The minimal duplex DNA sequence required for site-specific ...
Transcript of The minimal duplex DNA sequence required for site-specific ...
Volume 14 Number 12 1986 Nucleic Acids Research
The minimal duplex DNA sequence required for site-specific recombination promoted by the FLPprotein of yeast in vitro
Gerald Proteau, Deborah Sidenberg and Paul Sadowski
Department of Medical Genetics, University of Toronto, Toronto, M5S 1A8, Canada
Received 9 April 1986; Revised and Accepted 21 May 1986
ABSTRACTThe 2-micron p i i r a i d of tho yeast Saccharomvces c e r e v l s i a e code* for a
s i te-speci f ic reconbinase ('FLP') that ef f ic ient ly catalyses recombinationacross the plasmid's two 599 bp repeats both jjj vivo and .is vitro. We haveused the partially purified FLP protein to define the minimal duplex DNAsequence required for intra- and intermolecular recombination J_£j vitro.Previous DNase footprinting experiments had shown that FLP protected 50 bpof DNA around the recombination s i t e . We made BAL31 deletions and syntheticFLP s i tes to show that the minimal length of the s ite that was able toreconbine with a wild-type site was 22 bp. The site consists of two 7 bpinverted repeats surrounding an 8 bp core region. We also showed that thedeleted s i tes recombined with themselves and that one of three 13 bprepeated elements within the FLP target sequence was not necessary forefficient recombination _in vitro. Mutants lacking this redundant 13 bpelement required a lower Mount of FLP reconbinase to achieve naxinal yieldof recombination than the wild type s i t e . Finally, we discuss the structureof the FLP site in relation to the proposed function of FLP recombination incopy number amplification of the 2-micron pi aim id in vivo.
INTRODUCTION
S i t e - s p e c i f i c recombination has been implicated in the control of gene
express ion in several prokaryotic organisms (1-5) and i s a l so thought to
play an important ro le in express ion of antibody d i v e r s i t y (6) and d i v e r s i t y
of genes for T-ce l l receptors (7 , 8 ) . A d i rec t approach to understanding
the mechanisms of s i t e - s p e c i f i c recombination i s to purify prote ins involved
in reconbination and to study the ir i n t e r a c t i o n s with the s i t e s at which
recombination events occur.
In v i t r o s i t e - s p e c i f i c recombination systems have been developed for
several prokaryotic recombination events (5, 9, 10, 1 1 ) . Such a de ta i l ed
ana lys i s i s currently being performed on the eukaryotic s i t e - s p e c i f i c
recombinase encoded by the 2 micron c i r c l e DNA of yeast (12, 13, 1 4 ) . This
6318 bp plaamid has two precise 599 bp inverted repeats which divide the
c i r c l e into two unique regions (15 ) . i s v ivo , e f f i c i e n t recombination
© IR L Press Limited, Oxford, England. 4787
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
occurs icrot i these repeated sequences generating two isomers (A and B
forms) of 2 micron pi aim id DNA. These forms differ froo one another in the
relative orientation of the two unique regions. Broach and his coworkers
(16, 17) have shown that this recombination event requires an intact FLP
gene, the largest open reading frame on the plasoid, as well as a 65 bp
region within the large 599 bp inverted repeats.
The FLP gene has been cloned into both Saccharomvoes cerevisiae and
Etcherichia col i expression vectors (12, 13, 14, 18). Subsequently, assays
were developed that demonstrated efficient _in vitro recombination and
allowed the purification of the FLP recombinase (12, 14, 19).
The FLP recombinase protects approximately 50 bp of duplex DNA from
digestion with pancreatic DNase (20). This region contains an 8 bp core
sequence surrounded by three 13 bp symmetry elements (Figure 1) . The two
symmetry elements surrounding the 8 bp core are in inverse orientation
(elements 'a' and 'b ' . Figure 1) . The third element is in direct
orientation with one of these two elements (element 'c' to the le f t in
Figure 1 ) . The FLP enzyme introduces single strand breaks at the margins of
the core (vertical arrows in Figure 1) and these breaks are the presumed
sites of strand exchange.
One of the important questions regarding the FLP sequence is the sixe
of the Minimal duplex DNA required for efficient recombination.
Gronostajski and Sadowski (21) used exonuclease digestion to carry out an
analytical study that defined the minimal duplex requirement for
recombination (boxed region in Figure 1) . These studies made use of
exonuclease s that degraded a single strand of the duplex DNA from a unique
Nucleate Protected Region
5 ' ,T- b
QCTTTGAAGTTCCTATTCCGIAAGTTCCTATTCTCTAGAAAGTATAGIGAACTTCAG 3'
3,CQAAACTTCAAGQATAAGGCTTCAAQ)GATAAQAQATCTTTCATATqCTTGAAGTC5.
i t F L P Cleavage sites — 1 3 b p Repeats f^J Minimal Duplex DNA Sequence
Figure 1. DNA sequences involved in FLP-aediated recombination.The braoket above the sequence shows the region of the s ite protected
from DNase digestion in the presenoe of FLP (20). The thiok horixontalarrows denote the three 13 bp symmetry elements surrounding the 8 bp core.They are labelled 'a ' , 'b' and 'c ' from right to l e f t . The thin verticalarrows at the margins of the core indicate the FLP-mediated cleavage s i tes(20) . The boxed sequence represents the minimal DNA sequence required forFLP—mediated recombination (21) as defined by exonuclease digestion.
4788
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
PGP25, pQP45:two dHI«r*nt B-E
bt*«f1s tn pOCO
B
PGP10: B-B Insert
mpuce
P G P 7 O : B - B kuart+ H-H m»rt
!pGP72: B-x hurt
*H p<>£\pGPOGA, pQPATA:ytoo dllt.r.nl 3-8
Mftt lii pUC9
| pOSGi pOPOQA+ H-H Fn^rt
POSA6: pQPAT*
Figure 2. Construction of the plasmids containing the recombination s i tesof interest.
A. Plasmids pGP25 and pGP43 consist of the BanHI-EcoRI fragmentcontaining the BAL31-deleted FLP s i tes from pGPll and pGP20 respectively(20) which were cloned into the BamHI-EcoRI s i tes of the poly 1 later of pUC9(see Table 1, l ines 3 and 4 ) .
B. A synthetic oligoaer which contained a FLP half -s i te bounded by aBamHI sticky end on the le f t and an i t s I sticky end on the right was clonedinto plasmid pBAlll that had been cut with BamHI and Xt§I to give pGPl/2(see Table 1, line 5 ) . A 912 bp Hindlll fragnent containing the entire 599bp repeat region of 2 micron DNA was then cloned into the Hindlll s i te ofpGPl/2 in both direct (pGP72) and inverse orientations (pGP73) .
C. A 32 bp synthetic FLP si te having BamHI sticky ends was cloned intothe BaaHI s i te of the polylinker of pCC9 to give pi am id pGPIO (see Table 1,line 6 ) . The 912 bp fragment used in the previous construction was clonedinto this plasmid in direct orientation to generate plasmid pGP70.
D. Synthetic oligoaers having Sail sticky ends were oloned into theSail s i te of the polylinker of pUC9 to generate pGPGGA and pOPATA (see Table1, lines 7 and 8 ) . The 912 bp fragment was then cloned in directorientation into each of these plasmids to give plasmids pDSG2 and pDSA6.
The arrow indicates the direction of the FLP s i t e . Restriction enxymes i t e s : B - BamHI. E = fitflRI, X - Jfeal, P - P_i_tl, H - Hindlll and S - Sail .
terminus (J£. col i exonuclease III and T7 gene 6 exonuclease). Hence the
recombination substrate consisted of a duplex DNA with a single stranded
t a i l . In order to corroborate these studies using fully duplex DNA, BAL31
exonuclease deletions of the FLP site and fully art i f ic ia l FLP s i tes using
synthetic oligonucleotides were made. In this study, we have tested the
abil i ty of these s i tes to function as substrates for FLP-mediated
recombination. We also address the possible function of the third 13 bp
symmetry element (element 'c') in regulation of the recombination reaction.
4789
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
MATERIALS AND METHODS
Str»in»
E. c o l i HB101 ( r k ~ , m^, recA") «nd I . c o l i JM83 (a£a, lac . -pro , .Hr. A,
t h i . 8Odlac Z M15 (22) were obtained from J. F r i e s e n .
Plaamid c o n i t r n c t i o n
BAL31 n u c l e a s e - d e l e t e d p lasmids , pGPll and pGP20 were generated as
p r e v i o u s l y deacribed (20) aaing pi i raid pGP40 which has two wi ld type
recombinat ion a i t e t in d irec t o r i e n t a t i o n . The BamHI - EcoKI fragnenta from
pCPll and pGP20 were transferred i n t o the BamHI - gc_o.RI s i t e s of the pUC9
p o l y l i n i e r (23) to y i e l d the plasmids c a l l e d pGP25 and pGP45, r e s p e c t i v e l y
(Figure 2 ) .
The two strands of the ha l f s y n t h e t i c s i t e were purchased at p u r i f i e d
ol igomers from the 01 igonuc leot ide S y n t h e s i s Laboratory, Department of
Biochemiatry, Queen's U n i v e r s i t y , Kingston, Ontario , Canada. The other
o l i g o n u c l e o t i d e s were purchased from the Ontario Cancer I n a t i t u t e . The
p r o t e c t i n g groups were c leaved from the o l i g o n e r by concentrated ammonia
treatment . The s o l u t i o n was then t r a n s f e r r e d to Eppendorf tubes , f r o i e n in
dry ice and evaporated in a Speed-Vac apparatus (Savant) overn ight .
01 igonucleotides were then purified by aeparation on polyacrylamide gels
followed by overnight elution of the cut out gel band in ammonium acetate
(24). All ol igonucleotides were paaaed through a Sep-Pak C18 column as the
last step in the purification. The fractions containing the
oligonucleotides were frozen in dry ice and evaporated in a Speed-Vac. They
were resuspended in water to a concentration of 10-20 picoaoles per |iL.
Duplex DNA fragments were then made by annealing pairs of corresponding
purified ol igonucleotides at 65'C and slowly cooling to room teaperature.
The solution waa placed on ice and used the same day or stored at -20*C for
later use. The synthetic FLP recombinase s i tes were cloned into the
polylinier of plasaid pUC9 (Figure 2 ) . The synthetic half -s i te which has a
5' protruding BamHI end and a 5' protruding Xbal end was cloned in the BamHI
- Jfcal s i t e s of pi inn id pBAlll (20) to give pi aim id pOPl/2. The 912 bp
Hindlll fragment of 2-micron plaanid containing an entire S99 bp repeat waa
cloned in both direot and inverse orientations into the Hjndlll s i te of
pCPl/2 (Figure 2 ) . After ligation, the molecules were transformed into E..
coli JMS3 or £. col i HB101. The sequences of the various constructs are
shown in Table 1.
Assays
Intramolecular inversion and excision assays were done as previously
4790
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
described (19, 25) using linear 3'- 3 2P end-labeled plasmid substrate* (see
Figure 3 ) . Twenty ng of substrate was incubated with FLP recombinase at
30°C for 30 min as indicated in the figure legends. Reactions were stopped
by addition of 0.25 volume of a solution containing 1% SDS, 0.5% bromophenol
blue, 40% glycerol, and 200 mH EDTA to an aliquot of the reaction mixture
which was then heated at 65°C for 10 min before analysis on agarose gels .
Another aliquot was used to check for inversion by restrict ion endonuolease
digestion and agarose gel electrophoresis. Autoradiography was done on the
dried ge ls . The internolecular integration assay was essential ly done as
previously described (25). The 3' end-labelled DMA substrate (20 ng) was
incubated with unlabelled circular DNA substrate in the presence of
FLP recombinase as indicated in the figure legends. The reaction was
stopped and analysed as for the intramolecular reactions.
Preparation of the FLP reconbinase
The FLP recombinase was purified as previously described (19).
Fractions from the f irst or second Bio Rex column were used and were free of
exonuclease and endonuclease act iv i ty .
Other aethods
Agarose gel electrophoresis and transformation of £. poll strains were
performed according to standard procedures (26) . Protein concentrations
were deternined as described by Bradford (19) and DNA sequences were
determined as described by Maiam and Gilbert (27) .
Plttsmid preparation
Bacteria harbouring plasmids were grown in LB medium at 37°C in the
presence of 20 ug/ml tuple i l l in and anplified with chloramphenicol (200
ug/ml). Plasmids were isolated by Triton X-100 lys i s (19).
Enxvmes
Restriction enzymes were purchased fron New England Biolabs, BEL, or
Boehringer Mannheim. Polynucleotide kinase, T4 DNA ligase were from New
England Biolabs. Avian myeloblastosis virus reverse transcriptase was from
Life Sciences.
RESPLTS
Determination of the minimal DNA sequence required for intramolecular
recombination.
(A) BAL31 exonnclease deletion mutants One approach to define the minimal
DNA sequence required for FLP mediated s i t e - spec i f i c recombination was to
make BAL31 deletions in one of the FLP s i tes on a plasnid containing two
4791
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
TABLE 1 . Saquencei of the FLP S i t e s Died i s tho Recombination As<aj>.
1. 43 (N) HjAAGTTCCrATI XOAMTTCCrArATCTAQAAAA'ATACGAACrTC-(N)751. 2 0 (N) MJAACTTCCrATTCCGAACTTCCTATTCTCTAGAAAOTATAOCAACTTC- (N) 43 . tot»oii.tociiCGAAGTrCCTATTCTCTAGAAAETATAOOAACTTC-(N)754 . «ntct«ctntccnAOTrCCrATTCTCTAOAAACTATAOGAACrrc-(N)7S5 . ttnctii;»llt<li«ct.«TCCTATTCTCTAGAAAOTATAOCAACrTC-(N)736. ctnoiltoncmtcoTrCCTATTCTCTACAAAGTATAOCAAlttt7 . cntcttiictic«tgtct»CCTATTCTCTAGAAAOTATAaG»ot«ct8. i » i c t tnc t io» i i t cnc» iTAlTClCTAOAAAGTATAtta tcnc
Site
pBAlllpBA112pGP25pGP4JpGPl /2pGPIOpOPGGApOPATA
Dir«ot
pGP40pBA126pOPllpGP20pGP72pGP70pDSO2pDSAi
Invent
PGP73
The arrows above the sequence indicate the 13 bp s j v a e t r j eleaients asin Figure 1. The notat ions (N)43, N(75), N(20) and N(4) indioate that 43,75, 20 and 4 base pairs of the normal 2-nicron sequence e x i s t beyond thesequence indicated. PI a said pDC9 or 1 inker sequences are represented aslover case l e t t a r s . Ths nanes of the pi aSBids containing a s ing le s i t e arel i s t e d under the heading ' s i t e ' . The entr ie s under the headings ' d i r e c t ' or' inverse' indicate that a wild type s i t * as well as the sequence indicatedi s present in the plasaid in direot or inverse or ientat ion r e s p e c t i v e l y (seeFigure 2) . In each saquenc* th« 8 bp core region i s underlined. Not* that5 addit ional base pairs to the l e f t of the s i t e in pGPl/2 are under 1 ined(1 in* 5) . While derived frosa p lasa id 1 inker sequences, these are ident i ca lto those found at similar pos i t i ons in aleaient ' o ' ( l ine 1 ) .
B
oxclslon inversion integration
Figure 3. Principle of the FLP tis iys.A. The excision m i ; .A 3' end labelled »ub«tr«te (*) containing two FLP recombination »ites
in direct orientation (arrows) is incubated with the FLP protein. Ifrecombination occurs, the products will be an onlabelled circular moleculeundetectable by autoradiography and a shortened labelled linear moleculewhich can be detected by antoradiography.
B. The inversion assay.A 3' end labelled substrate containing two FLP recombination s i tes in
as inverse orientation will undergo FLP-mediated inversion of the DNAbetween the s i t e s . The inversion of the DNA can be deteoted by digestionwith a restriction enzyme that has a recognition sequence positionedasymmetrically between the two FLP s i t e s .
C. The integration assay.A linear 3' end labelled molecule recombines with an unlabelled
circular substrate. The product is a linear molecule containing two FLPsites. Multiple integration events generate higher order multimericproducts (see Figures S and 7).
4792
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
A B C
1 2 3 4 1 2 3 4 1 2 3 4
Figure 4. The intramolecular recombination of BAL31 deleted FLP s i tes witha wild type l i t e .
ficjjRI linearized 3' end-labelled substrate (20 ng) was inoubated in thepresence of increasing amounts of FLP recombinase at 30°C as described inMaterials and Methods. Reactions were stopped after 30 min, aliquot! of thereactions were electrophoresed on a 0.8% agarote gel, the gel was dried andanalysed by autoradiography.
A. An antoradiogram of the assay using plasmid pGP40 (containing twointact s i tes) as a positive control showing the substrate (S) and produot(P) of the FLP-mediated excision.Lane 1, no FLP protein, lane 2, 0.5 ug FLP protein, lane 3, 1.0 ug FLPprotein, lane 4, 2.0 ug FLP protein.
B. FLP-nediated recombination using plasaid pGPll as substrate. Theconditions and enzyme concentrations were the same as in A.
C. FLP-mediated recombination using plasaid pGP20 as substrate. Theconditions and enzyme concentrations were the same as in A.
s i tes in direct orientation. The recombination between the deleted and
intact recombination s i tes was detected by incubating the end-labelled
substrate and observing the appearance of the shortened linear recombination
product (see Materials and Methods and Figure 3A). The results of such an
experiment are shown in Figure 4.
The parent plasmid pGP40 (20, Table 1) containing two intact sites in
direct orientation served as a positive control for excision. With
increasing concentrations of FLP recombinase, more recombination product was
observed. Plasmid pGPll (Table 1) which lacks the entire 'c ' symmetry
element recombined well with a wild type site on the same molecule (Figure
4793
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
c b a b a
P- t
S-i
1 2 3 4 5 6 7 8 9 10 11Figure 5. Influence of symmetry element 'c' on FLP—mediated recombination.
Reaction mixtures (100 fil) contained 25 mM Tri«-Cl, pH 7.4, 10 mH«|Cl2, 5 ng of 3 ' , 32p-l»bellod plasmid and 5 ng of unlabelled plasmid asfollows: Lane 1 no FLP; lanes 2 and 7 - 240 ng, lanes 3 and 8 - 480 ng,lines 4 and 9 - 720 ng, lanes 5 and 10 - 960 ng, lanes 6 and 11 - 1.4 ngLanes 1-6 - reactions contained 32p-lin e»r pBA112 plasmid and unlabelledpBA112 plasmid (wild-type FLP s i te ; see diagram above lanes)Lanes 7-11 - reactions contained 32p-linear pGP25 plasmid and unlabelledpGP25 plasmid (FLP site lacks symmetry element ' c ' , see diagram abovelanes). Since these plasaids differ in length by less than 1%, they arepresent in essential ly eqnimolar mounts. Note that maximal extent ofrecombination with pGP2J (lane 8) is reached with one-half as much FLP asneeded for plasmid pBA112 (lane 5 ) . Plasmid pGP2S then undergoes markedinhibition of recombination with increasing FLP concentration (lanes 9-11).
4, panel B) . Plasmid pGP20 which has an additional deletion extending 2 bp
into symmetry element 'b' to the l e f t of the 8 bp core (Table 1, and Figures
1 and 2) also recombines well with a wild type site on the same molecule
(Figure 4, panel C). In fact, careful examination of the experiment shown
in Figure 4 showed the maximal yield of recombinant product (P) was sl ightly
higher for the BAL31 deletions than for the intact site (compare lane A3
with lane B3 and C3) . Furthermore, plasmid pGP20 has been shown by DNase
footprinting experiments (20) to be protected and cleaved by the FLP
4734
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
B
123 123 123 123 123
Figure 6. Intramolecular recombination of synthetic oligoaeric FLP t i t e i .Reaction condition* were the same as in Figure 4. The two FLP t i t e i on
the molecule were in direct orientation. Lane 1, no protein, lane 2, 12 ngprotein, lane 3, 24 ng protein.
A. f i ld type control, pi»mid pBA126 containing two intact s i te* .B. Linear pGP70 containing one intact and one deleted FLP s i t e .C. Linear pGP72 containing one intact and one deleted FLP s i t e .D. Linear pDSG2 containing one intact and one synthetic FLP s i t e .£. Linear pDSA6 containing one intact and one synthetic FLP s i t e .S - substrate, P - excision product. See sequences of s i tes in Table 1.
reconbinase as well as the wild type recombination s i t e . The studies
presented here show that the third symnetry element ('c') (Figure 1) is not
essential for intramolecular recombination .in vitro.
To exanine the role of element 'c' more carefully, a detailed t i trat ion
of the yield of recoobinant product as a function of FLP concentration was
carried out. This experiment assayed internoleoular reoombination between
linear, end-labeled substrate containing a single FLP site and a similar
cold circular molecule (see Figure 3, panel C). In the experiment shown in
Figure 5 we compared a wild-type site with a s i te that lacked the 'c'
symmetry element. Two observations emerge from this experiment. The f irst
is that the maximal yield of recombinant product is attained at a lower
level of FLP with the deleted substrate than when the wild-type s ite is used
(Figure 5 ) . Secondly, recombination between the deleted FLP s i tes begins to
be inhibited at a lower level of FLP than recombination between the
molecules containing the wild-type s i te . We showed previously that excess
4795
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
B
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8
IPIP
Figure 7. Intermolecular recombination of the deleted FLP recombinationsites.
EcoRI linearized 3' end-labelled substrate (20 ng) was incubated with10 ng of cold circular pi a an id containing only one FLP recombination site inthe presence of FLP recombinase (320 ng protein) at 30°C for 30 min asdescribed in Materials and Methods. Aliquots of the reactions wereelectrophoresed, the gel was dried, and autoradiographed.The order of cold circular substrate is lane 1, none; lane 2, pBA112;lane 3, pGP25; lane 4, pGP45; lane 5, pGPl/2; lane 6, pGPIO; lane 7,pGPGGA; lane 8, pGPATA.
A. Linear pBA112 was used as the end labelled substrate.B. Linear pGPIO was used as the end labelled substrate.
S = substrate
IP - integration products.
FLP actually inhibits the recombination reaction (25). Thus it seems that
while the third 13 bp symmetry element is not needed for efficient
recombination, it may play a role in regulating the stoichiometry of the
recombination reaction. The possible function of the third symmetry element
will be dealt with in the Discussion.
(B) Synthetic oligomers Another approach taken to define accurately the
minimal duplex DNA sequence required for recombination was to construct
4796
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
shortened synthetic oligomers of the FLP recombination s i t e . These
synthetic s i tes vere cloned into ptJC9 in direct orientation with respect to
a complete 599 bp repeat sequence (see Figure 2 and Table 1) and assayed in
vitro by the ezcisive recombination assay (Figure 3, panel A). The results
of this experiment are shown in Figure 6. The wild type control plasmid
pBA126 (panel A) which contains two intact sites excises well (Table 1 ) .
Plasmids pGP70 (panel B), pGP72 (panel C) and pDSG2 (panel D) with their
progressively greater deletions also produced excision products. The mutant
with the largest deletion, pDSA6 (panel E) did not produce excision product
under the conditions of this experiment. Therefore, the smallest site that
recombined eff iciently was a 22 bp FLP s i t e , containing the 8 bp core region
surrounded by two 7 bp inverted sequences (Figure 6, panel D). No
recombination was detected when 2 additional bp were deleted on both ends of
the FLP site (Figure 6, panel E). Similar results were obtained for
inversion substrates (data not shown). These results are in good agreement
with previous analytical studies (21) and define the minimal sequence
necessary for efficient intramolecular recombination as 22 bp.
In order to examine the abi l i ty of two mutated FLP s i tes to re combine
with one another, we used the intermolecular recombination assay to detect
recombination between linear end-labelled and circular unlabelled substrates
(see Figure 3, panel C). The assay was used to detect recombination between
pairwise combinations of deletion mutation and wild type s i t e s . The results
of two such assays are presented in Figure 7. In panel A, labelled pBA112
whioh has a single wild type s ite (20) was recombined pairwise with cold
plasmids containing a wild type s ite (lane 2) or the deletion mutations
(lanes 3-8) . Panel B shows results obtained when labelled deletion mutant
DNA from plasmid pGPIO was incubated with cold plasmids containing the wild
type site (lane 2) or the other deletion mutations (lanes 3-8). Lane 1 in
both panels is a negative control of the labelled substrate; no
integration is detected in the absence of cold oircular substrate. Vhere
recombination occurred, it was detected regardless of which substrate was
labelled. Recombination between a deleted and wild-type site was similar to
that observed between two identical mutant s i tes (panel A, lane 6 and panel
B, lane 6) . The overall pattern of recombination between any labelled
linear substrate and all cold oircular substrates as seen in Figure 7 was
similar. Plasmid pGPl/2 has consistently shown better recombination than
pGP25 or pGP45. A possible reason is suggested below. The FLP site
containing 22 bp (pGPGGA, Table 1) was the smallest site capable of
4797
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
recombining. The even smaller s i te (18 bp) pGPATA (Table 1) vat unable to
re combine (Figure 7, lane 8, panels A and B) . Thus while there are some
quantitative differences between the various mutations, there is generally
good agreement between the results obtained with the intramolecular and
intermolecular assays. It can therefore be concluded that intra- and
intermolecular recombination require the same minimal duplex DNA sequence.
DISCUSSION
In this paper, we have reported further characteriiation of the target
sequence of the FLP site-specif ic recombinase of yeast. The enzyme had
previously been shown to protect a region of about 50 bp containing three 13
bp symmetry elements surrounding an 8 bp core region (see Figure 1) .
However the third symmetry element (element 'c') has been shown not to be
needed for recombination ^j vitro or _iri vivo (20, 28, 29 and this work).
Seneooff and Cox (J. Biol. Chan., in press) have shown that the third
symmetry element ('c') does not mediate directionality of the FLP reaction.
Rather directionality is dotemined by the inherent asymmetry of the 8 bp
core sequence.
If this third symmetry element is not needed for recombination, then
what sight i t s function be? We have shown that FLP forms three stable
protein:DNA complexes with a fragment of DNA containing a ooaplete FLP site
(B. Andrews si Ml- manuscript submitted). The three complexes are l ikely
formed by the binding of 1, 2 or 3 protomers of FLP protein and each
symmetry element comprises a single binding domain. Hence i t is likely that
this third symmetry element can bind a molecule of FLP. We have previously
shown that excess FLP protein inhibits FLP-mediated recombination. Our
findings here show that a complete FLP s i te (containing 3 symmetry elements)
is l e ss susoeptible to inhibition by an excess of FLP protein than a site
that lacka one symmetry element (Figure S) . Thus i t appears that the
function of this third synaetry element may be to sequester excess FLP and
thus to prevent i t from) inhibiting FLP—mediated recombination.
How might this third symmetry element function i g vivo? Futcher (32)
has proposed a model whereby the FLP recombinase i s involved in
amplification of the copy number of the 2-micron pi a so id. Basically his
model postulates that soon after replication of one of the 599 bp inverted
repeats, FLP promotes recombination between one of the newly replicated FLP
sites and the unreplicated FLP s i t e . The result of this event is to invert
one of the two replication forks of the circle with respect to the other.
4798
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
Figure 8. Futcher model for involvement of FLP-mediated recombination incopy number amplification (32).
1. Bidirectional replication of 2-nicron pi amid begins at originadjacent to the bottom inverted repeat and toon replicates through a FLPs i t e . The molecule now has three FLP s i tes (op«n arrows) one of which isnewly replicated (dotted l i n e s ) . The thin arrows indicate the direction oftravel of the replication forks.
2. FLP-mediated recombination occurs between the top (unreplioated)FLP site and the replicated one on the bottom. The result i s that the tworeplication forks are now proceeding in the l u e direction, following oneanother around the c irc le .
3. This can be appreciated by rearranging the molecule in 2 byrotating portions C and D with respect to sequences A and B as indicated bythe arrows. As the two forks, which now are dear ly proceeding in the samedirection, continue around the circle the result wil l be the formation ofnultimers of the 2-micron circle (not shown) which can then be resolved tononomer c irc les by FLP-mediated recombination. For further details see(32).
The two forks now follow one another around the circle and this 'rolling
circ le ' mechanism generates multimers of the pi asm id (see Figure 8 ) .
We suppose that as more nultimers are made, more FLP protein would be
synthesized and if too high a concentration is reached, perhaps FLP-mediated
recombination would be inhibited. The Futcher model also postulates that
FLP-mediated recombination resolves the multimeric structure into noncner
units. Hence if too much FLP resulted in premature inhibition of FLP
recombinase, then the multimers night not get resolved. Therefore we
suggest that the extra symmetry element functions to modulate the
stoichiometry of the reaction by acting as a 'sink' for excess FLP and
thereby preventing untimely inhibition of the FLP reaction.
In this paper we have also further refined the determination of the
minimal duplex DNA sequence needed for FLP-mediated recombination. Our
4799
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
previous analytical studies Bade use of exonucleolytic digestion to define
the ninimal duplex DNA requirement (21). Our present results confirm and
eitend these observations: the smallest duplex sequence that is able to
undergo recombination jjj vitro comprises an 8 bp core sequence surrounded by
two 7 bp inverted symmetry elements. Removal of two further bp from each
end abolishes recombination. Since our previous studies suggested that
removal of an additional base pair from either end of the FLP site might
s t i l l allow recombination (21), one cannot exclude the poss ibi l i ty that a 20
bp FLP site might exhibit recombination _ifl vitro. A further minor
discrepancy between the present study and our previous results (21) is that
the latter work suggested that an additional 5 bp of the top strand in
symmetry element 'b' are needed for recombination (see boxed sequence.
Figure 1 ) . This may have been due to the fact that the FLP site being
deleted by the exonuclease was located at the end of the recombination
substrate. Alternately, it could have been due to the contacts of the FLP
protein with the top strand that are more important than those on the bottom
strand of this symmetry element. While we find that a 22 bp site is
competent to perform intramolecular recombination with a wild-type site
(Figure 6, panel C), it does require a somewhat higher level of FLP to
aohieve 50* excision. Ve have shown that this 22 bp sequence binds FLP
poorly as measured by a gel retardation assay or a Uillipore f i l t e r binding
assay (B. Andrews, manuscript submitted). It is thus somewhat surprising
that intermolecular recombination between two 22 bp target sequences is
detectable at a l l . We are investigating the poss ibi l i ty of cooperative
interactions between a wild-type site and a truncated one.
We consistently observe that the FLP-site contained in pGPl/2 (Table 1,
line 5) recombines more effectively than all other truncated FLP s i tes (see
Figure 7 ) . Inspection of the sequences in Table 1 ( l ines 1 and 5) reveals
that fortuitously five of the thirteen base pairs in pGPl/2 correspond to
those in the same positions of symmetry element ' o ' . Moreover four of these
btse pairs constitute olose contaots for the FLP protein (B. Andrews,
unpublished; R. Bruckner and M. Cox, personal communication). Thus i t is
conceivable that these sequences might constitute a binding domain for the
FLP protein that increases the efficiency of recombination.
Jayaram (28) has shown that l a vivo, a shortened synthetic FLP site was
sble to recombine with endogenous 2-micron plasmid but with reduced
efficiency. However since this assay involves an equilibrium between
intermolecular recombination and intramolecular recombination and since the
4800
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
latter event would score at negative in thi« titty, it it difficult to
compare the i c vivo and the _i_n vitro retultt. Since we find that
intranolecnltr recombination it more efficient than intermolecular
recombination _in vitro, it it pottible that the i s vivo attay underestimate!
the frequency of FLP-meditted recombination.
Thit work vat tupported by the Medical Research Council of Canada.
P. S. i t a Career Inve t t iga tor of the tane agency. We thank Janice Reid for
her pat ient preparation of the manotcript. We thank Dr. Michael Cox for
communicating r e t u l t t in advance of p u b l i c a t i o n .
REFERENCES1 . Zieg, J . , Silverman, M., Hilmen, H. and Simon, M. (1977) . Science
124:170-172 .2 . lamp, D. , Choir, L.T. , Broker, T.R., Kir oh, D. , Zipter , D. and Kahmann, R.
(1979) . Cold Spring Harbor Symp. Quant. B i o l . 41:1159-1167.3 . I ida , S. , Meyer, J . , Kennedy, H.E. and Arber, W. (1982) . EMBO J .
1:1445-1453.4 . P la t terk , R.H.A. and van de Putte , P. (1984) . Biochim. Biophyt. Acts .
242.: 111-119.5. Nath, H.A. (1981) . Ann. Rev. Genet. 15.: 143-167.6 . Tonegawa, S. (1983) . Nature Ifl2.: 575-581.7. Clark, S .P. , Tothikai , Y., Taylor, S . , Siu, G., Hood, L. and Mak, T.W.
(1984) . Nature 111:387-389 .8. Gatcoigne, M.R.J., Chien, Y., Becker, D.M., Kavaler, J. and Davi t , M.M.
(1984) . Nature H f i : 3 8 7 - 3 9 1 .9 . Abremtki, K., Hoett, R. and Sternberg, N. (1983) . Cell 12.: 1301-1311.10. Abrentki, K. and Hoe i t , R.H. (1984) . J. B i o l . Chen. 212.: 1509-1514.1 1 . Weitberg, R.A. and Landy, A. (1983) . In Lambda I I , Hendrix, R.W.,
Roberta, J.W., Stahl , F.W. and Weitberg, R.A., edt . pp.211-250. ColdSpring Harbor Laboratory, Cold Spring Harbor, New York.
12 . Vetter , D . , Andrewt, B . J . , Robertt-Beatty , L. and Sadowtki, P.D. (1983) .Proc. Nat l . Aoad. S c i . USA £P_: 7284-7288.
1 3 . Sadowtki, P.D. , Lee, D.D. , Andrew•, B .J . , Babineau, D. , Beatty , L . ,Morte, M.J., Proteau, G. and Vet ter , D. (1984) . Cold Spring HarborSymp. ftuant. B i o l . 42 :789-794 .
14 . Meyer-Leon, L . , Senecoff, J . F . , Bruckner, R.C. and Cox, M.M. (1984) .Cold Spring Harbor Synp. ftuant. B i o l . 4_£: 798-804.
15. Hartley, J .L. andDonelson, J .E . (1980) . Nature 2fi£: 860-865.16 . Broach, J.R. and Hickt , J .B . (1980) . Cell 21 :501-508 .17. Broach, J.R. and Guaratcio, V.R. and Jayaram, M. (1982) . Cell
22 :227-234 .18. Cox, M.M. (1983) . Proc. Nat l . Aoad. Soi . USA fi0_: 4223-4227.19. Babineau, D., Vet ter , D . , Andrewt, B .J . , Gronostajtki , R.M., Proteau,
G.A., Beatty, L.G. and Sadowtki, P.D. (1985) . J. B i o l . Chen.2 M : 12313-12319.
20 . Andrewt, B . J . , Proteau, G.A., Beatty, L.G. and Sadowtki, P.D. (1985) .Cell 1ft:795-803.
2 1 . Gronottajtki , R.M. and Sadowtki, P.D. (1985) . J. B i o l . Chora.: 12320-12327.
4801
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018
Nucleic Acids Research
J. B i o l . Chan.
2 2 . Meaaing, J. (1979) . NIH Pnbl icat iona , No. 79-99 ( 2 ) : 4 3 - 4 8 .2 3 . Vio ira , J. and Meaaing, J. (1982) . Gene 19_:259-268.2 4 . Sanchez-Peacador, R. and Urdea, M.S. (1984) . DNA 3_: 339-343.2 5 . Gronoatajaki, R.M. and Sadowaki, P.D. (1985),
2 M : 12328-12335.2 6 . Maniatia, T . , Fr i tach , E.F. and Sambrook, J. (1982) . 'Molecular
Cloning, a Laboratory Manual', Cold Spring Harbor Laboratory, ColdSpring Harbor, Ne» York.
27 . Maxam, A.M. and Gi lbert , V. (1980) . Meth. Eniynol . £5_: 499-560.28 . Jayaraa. M. (1985) . Proc. Natl . Acad. Sc i . USA j£2_:5875-5879.29 . Seneooff, J . F . , Bruckner, R.C. and Cox, M.M. (1985) . Proc. Nat l . Acad.
S c i . USA 8 .: 7270-7274.30 . Mizuuchi, E . , Teiaberg, R., Enquitt, L. , Mizuuchi, M., Buraczynaka, M.,
F u e l l e r , C , Hau, P . -L . , Roaa, ». and Landy, A. (1981) . Cold SpringHarbor Symp. Quant. Bio l . 4£:429-437.
3 1 . Hoeaa, R.H. and Abreaaki, E. (1985) . J. Mol. B i o l . 181:351-362.32 . Futcher, A.B. (1986) . J. Theor. B i o l . ( i n p r e a a ) .
4802
Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018