicated, transcription pulls apart the DNA strands and couples new nucleotides to the ones already on the strand using base pairing. The enzyme used in transcription is called RNA polymerase. For an mRNA-transcript, only a single DNA strand needs to be copied. Which strand is read is determined by the location of the start and end of a gene. The start is indicated by the promoter; the end by the terminator. Both the start and the end of the gene is recognized by the RNA polymerase due to specific pieces of DNA.

Use the image on the next page to find and understand the steps outlined above.

18

The Molecules of Life Chapter 5. How does DNA mutation cause faulty ion pumps?

The RNA polymerase enzyme uses one of the dual DNA strands as a template for the mRNA code. On this strand, base pairing takes place between the new nucleotides being built into the mRNA and the nucleotides inside the DNA. This is why the strand used for base pairing is called the template strand.

There is no base pairing on the opposite strand. However, except for the fact that DNA contains a T and RNA contains a U, the code is identical to the code inside the mRNA. For this reason, this strand is called the coding strand because it contains the code as it will be in the mRNA strand.

What determines which strand becomes the template, and which one becomes the coding strand? This is differs gene by gene. One string can be coding for one gene, but it can act as the template for a gene a bit further on. The strand that will be the strand for coding is determined by the place of the promoter.

Genes are on both strands, thus RNA molecules are made of both of them.

The promoter is a piece of DNA that precedes the gene. One of its characteristics is the TATAA box. This is a code, made up of a number of adenosines and thymines, which lies on the coding strand. In eukaryotes, the starting point of transcription is approximately 35 nucleotides down the strand. In drawings, this nucleotide is indicated by +1. See also the figure on the next page. The end of transcription is indicated by the terminator sequence. This is a code in the DNA that is characterised by a number of guanines and cytosines in a specific order. When this terminator sequence is recognised, the RNA polymerase stops transcription and the mRNA is ready for further processing (see section 5.2).

19


Prokaryots are organisms without a nucleus.

Bacteria belong to this group.

Eukaryotes are organisms with a nucleus. These are among others animals (including humans), plants and fungi.

Summary:

The promoter is the location in the DNA where the RNA polymerase bonds; +1 indicates the base pair where RNA polymerase starts the transcription; In eukaryote cells, the TATAA box is at position -35, 35 base pairs before +1; The promoter is not copied into the mRNA.

5.2 RNA processing, modifying the RNA inside the nucleus In eukaryotes, the mRNA is not yet complete when RNA polymerase is finished transcribing. At this point, it is pre-mRNA. Three more processes take place inside the nucleus before the mRNA is finished:

The introns are removed. This is called RNA splicing. At the start of the mRNA (the 5’ end), a molecule is bonded that is called the 5’ cap. A string of adenines are attached to the end of the mRNA. This is called the poly(A) tail.

The functions of the cap and tail are

Checking whether the mRNA is finished. Recognition - the 5’ cap and poly(A) tail are recognised by the transporting mechanisms

that transport the mRNA from the nucleus. Protection - they protect the mRNA from degradation.

20


5.3 Translation, from mRNA to protein When a gene is transcribed into the mRNA form, the information inside the mRNA is used to build a protein. This process is called translation, and it requires the following parts:

The mRNA, as a source of information; Single amino acids, the building blocks for the protein; A translator that bonds the correct amino acids based on the RNA code. This is achieved by

the cooperation of the ribosome with transfer RNA molecules that each carry amino acids that link to the protein under construction. Among other things, the ribosome is built of RNA.

The key cipher needed to translate RNA code into the correct amino acid order is the same in every living cell. A combination of three nucleotides indicates what amino acid should be bonded. Every mRNA copy contains the code AUG, which is a start signal recognised by the ribosome. First, the amino acid methionine is incorporated. The three following nucleotides determine the next amino acid, and so on until the ribosome encounters a stop signal. The string of amino acids is then complete and it is released.

Question 5-1: Reading the genetic code ading the genetic code Look at the figure below and explain how you should read the table for the genetic code. Look at the figure below and explain how you should read the table for the genetic code.

21


The mRNA moves through the ribosome. When the ribosome encounters a start message, the first tRNA, containing the bases UAC, is bonded, and the first amino acid is incorporated (methionine).

A summary of the process of translation can be found on http://bit.ly/3nlEMu and http://bit.ly/YCTrF.

Question 5-2: Providing your own commentary a. First, study the animation at http://bit.ly/u3xjj or the three animations at http://bit.ly/tujw2

and make sure you understand them. Next, turn off the sound and provide your own commentary for the movie to a classmate or in front of the class.

b. Pay attention: the promoter and terminator determine where transcription starts and stops inside the DNA. This has NOTHING to do with the start and stop codons in the mRNA. The piece of DNA transcribed into mRNA is always bigger than the bit between start and stop codons.

Question 5-3 Build a gene In this assignment, you will create your own gene and see what protein is formed from it. The protein must contain seven amino acids. a Think of the nucleotide order of a piece of double stranded DNA that contains a start and a stop

codon. Include a promoter and a terminator in your DNA sequence.

b Write the mRNA sequence beneath the DNA.

5. Use the following sequence as a terminator on the coding strand: CTGGCGGC. Transcription stops 2 nucleotides after this sequence.

6. Pay attention: There is a string of random nucleotides after the start of transcription before the start codon. The same principle applies to the end of the gene. There is a series of random nucleotides between the stop codon and the terminator.

1. You will find the start codon ATG on the coding strand. 2. Use TAA as the stop codon on the coding strand. 3. Make sure there are six amino acids on the string between the start and stop codons. 4. Use the following sequence as a promoter on the coding strand: TAATAT. Transcription

starts 10 nucleotides after this sequence.

22


c Use arrows to indicate the beginning and ending of the translation process. d Describe the sequence of the amino acids that are coded into your gene.

5.4 Conclusion A gene can be read by making an mRNA copy. This is called transcription. The mRNA is read inside a ribosome, where the correct amino acids are bonded to each other using tRNA. By linking the correct amino acids, a protein is built to the exact specifications contained in the DNA.

5.5 Mutations The CF-question in this chapter is: How does a mutation inside the DNA cause faulty ion pumps?

In chapter 3, you established that faulty proteins can be made when something is wrong with the blueprint for that protein inside the DNA. Thus, a mutation inside the DNA can cause a faulty protein, or perhaps no protein at all to be built. A mistake in the DNA is known as a mutation.

Take a moment to think of what mutations could take place inside the DNA, and the possible consequences of these mutations.

There are two copies of every gene inside a cell – one from the male, and one from the female. Both genes are used inside a cell, so if one gene is faulty but the other one is not, the mistake-free gene will code for properly functioning proteins. So, in many cases, both genes have to be mutated in order to cause a faulty protein. This phenomenon plays a part in cystic fibrosis.

Question 5-4 What mutation is most common in CF patients? Find the mutation that is most common in CF patients on the Your Genes Your Health website (www.ygyh.org).

a. Compared to the correct mRNA sequence, what is the difference? b. Are proteins built? If yes, what are the differences compared to the regular CFTR protein?


How does a mutation inside the DNA cause faulty ion pumps?

Use a conceptual schema to answer this question.

23

Chapter 6. Why isn’t the mutation expressed in every cell? The Molecules of Life

Chapter 6. Why isn’t the mutation expressed in every cell? CF shows up in different parts of a patient’s body, in, for instance, their lungs, intestines and pancreas. Chapter 4 described how the gene that codes for chloride pumps must be present in every cell. This means that every cell contains the mutation. However, despite this, most of the body of a CF patient functions properly. The mutation only takes effect in some parts of the body, among which are the lungs, intestines and pancreas. Why don’t all cells suffer from the mutation, even though they all contain the mutated gene?

Not every cell needs chloride ion pumps. This means that many cells do not use the gene that codes for chloride ion pumps.

The question for this chapter is:

When is the information inside the DNA translated into proteins?

The processes that determine whether or not a gene is read are indicated by the term ‘gene regulation’.

6.1 Gene regulation Chapter 3 showed that every cell inside the human body contains the same DNA-packet. All cells contain the information for proteins that might be needed sometime, somewhere in the body. Not every cell will produce every protein.

Question 6-1 Specific proteins a. Name five proteins (or tasks carried out by proteins) that you are sure are only produced in

certain kinds of tissue. Also name the place inside the body (organ/tissue or cell type) that uses this protein. For example: light receptors inside the eye.

b. Additionally, name three proteins that are necessary in every cell. To help, take another look at the list of protein tasks in section 2.2.

If not every protein is needed in every cell, this means that not every gene is read. In certain cells, some genes are permanently ‘off’, because they code for a protein that cell will never need.

Things get even more complicated: in a many cells, proteins are only produced when they are actually needed; this is when the gene is read or turned ‘on’. It is only when the protein is needed by the cell that RNA polymerase will bind to the gene and make a copy of it.

Question 6-2: Which genes can be turned off and on? Write down a gene that is switched ‘on’ and ‘off’ in certain cells. For example: enzymes that break down alcohol in the liver cells are only made when alcohol is present in the blood.

Whether a gene is read or not, is determined by transcription factors. These are proteins that attach themselves to the promoter at the beginning of the gene. Transcription factors come in two types: activators and repressors. For activators, the rule is that RNA polymerase can only begin transcription when the activator is connected to the promoter. Thus an activator switches a gene ‘on’.

The reverse is true for a repressor: when a repressor is connected to the promoter, it is impossible for RNA polymerase to start transcription. A repressor switches a gene ‘off’.

24

The Molecules of Life Chapter 6. Why isn’t the mutation expressed in every cell?

It is important to be clear that transcription factors are themselves proteins. For every transcription factor there is a gene, in which mutations can also occur.


Why isn’t the mutation expressed in every cell?

25

Chapter 7. How does a chloride ion pump work? The Molecules of Life

Chapter 7. How does a chloride ion pump work? Chapter 2 described the tasks undertaken by a variety of different proteins. Pumping out chloride ions is one of the tasks carried out in mucus-producing cells.

A mutation in the blueprints of a cell can lead to a different kind of protein being built. In this chapter, you will examine what the chemical composition of proteins looks like. This composition determines the three-dimensional shape of a protein. This shape is of great significance and influences the way a protein behaves and functions.

Not every protein is operational all the time; many of them switch between on and off.

The general question for this chapter will be:

How do proteins work?

7.1 Proteins The primary fact to remember about proteins is this: every protein carries out one, specific task inside the cell or body. To answer the question how it is possible that there is a protein for every task, you will have to delve into proteins’ chemical composition. This is because their spatial shape is essential to enable their proper functioning.

The second fact to remember is: every protein has a specific spatial shape and a specific chemical composition that is crucial to their proper functioning.

In this chapter, you will discover how it is possible to produce every necessary kind of protein, each with their own unique structure and composition, by combining only twenty building blocks, the different amino acids.

7.2 Amino acids In the image above, the ‘R’ inside the general structure for an amino acid means R-group, or side group. It is the only thing that differs among the different amino acids.

26

The Molecules of Life Chapter 7. How does a chloride ion pump work?

The different groups of amino acids have different chemical properties. In the figure above, you can see that we can differentiate the following groups:

R-groups that are positively charged inside the cell; R-groups that are negatively charged inside the cell; R-groups that are polar (they dissolve well in water), but are uncharged; R-groups that are a-polar (they do not dissolve well in water), and are also not aromatic

(they do not contain benzene rings) R-groups that are aromatic. These contain benzene rings.

7.3 Linking amino acids

27


Question 7-1: How many different kinds of protein using twenty amino acids? Every kind of protein can be made by linking amino acids. Twenty different building blocks may not seem like a lot, but they can be combined in an infinite number of ways, creating an infinite number of possible proteins. a Using a calculation, show how many different proteins can, in theory, be made using only four

amino acids. b How many different proteins are possible using 10 amino acids? Many proteins consist of more than 100 amino acids, they often consist of over 1000 amino acids; thus, it is clear that it is very possible to create a unique protein for every task inside a cell using only 20 amino acids.

7.4 The structure of proteins As mentioned above, the spatial structure of a protein is essential for it to function properly. The structure originates from the chains of amino acids folding themselves into a three-dimensional shape. This is caused by the chemical bonds between the amino acids.

In the figures below, difference will be made between

Primary structure Secondary structure Tertiary structure Quaternary structure

The following chemical interactions play an important role in forming these structures:

Hydrogen bonds Ionic bonds Hydrophobic interactions (also known as van der Waals interaction) Disulfide bonds

28


Proteins can only correctly carry out their task when their spatial structure is intact. This structure can be depicted in a number of ways. Take a look at the following animations to get a feel for three different kinds of depiction methods:

http://bit.ly/FyGyF and http://bit.ly/1YPEf

Under extreme conditions, these interactions can be disturbed. For example, when the pH changes, the charge of amino acids’ R-groups changes, which in turn can upset ionic bonds. The protein will then lose its structure, it will no longer ‘fit in’, and will therefore stop functioning.

29


7.5 Enzymes Enzymes are special kinds of proteins. A cell needs many different kinds of chemical components, as building material, for example, or as a source of energy. Membranes, for instance, are composed of lipids, and sugars are needed to fuel cell processes. Solitary amino acids and nucleotides also need to be present in the cell in sufficient quantities. Practically all chemical interactions that form or destroy these chemical components are catalysed by enzymes. Enzymes are proteins that ensure the chemical reaction necessary for a cell to function can actually take place. This can be depicted as follows:

E + S ES EP E + P

E = Enzyme S = Substrate ES = Enzyme-substrate complex EP = Enzyme-product complex P = Product

30


Enzymes bind the molecules that need to be converted (the substrate) to their active site. This site is, chemically as well as spatially, specifically engineered to accept only the intended substrate. An enzyme that has bound the intended substrate is called an enzyme-substrate complex.

7.6 Influencing enzyme activity The activity of enzymes can be influenced by making sure that the substrate can no longer reach the active site. This can be done in two ways:

Molecules that are chemically very similar to the substrate can bind to the active site, preventing the substrate from binding. These are called competitive inhibitors.

Molecules that attach themselves to the enzyme (often in a different place than the active site) can cause the active site to change shape, which means that the enzyme can no longer function optimally. These are called non-competitive inhibitors.

Some enzymes are only found in cells in their non-active form. This means that another molecule, often also a protein, is needed to activate the enzyme. This makes it possible to switch certain kinds of enzymes on and off.

Question 7-2: Where do activator molecules bond? Will a molecule that can activate a non-active enzyme bond in the active site, or somewhere else? Explain your answer. Explain your answer.

31


Question 7-3 Inhibitors What is the effect of adding more substrate:

a. When competitive inhibitors are present? b. When non-competitive inhibitors are present?

We now have a general description of how proteins are built and what their structure looks like. However, what does the malfunctioning protein in a CF patient looks like? The protein that is either not present or is mutated in CF patients is called CFTR, which stands for Cystic Fibrosis Transmembrane Conductance Regulator. It is the protein that can pump chloride ions out of a cell.

The animation below does not show a chloride pump (CFTR), but rather a sodium-potassium one. The underlying principle is the same. Contrary to the sodium-potassium pump shown in the animation, CFTR only pumps chloride ions out. It does not pump another substance into the cell.

Take a look at the animation at: http://bit.ly/9Q4k2

Transporting ions takes energy, which is supplied by the high-energy molecule adenosine triphosphate or ATP. This is the same molecule used when incorporating adenine into mRNA. When ATP bonds to the protein, it splits into ADP and a solitary phosphate group. By binding the phosphate group to the protein, the protein changes shape, causing the chloride ions to be pushed out. When the phosphate group is removed again, the protein takes on its original shape once more, ready to bind ATP again.


How does a chloride ion pump work?

32

The Molecules of Life Chapter 8. Why are the chloride ion pumps missing?

Chapter 8. Why are the chloride ion pumps missing? Research shows that most CF patients do not have CFTR proteins in their cell membranes at all. This is odd, as the mutation that is most commonly found consists of three missing nucleotides in the gene, causing the 508th amino acid (fenylalanine) to be missing from the protein. You would expect the protein to be made, though perhaps to be malfunctioning. Why then, is it missing completely in so many patients? Based on what has been revealed in previous chapters, you might suspect that there are more mechanisms inside a cell that play a part in building, checking and transporting proteins than we have discussed so far. For example, how is a protein made inside the cytoplasm transported to the membrane, and how does a cell ‘know’ which protein to transport? The question we will address this chapter is:

What causes proteins to take the right action, at the right place, at the right time?

8.1 The teamwork of cell processes Science does not yet know everything that happens inside a cell that ensures all tasks are carried out correctly. There are enormous scientific questions in this field that, for now, remain unanswered. The functioning of a cell is so complicated that science has only just started to work out how all these processes take place. So, despite the fact that we know the complete DNA code of a human cell, we are a long way from understanding fully how a cell works.

Question 8-1: The inner life of the cell To get an idea of how complicated the interactions between different kinds of proteins inside a cell are, you need to study the complete version of the film ‘the inner life of the cell.’ The film shows how a white blood cell recognises an inflamed spot inside a blood vessel. As a result, the cell changes its shape completely and crawls towards the inflammation through the cells of the blood vessel. Focus on recognising different kinds of proteins rather than trying to understand the precise explanation of what is happening. You can watch the film at http://bit.ly/rLXaL. What questions does the film raise to you?

8.2 Expert assignment Although scientists are still discovering the details of many of the processes inside a cell, they have a good understanding of what goes wrong inside mucus-producing cells. In the expert assignment, you will investigate what processes inside a cell should function properly in order to get the CFTR protein to the right place in the cell. The expert assignment is outlined in appendix B; work in groups.

8.3 Answer the CF-question using the sub-question

What causes the ion pumps to be completely missing inside the cells of most CF patients?

How are ion pumps transported to the cell membrane in normal cells?

33

Appendix A: Poster assignment The Molecules of Life

34

Appendix A: Poster assignment In this module, you will attempt to discover the molecular mechanisms behind a disease or biological phenomenon you have chosen yourself. You will present your findings using a poster. To prepare a good poster, start with writing a summary of the molecular mechanisms you have found in the literature. The summary will be written during class but the preparations for it have to take place in your own time.

What is the poster assignment made up of? Literature study on a subject in molecular biology Carry out the assignment with two other group members Present a written report of your findings by way of a summary Present your research in the form of a poster

The purpose of the poster assignment: To learning more about a specific subject in molecular biology Your research will show that you have mastered the theory behind molecular mechanisms

inside a cell In the summary, differentiate between issues of primary and secondary concern; make

sure to structure your summary properly Use the summary as a guideline for your poster The summary will provide insight into the contents of your poster. This summary will be

handed out to the people who will grade your poster

A thorough literature study Find1 (and read) articles on your own. Before you and your team start working on the poster, write a summary of your findings. It

is vital that you read the articles you have found beforehand, and that you understand the main issues. It is useful to write down crucial points, with references to sources, so that you know where you found them. Discuss within your team who tackles which part of the literature study.

In class, write your summary with your team. DO NOT use a previously written summary, or parts of one. This is so that your teacher can see the summary being written, to ensure that you are working as a team, and that the result is a group effort.

The summary should not exceed a single side of A4. This is essential for making a good poster. With a proper summary, creating the poster will be a lot easier.

Before you start making the poster, allow your teacher/supervisor to read the summary of your literature study; make sure this contains proper references.

Base your poster on your summary. The poster will be presented at the central presentations. Your classmates and your teachers will grade both the poster and your knowledge of the subject.

1 Finding good literature/articles is a skill in its own right. You can try starting with Wikipedia; their articles often mention sources that you can also use for your research. When looking for sources, keep in mind that this assignment is about mechanisms on a molecular level.

The Molecules of Life Appendix A: Poster assignment

Possibilities As a team, pick a subject in the field of molecular biology from the list below. Alternatively,

it might be possible to work on a subject not on the list but chosen by you and your group, but consult your teacher first.

Indicate your choice on the list. If a different group wants to cover the same subject, speak to your teacher.

Topics for the poster assignment with some relevant sources as a starting point:

Exon skipping as a therapy for for Duchenne Muscular dystrophy? http://www.ygyh.org/dmd/whatisit.htm

Huntington Disease, What is known and unknown about the mechanism of the disease? https://hopes.stanford.edu/ http://www.ygyh.org/hd/whatisit.htm

How does the anti-cancer drug Gleevec work? http://en.wikipedia.org/wiki/Imatinib http://uk.youtube.com/watch?v=7ZMVQ1Vbb7Y http://www.cancerquest.org/index.cfm?page=405 http://www.insidecancer.org/ klik ‘targeted therapies’

How does the anti-breast cancer drug Herceptin work? http://www.kennislink.nl/publicaties/diagnose-van-de-genen http://uk.youtube.com/watch?v=IeE3K7U9fTQ http://www.insidecancer.org/ klik ‘targeted therapies’

Triple therapy in the fight against HIV. Which processes are targeted by the drugs? http://whyfiles.org/035aids/index.html

How can tumors become resistant to chemotherapy? http://www.cancerquest.org/drug-resistance-mdr

The infuenza virus. Why do we need a new vaccine every year? http://en.wikipedia.org/wiki/Human_papillomavirus

How does BOTOX work? http://en.wikipedia.org/wiki/Botulinum_toxin

How does asprin block your headache? http://www.howstuffworks.com/aspirin.htm http://www.nature.com/nrc/journal/v1/n1/fig_tab/nrc1001-011a_F1.html

How can a virus cause cervical cancer? http://www.cancerquest.org/how-hpv-causes-cancer

Familial_hypercholesterolemia. Why does this genetic disorder cause high cholesterol levels?

http://en.wikipedia.org/wiki/LDL_receptor http://en.wikipedia.org/wiki/Familial_hypercholesterolemia

Your own subject A subject is only appropriate for this assignment if it can be worked out on a molecular

level. It needs to cover the effect of particular molecules inside a cell (for instance a gene, protein or drug). You might find some inspiration on http://www.ygyh.org/

Grading the posters Your poster will be graded by your classmates, but you will also grade your classmates’ posters. You will do this in the following way: from your group of three students, one will always stay with the poster. He or she will present the poster to the people grading it. At the same time, the two remaining group members will grade another poster. When the first round of grading is finished, one of the two people grading will swap places with the group member presenting the poster, and so on. After three rounds, everyone will have presented the poster once and have graded other posters twice.

When all posters have received a grade, discuss the content similarities between your poster and the three you and your group have graded. Note your findings on the back of the grading form.

35

http://www.ygyh.org/dmd/whatisit.htm

http://www.ygyh.org/hd/whatisit.htm

http://en.wikipedia.org/wiki/Imatinib

http://uk.youtube.com/watch?v=7ZMVQ1Vbb7Y

http://www.cancerquest.org/index.cfm?page=405

http://www.insidecancer.org/

http://www.insidecancer.org/

http://whyfiles.org/035aids/index.html

http://www.howstuffworks.com/aspirin.htm

http://www.nature.com/nrc/journal/v1/n1/fig_tab/nrc1001-011a_F1.html

http://en.wikipedia.org/wiki/LDL_receptor

http://www.ygyh.org/hd/whatisit.htm

Appendix B: Expert assignment Cystic Fibrosis The Molecules of Life

Appendix B: Expert assignment Cystic Fibrosis

Introduction In this assignment, you will become experts on one of the cellular and molecular topics that play a role in cystic fibrosis. As experts, you will pass on your knowledge to your classmates. Your classmates will then be tested on what they have learnt.

Available sources Use all sources that accompany your chosen topic. Additionally, use Wikipedia to find the proper terms for the cell processes that are involved in the topic.

If your school has biology handbooks, such as ‘Biology’ by Campbell, use these to look up the general processes mentioned in the assignment.

Group 1: The CFTR gene and the CFTR protein Become an expert on the CFTR gene, and the CFTR protein that originates from it by answering the following questions:

On which chromosome does the CFTR gene lie? How many base pairs is the CFTR gene composed of? How many exons is the gene composed of? How long is the mRNA? What percentage of the gene consists of non-coding parts? How many amino acids are needed to build the CFTR protein? What percentage of the

nucleotides in the mRNA do not code for an amino acid? Describe the building of the protein. What are the different domains? What is a nucleotide-binding domain (NBD), and what is it for? Where is the mutation most commonly found in CF-patients located? Give a logical explanation for the fact that CF is a recessive hereditary disease (see

Wikipedia).

Use at least the following sources (research other sources for more information):

http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/cftr.shtml http://users.ox.ac.uk/~genemed/ (click on Cystic Fibrosis)

Group 2: The CFTR protein’s transfer to the membrane

CFTR is a transmembrane protein. Transport towards the membrane is crucial to allow the mucus-producing cell to function properly. Answer the following questions:

What does transmembrane protein mean? In what part of the cell are proteins that need to be transported to the membrane made? Transmembrane proteins are first attached to the membrane of a vesicle. This vesicle then

fuses with the cell membrane. Describe the route taken by the CFTR protein from the moment it is made until it arrives at its destination.

How does a cell ‘know’ which proteins are transmembrane proteins? How does a cell ‘know’ which parts of a protein should be outside, and which should be

inside the cell?

Use at least the following sources:

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?highlight=ER&rid=mboc4.section.2202#2204 http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.figgrp.2212 http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.figgrp.2227

36

The Molecules of Life Appendix B: Expert assignment Cystic Fibrosis

Group 3: ATP production as an energy source for CFTR

Pay attention: this topic has only few sources that are readily provided. You and your group might have to look for additional ones.

The CFTR protein pumps chloride ions. Carrying out this task takes energy. As with most processes inside a cell, the high-energy molecule ATP is used as fuel. The CFTR molecule has two combining sites to accommodate this. In this assignment, you will become experts in the field of ATP production inside a cell.

Where in the cell is ATP production located? What are the proteins that produce ATP called? Write down the net chemical equation of ATP synthesis. Describe, using images, the way the protein that creates ATP works. You can see in the animations that proton transport is the main source of power behind

ATP production. Where are the protons before they pass through the protein? How is the proton gradient formed? What is a cell’s fuel?


http://www.youtube.com/watch?v=3y1dO4nNaKY http://en.wikipedia.org/wiki/Adenosine_triphosphate Campbell Biology, Campbell, Neill A., Reece, Jane B., 6-8th edition. Ask your teacher about

this book and other books on this subject.

Group 4: Protein folding and degradation of wrongly-folded CFTR proteins

If a CFTR protein is folded the wrong way, the cell will destroy it. Answer at least the following questions:

What molecules ‘help’ the proteins to fold the right way? What is the label that is attached to proteins that are ready for degradation called? Describe in your own words what happens when a protein needs to be destroyed.


http://www.c3.nl/c3/files/chemistry_nl.pdf http://nl.youtube.com/watch?v=4DMqnfrzpKg http://nl.youtube.com/watch?v=w2Qd6v-4IIc

Execution Read the secondary assignments below and make sure you understand the assignment.

Introducing the assignment; forming groups and assigning different topics. Dividing the tasks - studying and exploring the subject deeper. Every member of the group needs to attempt to gain a complete understanding of the assigned topic using the sources provided. As a group, make a clear division of tasks: who will keep an eye on the overall progress? Who will keep in contact with the teacher? Who will study paper sources, and who will research online?

Exchanging knowledge; formulating questions Plan a meeting where all five-group members are present. Discuss what you have learnt, share information and question each other. In this way, each individual group member will become an expert on the subject. As an expert, you can share your knowledge with your classmates.

As a group, formulate two questions and write down the respective answers. One question should be knowledge-based, and one question should focus on applying knowledge in the right way.

By thinking of the questions yourselves, you will find out if you as an individual or as part of a group know enough to answer critical questions from your classmates.

Have your teacher take a look at the questions; email them to your supervisor.

37

Appendix B: Expert assignment Cystic Fibrosis The Molecules of Life

Preparation for exchanging your knowledge with non-experts Assemble new groups: five experts (one from every group) will form a new group together. This means every group will have five experts, each with their own area of expertise. Every expert has eight minutes to explain his or her topic to the non-experts.

The non-experts will take notes and ask questions about things that are unclear to them.

Doing and discussing the test To make sure that all class members understand the different regulating mechanisms, everyone will answer the questions formulated by the expert groups earlier.

The answers will be discussed in class.

Afterwards: evaluation and rounding off.

38

The Molecules of Life Appendix C: Final assignment Cystic Fibrosis

Appendix C: Final assignment Cystic Fibrosis Many people suffer from cystic fibrosis. Often, they have to undergo a great deal of treatment and take a variety of drugs to combat the symptoms of the disease. However, this treatment does not address the cause of the disease. It is your task to think of a solution that tackles the cause of the disease on a molecular level.

Describe the three ways in which, theoretically, the mucus-producing cells can be repaired. You will have to answer at least the following questions:

Can the treatment be applied in one sitting, or will the patient have to come back for return visits?

Will the treatment end up in all cells, or only those that are supposed to make CFTR pumps?

Deduce why this treatment has not been applied to patients with CF (yet).

Try to finish this assignment without looking on the Internet. If you have questions remaining at the end of the assignment then can you try to look for the answers online.

39

Appendix D: Starting assignment The Molecules of Life

Appendix D: Starting assignment You will have covered DNA, translation, transcription etc. in year 10. However, this starting assignment is intended to refresh your knowledge and to fill in any gaps.

Question D-1: The ribose molecule

a. Circle the sugar molecule, the base molecule and the phosphate group in the molecule pictured here.

b. Number the C-atoms of the ribose molecule. c. You can see in the figure that one side of this

molecule is charged. Which side is more negatively charged – the inside or the outside?

An organism’s hereditary information is stored in its DNA in the form of a code. This code consists of four building blocks, or bases. These bases succeed each other in a particular order – that is: ...AGTCGTAATTGGCCCCAATTGCAAAAA...’.

A succession of bases, called a sequence, codes for one protein. This is called a gene. The DNA (as pictured below) consists of sugars (deoxyribose) and phosphate groups. Every base in the sequence, be it adenine, guanine, cytosine or thymine, bonds to a sugar group. DNA has a double helix structure, and the two strands of the double molecule are held together by hydrogen bonds.

Question D-2 The DNA strand a. Put the terms below in their correct place on the diagram:

Adenine, thymine, cytosine, guanine, uracil, phosphate, deoxyribose, hydrogen bond, backbone, nitrogen bases.

b. A piece of DNA contains 33% guanine. What percentage of adenine, cytosine and thymine will is contained in this piece?

40

The Molecules of Life Appendix D: Starting assignment

Question D-3 DNA replication a. DNA replication is semi-conservative. What does this mean? b. In what direction is DNA read: 3’ to 5’ or 5’ to 3’? c. In what direction is the new sequence produced? d. What molecule splits from the strand to provide the required energy? e. If sequences can only be read in one specific direction, what are the implications for the

lagging strand?

Question D-4: Transcription and translation DNA contains the code needed for proteins to be built. Proteins are created in the ribosomes, but DNA cannot leave the cell nucleus. This means that a ‘messenger’ is needed to convey the information from the cell nucleus to the ribosomes. There are many kinds of RNA, but the RNA that transports the message in the DNA is called messenger RNA, or mRNA.

a. Where does transcription take place? b. What are the differences between DNA and

RNA? c. What is put on the 5’ end of RNA? d. What is the purpose of the part mentioned in

question c.? e. What is actually translated in the translation

process?

Question D-5: Amino acids The information from the RNA is translated into amino acids. Every three bases code for one particular amino acid. A triplet of these bases is called a codon. This code is the same for every organism in the world.

a. How many different amino acids can be coded using the codon system?

Every amino acid has a central carbon atom (the Can amino group, a carboxyl group (the ‘base’ group) and a side, or R chain.

b. In the diagram pictured below, indicate the following parts of the amino acid: the Cthe amino group, the carboxyl group and the side chain.

There are twenty possible amino acids. The only difference between them is the structure and composition of the side chain. Because of these different side chains, every amino acid has its own particular characteristics - for example: hydrophobicity, electric charge, size, base-acid characteristics, and the possibility of forming hydrogen bonds or other covalent bonds.

When two or more amino acids are linked to each other they are called polypeptides, or proteins. The successive chain of -NH-C-CO-NH-C-CO- is called the backbone.

41

Appendix D: Starting assignment The Molecules of Life

Two amino acids can bond to each other via a peptide bond. When a peptide bond is established, a H2O molecule is released.

The properties of amino acids are crucial for the folding of a protein chain. For example, charged side chains can form ionic bonds with one another or with other charged molecules in the protein. The amino acid cysteine contains an extremely important sulphur group, as two cysteine molecules can form a sulphur bond between them, a bond that is of vital importance to the structure of peptide chains.

Questions D-6 Proteins a. Indicate the peptide bond in the figure below.

b. In the figure below, indicate the following components: polypeptide backbone, ionic bond, sulphur bond, hydrophobic interaction and hydrogen bond.

c. How many different dipeptides can you build using these 20 amino acids? d. And how many different proteins can you built consisting of 100 amino acids? e. Draw the dipeptides Leu – Asp and Asp – Leu. Circle and name the differences between the two

molecules. f. The polypeptide, or amino acid chain is hydrolysed in the animation. What does this mean?

The scientific community has adopted the convention that amino acid sequences of proteins are always read from the N-terminus to the C-terminus. In other words: from the ‘amino tail’ to the ‘carboxyl tail’.

42

The Molecules of Life Appendix E: Practice questions DNA

Appendix E: Practice questions DNA

Question E-1: What are the base components of Staphylococcus afermentans? A researcher has isolated the DNA of Staphylococcus afermentans and analysed its base composition. The cytosine base forms 27% of the total bases. Can the researcher, based on this finding, predict what percentage of adenines will be present in the DNA? If yes, what is this percentage? If no, why not?

Question E-2: How big is the complementary strand? Take a look at the following piece of single strand DNA: 3' TTAAAAAAAGGTAAATTATAGGC 5'.

a. What is the base order of the complementary strand of DNA? b. What is the base order of the complementary strand of RNA?

Question E-3: Which is the coding DNA strand? The order of nucleuotides in a piece of mRNA strand is as follows: 3’ AACGGUGCUUGGACCU 5’. What is the corresponding piece of coding of a DNA strand? A. 3’ TTGCCACGAACCTGGA 5’ B. 5’ TTGCCACGAACCTGGA 3’ C. 3’ AACGGTGCTTGGACCT 5’ D. 5’ AACGGTGCTTGGACCT 3’

Question E-4: From DNA to RNA A piece of a DNA molecule is pictured below. In this case, the RNA polymerase moves over the strand of DNA from right to left. Here, the whole piece is translated into mRNA. 5' ACTCAACGTTAC 3' 3' TGAGTTGCAATG 5' What is the base order of the mRNA sequence formed by the RNA polymerase? When writing down your answer, indicate the 3’ end and the 5’ end.

Question E-5: Hereditary material of a virus A researcher has determined the composition of the hereditary material of a virus: cytosine 17%, adenine 27%, uracil 31% and guanine 25%. Based on these findings, what two differences can you determine between the virus and the human hereditary material?

Question E-6: Given the following eukaryote DNA sequence 5’ ...TATAAACCTCGACAACCAATCGTAAAAACCACTGAAGATCT...3’ 3’ ...ATATTTGGAGCTGTTGGTTAGCATTTTTGGTGACTTCTAGA...5’

a. What could be the purpose of the first 6 base pairs in the sequence above? b. Which is the template strand, the top or the bottom?

43

Appendix E: Practice questions DNA The Molecules of Life

c. Give the corresponding mRNA sequence. d. Due to a mutation, the T base on the third position in the 5’-3’ strand changes into a G base.

What are the consequences of this mutation?

Question E-7: The replication reaction Look carefully at the structures of the components pictured below. One of the two will be added to the replication reaction. Present in this reaction are: a string of DNA, and all components to replicate this string.

a. What do you expect will happen when component A is added in large quantities, compared to the deoxycytosine triphosphate (dTCP) already present?

b. What happens when you add component A to a quantity corresponding to 10% of the quantity of dTCP?

c. What happens when component B is added under the same circumstances as in a. and b.?

Question E-8: mRNA and rRNA How can eukaryote mRNA be separated from other kinds of RNA, such as ribosomal RNA? Give two possibilities. Hint: there are certain particles, approximately the size of sugar crystals, to which reactive molecules such as proteins, DNA, RNA etc. can be attached. These particles can be easily removed from a solution by centrifuging.

Question E-9: What is the code for... What is the base order for the piece of a gene that codes for the peptide sequence NH2-Met-Trp-COOH? Draw both strands of DNA and indicate the polarity.

Question E-10: What proteins are formed in vitro? The following polyribonucleotides were separately presented to an in vitro (meaning: in a test tube) system of protein synthesis.

a. poly (AC) b. poly (AUC) c. poly (AAG) d. poly (GAU) e. poly (UAUC)

The initiation of the protein synthesis process is rather uncontrolled in the in vitro system, and can happen at every possible position. What amino acids could be incorporated in these five experiments?

44


Question E-11: What proteins are formed in a bacterial in vitro system? In a bacterial in vitro system, the following artificial mRNA is used: 5'- A A G U C C G G U G G C U C U A G A U G A G U A A G U A -3' Initiation of the protein synthesis process is rather uncontrolled in the in vitro system, and translation can start at random points in the mRNA sequence. However, as should happen with an in vitro system, termination functions properly. What is the order of the amino acids in the longest polypeptide chain that can possibly be synthesised from this system? Indicate where the NH2- end and COOH- end of the polypeptide are located. For the names of the amino acids, use the abbreviations found in the code table.

Question E-12: Amino acids a. What amino acid will be bound to the rRNA molecule that has the anticodon 5’ AUG 3’? b. Due to a mutation, the anticodon of tRNAPhe is changed from 5’ GAA 3’ to 5’ GAC 3’. What

consequences will this mutation have? c. Due to a chemical reaction, Cys-tRNACys is changed into Ala-tRNACys. What consequences will

this mutation have for the protein?

Question E-13: 5-bromouracil The thymine equivalent 5-bromouracil is a mutagenic compound. It causes the mutation of one purine (A or G) into the other, and likewise for the pyrimidines (C and T). Which of the following amino acid substitutions do you expect will occur most as a result of mutagenesis due to 5-bromouracil? A. Met Val B. Met Leu C. Lys Thr D. Lys Gln E. Pro Arg F. Pro Ser

Question E-14: How many amino acids is the protein made up of? The pieces of the protein (P, Q and R) are made using the following three molecules of mRNA. You do not know in which direction the mRNA sequence is read. P: AGAGAGAGAGAGAGAGAG Q: CAUCAUCAUCAUCAUCAU R: AAUGAAUGGAUGAAUGAAUGGAUG Which of the following answers shows the correct quantity of amino acids with which the proteins are built?

P Q R

A 2 1 4

B 1 3 2

C 2 1 3

D 3 1 4

45

Appendix E: Practice questions DNA The Molecules of Life

Question E-15: What is the order of events in protein synthesis? Listed below are some of the events taking place during protein synthesis, what is the correct order of these events? 1. Peptide bonds are formed. 2. Transcription. 3. Codon – anticodon bonds are formed.

Question E-16: Observe the following mRNA segment An mRNA sequence is read from the DNA sequence shown below. This mRNA sequence contains 18 nucleotides, and one start and one stop codon. T A C C G A C T C T G C A T G A T T | | | | | | | | | | | | | | | | | | A T G G C T G A G A C G T A C T A A

a. What is the nucleotide sequence of this piece of mRNA? Indicate the 3’ end and the 5’ end. b. Additionally, indicate the 5’ and 3’ polarity on both of the polynucleotide chains shown above. c. What is the sequence of amino acids of the polypeptide that this piece of mRNA codes for?

Indicate the NH2- end and the COOH- end of the peptide.

Question E-17: Prokaryote and eukaryote mRNA How does the mRNA of a prokaryote differ from that of an eukaryote?

Question E-18: Ribosome

How many kinds of RNA can you find in an active ribosome?

Question E-19: Constant Spring Some people have an irregular variant of haemoglobin that is known as ‘Constant Spring’. The normal α-polypeptide chain of a haemoglobin atom has a length of 141 amino acids. However, the haemoglobin α-polypeptide chain of a person suffering from Constant Spring is 172 amino acids long.

a. Explain how Constant Spring might originate from the wild type gene by a substitution mutation or a frameshift mutation.

With Constant Spring, amino acid number 142 is a glutamine. The types of amino acid present in the 142th position have been determined in three variations of irregular haemoglobin α-polypeptide chains, and were found to be Glu, Ser or Lys.

b. What could be the original stop codon? c. All four irregular polypeptide chains possess identical amino acids for positions 143 up to and

including 172. Does this argue in favour of frame shift or for substitution mutation? Explain your answer.

Question E-20: Progeria The difference between a short, 13-year life span and a 75-year life span can sometimes be determined by a single base pair. This was discovered when scientists found the genetic cause that lies at the heart of an extremely rare aging disease called Hutchinson–Gilford Progeria Syndrome, or HGPS.

46


In patients suffering from this disease, a certain gene on chromosome 1 has had a cytosine base (C) replaced by a thymine (T) one. This means that in that point on the genetic sequence, the triplet GGC in the coding string has been altered into GGT. (The coding string is the complementary strand of the template). Usually, an alteration like this will not cause a mutation in the protein this strand codes for. Unfortunately, in this specific case, this mutation does cause a problem when the mRNA is formed because the synthesised protein (lamin A) is fifty amino acids shorter than it should be. This has disastrous results for the shape and the functioning of the cell membrane.

a. Explain why a mutation from GGC to GGT will usually not cause a different protein to be made.

Apart from pieces that code for amino acids (exons), genes also consist of non-coding parts (introns). When forming functional mRNA, these introns are cut from pre-mRNA using enzymes, leaving only the exons that are then linked together. These enzymes are designed to cut places in the RNA that have a certain order of bases. The figure shown here provides a schematic view of a gene containing introns and exons. Observe how the cell turns the gene into protein P in four steps.

b. Which of the following statements about the numbered parts of the figure is correct?

i. The amount of thymine in (1) is equal to that in (2). ii. Functional mRNA is indicated by (3). iii. The amount of amino acids in (5) is equal to the amount of nucleotides in (3). iv. The processes between (3) and (5) take place in the cell nucleus.

Research has shown why the mutation causes problems for the synthesis of lamin A: there is an extra cutting point in the pre-mRNA. This new cutting point is located in the penultimate exon, causing the final intron to be 150 nucleotides longer than it should be. In the worksheet below, a schematic view of the gene that codes for lamin A, including introns and exons, is provided. The extra cutting point in the mutant gene is indicated on the diagram. Imagine that the synthesis of lamin A from the lamin A-gene can be pictured similarly to how protein P is formed from gene P in the figure provided above.

c. In the figure below, draw a schematic picture of the synthesis of the mutated lamin A from the mutated gene.

d. In the third column of the worksheet, give the names of the structures you have drawn. They should match the structures numbered 2 to 6 in the image above.

New Cutting Point

47

Appendix F: Practice questions proteins and enzymes The Molecules of Life

Appendix F: Practice questions proteins and enzymes Question F-1: What does peptidase slice?

What bond(s) in the (part of a) protein sequence can be sliced by peptidase (an enzyme that cuts proteins)? A. Only 3. B. Only 1 and 4 C. Only 2 and 5 D. 1, 2, 3, 4, and 5

Question F-2: The structure of a protein The structure of a protein is determined by the sequence of its amino acids. If you create a genetically altered protein in which the amino acid sequence is reversed, will you get a protein with the same structure as the original? Explain your answer.

Question F-3: What amino acids are at the centre of a protein? Which of the following amino acids do you expect to frequently encounter in the centre of a folded protein? Which ones do you expect to be closer to the surface? Explain your answer. Ser, Leu, Lys, Gln, Val, Ile, Cys-S-S-Cys (two cysteines that form a sulphur bond).

Question F-4: Nucleo-plasmin

Nucleo-plasmin is a large protein that is synthesised in the cytoplasm, and active in the cell nucleus. The protein consists of two domains: a ‘head’ domain and a ‘tail’ domain. These domains can be separated from each other using a specific peptidase. The intact nucleo-plasmin can be labelled using radioactive materials. Micro-injection of this radioactive protein, as well as the solitary domains (head and tail), into the cytoplasm of a cell gave the results shown in the image on the left (after incubation).

a. What can you conclude from this experiment?

Absorption in the core

No Absorption in the core

Absorption in the core

48

The Molecules of Life Appendix F: Practice questions proteins and enzymes

The researchers went on, and found the following sequence of amino acids in the nucleo-plasmin: - - - Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val- - - (A) By introducing a mutation in this sequence, it changed into: - - - Pro-Pro-Lys-Thr-Lys-Arg-Lys-Val- - - (B) When this mutation was introduced, the nucleo-plasmin was no longer localised (see figure) .

b. What can you conclude from this experiment? c. Explain in which domain (head or tail) this sequence is located.

Question F-5: Sickle cells The figure below shows red blood cells. Figure (a), shows properly structured haemoglobin. The primary structure of the first seven amino acids is provided. In figure (b), you can see sickled red blood cells. Sickle-cell disease is caused by the substitution of one amino acid in the haemoglobin protein of red blood cells. This disease is extremely common in people from Africa.

a. Why does this substitution (Glu Val) have such an impact? b. Explain whether the impact would be the same if glutamate were replaced by aspartic acid.

Question F-6: Computer proteins Computers are an invaluable tool that scientists use to unravel the spatial structure of proteins. This knowledge is crucial when it comes to designing new molecules. , A computer will use the information gained by bombarding a protein with X-rays to build a three-dimensional image of the protein. This method has been used to discover the structure of many different kinds of proteins. New software enables researchers to design new proteins or improve existing ones. By designing new proteins it is possible to engineer new drugs. For example, creating substances that can inhibit an enzyme’s function. Computers have been used to screen many substances that could possibly block a particular enzyme in HIV. The spatial structure of this enzyme has been determined, followed by a cast of the shape of the active site. This is being compared to shape of approximately 10,000 molecules in the hope of finding a molecule that could be used to fight HIV and AIDS. (Source: Natuur en Techniek, 1994 [translated from Dutch]) The source describes how the spatial structure of a protein from HIV was determined using X-rays and a computer.

a. Explain why determining only the amino acid sequence of the protein would not provide enough information.

b. Explain why a cast of the active site was used. c. Explain in three steps how administering the drug described above can render HIV harmless.

Question F-7: What differentiates enzymes from catalysts? Which of the following statements is correct? A. An enzyme works on countless substrates. B. An enzyme cannot lower the activation energy. C. An enzyme only works for a specific target. D. An enzyme cannot control the direction of the chemical reaction.

49

Appendix F: Practice questions proteins and enzymes The Molecules of Life

Question F-8: Enzyme reactions Simple enzyme reactions are often pictured as follows: E + S ES EP E + P Where E, S and P stand for enzyme, substrate and product respectively.

a. In this model, what does ES stand for? b. Why does the arrow point both ways in the first step, but only one way in the second? c. Why is E on both sides of the reaction process? d. Often, a high concentration of P seems to decrease enzyme activity. Give an explanation for

this. e. Molecule X looks very similar to S. It can bond in the active site, but not converted. What do

you expect will be the effect of molecule X on the reaction process? Compare the effect of adding X to that of the quantity of P increasing.

Question F-9: The workings of enzymes in graph form The diagram below provides a correlation between the temperature of a reaction and the amount of molecules that are converted in 10 minutes.

Number of molecules substrate converted in 10 min.

Temperature

The amount of substrate converted at t1 and t2 is the same. Which of the following statements explains this correctly? A. The same number of enzyme molecules are active in t1 and t2. B. Every enzyme molecules converts the same amount of substrate in t1 and t2. C. There are more active enzyme molecules in t1 than in t2, but the enzymes convert less substrate in t1 than in t2. D. There are fewer active enzyme molecules in t1 than in t2, but the enzymes convert more substrate in t1 than in t2.

Question F-10: Decreasing enzyme activity Enzyme activity can be decreased in various ways. Some inhibitors (type 1) decrease the activity of an enzyme by changing its structure. Others (type 2) work by being very similar in structure to the substrate normally converted by the enzyme; in this case, the substrate and a type-2 inhibitor engage in an equilibrium reaction with the enzyme. In an experiment, a certain amount of type-1 inhibitors is added to a test tube that already contains an amount of enzyme. The amount of inhibitor is sufficient to fully prevent the enzymes from functioning. In a second test tube, this process is repeated with a type-2 inhibitor. Afterwards, substrate is added to both test tubes.

a. What do you expect will happen when converting to substrate?

Tube 1 Tube 2 A. Conversion increases Conversion increases B. Conversion increases No conversion C. No conversion Conversion increases D. No conversion No conversion

50

The Molecules of Life Appendix F: Practice questions proteins and enzymes

There is a way of decreasing enzyme activity where the end product of the reaction chains works as an inhibitor for one of the enzymes involved in the process. The inhibitor binds to that enzyme, causing it to be temporarily disabled. The reaction between enzyme and inhibitor is one that creates equilibrium. The figure below represents a schematic view of a reaction chain. E1, E2 and E3 are enzymes, while P1, P2 and P3 are products of the reaction. P3 functions as an inhibitor for E1.

Three scenarios that influence the quantity of P3 being produced in a given amount of time, are: A. The removal of P3 from the cell; B. Adding P3 to the cell; and C. Converting P3 into some other substance that does not inhibit E1.

b. Give the scenario(s) that lead to an increase of P3 –production.

51

the molecules of life - NLT · The module The Molecules of Life was developed for the Dutch...

Documents

Transcript of the molecules of life - NLT · The module The Molecules of Life was developed for the Dutch...