THE JOURNAL OF BIOLCGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry , and Molecular ' Biology, Inc.

VOl. 269, No. 41, Issue of October 14, pp. 25677-25683,1994 Printed in U.S.A.

'Molecular Cloning and Chromosome Localization of a Putative Basolateral Na+-K+-2Cl- Cotransporter from Mouse Inner Medullary Collecting Duct (mIMCD-3) Cells*

(Received for publication, June 6, 1994, and in revised form, August 4, 1994)

Eric DelpireSOn, Michael I. RauchmanSO, David R. Beierll, Steven C. Hebed$**, and Steven R. GullansS $$ From the w a r v a r d Center for Study of Kidney Disease, Renal Division, Harvard Medical School and the /Division of Genetics, Department of Medicine, Brigham and Women's Hospital, Boston, Massachusetts 02115

Electroneutral Na+-K'-2Cl- cotransporters represent one of the major routes for C1- movement in epithelia. A secretory form of the cotransporter has been described in the basolateral membrane of a variety of epithelia from fish to mammals. We isolated a putative bumet- anide-sensitive Na'-K+-2Cl- cotransporter cDNA, BSC2, from mIMCD-3 cells. Northern analysis indicates that in contrast to BSC1, the recently cloned renal-specific ap- ical isoform of the cotransporter, BSC2 is expressed in secretory epithelia and thus appears to represent the basolateral isoform. Furthermore, BSC2 is also ex- pressed in non-polarized cells, such as red cells and myocytes. Sequence comparison and chromosome local- ization demonstrate that BSC2 and BSCl are different genes that diverged before the evolution of vertebrates.

The Na+-K+-2Cl- cotransporter is ubiquitously expressed in animal tissues and serves a variety of physiological functions (for review, see OGrady et al., 1987; Haas, 1989). In salt and fluid secretory epithelia, such as the salivary gland and tra- chea, the Na+-K+-2Cl- cotransporter is localized to the basolat- era1 membrane and represents the cellular entry mechanism for transepithelial ion transport. Conversely, in some salt-ab- sorptive epithelia, such as the renal thick ascending limb of Henle, there is an apical Na+-K+-2C1- cotransporter involved in transepithelial ion transport. In addition, Na+-K+-2Cl- cotrans- port is known to play a prominent role in cell volume regulation in most mammalian cell types (Palfrey and O'Donnell, 1992).

Physiological studies suggest that at least two isoforms of the Na+-K+-2Cl- cotransporter exist in mammals. One isoform, which mediates apical ion entry in the renal thick ascending limb of Henle, has a higher affinity for loop diuretics, such as bumetanide (Forbush and Palfrey, 19831, a higher afflnity for C1- (Kinne et al., 19851, and is weakly sensitive to cell volume changes (Hebert and Sun, 1988). The putative alternative iso- form, in addition to showing differences in affinities for diuret- ics and ions, is acutely activated by cell shrinkage (Palfrey and O'Donnell, 1992).

Grants HL49251 (to E. D.) and DK36031 (to S. R. G.) and by Grant-in- * This work was supported in part by National Institutes of Health

aid 13-592-912 from the American Heart Association, Massachusetts affiliate (to E. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

8 Contributed equally to this work.

en's Hospital, Renal Division, 75 Francis St., Boston, MA 02115. Tel.: 7 To whom correspondence should be addressed: Brigham and Wom-

** Supported in part by National Institutes of Health Grant

$$ An Established Investigator of the American Heart Association.

617-732-5707; Fax: 617-732-6392.

DK36803.

Recently, Gamba and co-workers (1994) cloned cDNAs encod- ing both a bumetanide-sensitive Na+-K+-2Cl- cotransporter (BSC1)' and a thiazide-sensitive sodium chloride cotransporter (TSC) from rat kidney. These transporters showed considerable sequence homology indicating they are members of a poten- tially larger gene family. Interestingly, Northern analysis of BSCl indicated it to be a 4.6-kb transcript that was expressed only in the renal cortex and outer medulla. Similar observa- tions were made in rabbit kidney where a 5.2-kb kidney-spe- cific cDNA (NKCC2) was isolated (Payne and Forbush, 1994). This suggested that BSCl and NKCC2 encode an apical iso- form of the Na+-K+-2Cl- cotransporter, and another isoform remains to be identified. In fact, Xu and colleagues (1994) re- cently cloned a cDNA encoding a bumetanide-sensitive cotrans- porter (NKCC1) from shark rectal gland that shows significant homology to TSC and BSC1. Moreover, Northern analysis of NKCCl indicated that it is ubiquitously expressed in shark tissues as well as the rectal gland, a salt secretory epithelium.

The purpose of the present investigation was to clone the bumetanide-sensitive Na+-K+-2Cl- cotransporter cDNA ex- pressed in most mammalian tissues. A mouse inner medullary collecting duct cell line, mIMCD-3 (Rauchman et al., 1993), was used because it possesses basolateral Na+-K+-Cl- cotransporter activity but does not express the BSCl transcript. Using a PCR strategy based on conserved transmembrane domains of three members of this gene family, rBSC1, rTSC, and flTSC (Gamba et al., 1993, 1994), we isolated a 4.7-kb cDNA (mBSC2) that appears to encode a ubiquitously expressed murine Na+-K+- 2C1- cotransporter.

EXPERIMENTAL PROCEDURES Cell Culture and RNA Isolation-mIMCD-3 cells, derived from the

terminal portion of the inner medullary collecting duct of an SV40 transgenic mouse (Rauchman et al., 1993), were grown on 10-cm Petri dishes in Dulbecco's modified Eagle's mediudam's F-12 (1:l) (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (JRH Biosciences, Lenexa, KS), 50 unitdml penicillin, and 50 pg/ml strepto- mycin. Total RNA was isolated from mIMCD-3 cells using the method of Gough (1988). Briefly, cells from confluent dishes were recovered by scraping and spun in 1.5-ml microcentrifuge tubes at 700 x g at 4 "C for 5 min. Then, cell pellets were resuspended into 300 pl of lysing solution containing 10 m~ tris(hydroxymethy1)aminomethane HCI (pH 7.5), 150 m~ NaC1, 1.5 mM MgCI,, 0.65% Nonidet P-40. Next, the nuclei were removed by centrifugation at 11,000 x g at 4 "C for 5 min. The super- natants were added to tubes containing 300 pl of phenol, 300 1.11 of chlorofordisoamyl alcohol (50:1), and 300 pl of a solution containing 7 M urea, 1% SDS, 350 mM NaCl, 10 mM EDTA, and 10 mM Tris-HC1 (pH

2C1- cotransporter; TSC, thiazide-sensitive sodium chloride cotrans- The abbreviations used are: BSC, bumetanide-sensitive Na+-K+-

porter; kb, kilobaseb); bp, base paids); IMCD, inner medullary collect- ing duct; PCR, polymerase chain reaction; SSCP, single strand conformation polymorphism.

25677

25678 Molecular Cloning of Mammalian Na+-K+-2Cl- Cotransporter 7.5). After vortexing, the tubes were spun 2 min at 8400 x g, and the aqueous solution containing the RNA was recovered. RNA was then precipitated with sodium acetate and ethanol, pelleted, lyophilized, and resuspended into RNA-grade distilled water. Total RNA was igolated from mouse tissues using the guanidiniundisothiocyanate-cesium chlo- ride method (Sambrook et al., 1989). Briefly, isolated tissues were rap- idly frozen in liquid nitrogen, and 1 g of frozen aliquots were homog- enized in 7 ml of a 4 M guanidine thiocyanate, 22 mM sodium acetate, 1.12 g/ml mercaptoethanol solution. The 7-ml homogenate was layered on 4 ml of a 5.7 M CsC1, 24 mM sodium acetate solution in polyallomer ultracentrifuge tubes (Beckman). The tubes were spun at 32,000 rpm a t 20 "C overnight. The supernatant was then discarded and the RNA pellet resuspended into water and precipitated with sodium acetate and ethanol. Poly(A)+ RNA was prepared using total RNA from mIMCD-3 cells with oligo(dT)-cellulose affinity chromatography (Collaborative Research).

86Rb Uptake-mIMCD-3 cells were cultured on polycarbonqte mem- branes in 24-mm transwells (Costar Corp., Cambridge MA). Culture medium was replaced by a phosphate-buffered saline (Life Technolo- gies, Inc.), supplemented with 5 mM glucose in the presence or absence of 500 PM bumetanide, for a 30-min preincubation period a t room tem- perature. Apical or basolateral solutions were then replaced with iden- tical solution containing 2 pCi/ml 86Rb for a 10-min incubation at room temperature (86Rb uptake was linear over a period of 60 min). The uptake was stopped by two rapid washes in ice-cold phosphate-buffered saline containing 500 p~ bumetanide. Filters were detached from the transwells with a fine scalpel blade and placed in 15 ml of scintillation liquid. Preliminary experiments performed in parallel on 6 individual wells demonstrated identical uptakes for each well. The uptakes were therefore performed in triplicates, and the fluxes were expressed in pmol/dish/min.

Reuerse Transcriptase PCR-Based on highly homologous regions of the putative 1st and 10th transmembrane domains of flTSC (Gamba et al., 1993), rTSC, and rBSCl (Gamba et al., 1994), we designed sense and antisense degenerate 23-oligonucleotide primers with the following sequences: 5'-(A/G)TN(A/C)GNTG(CIT)ATG(CPT)TNAA(CPT)AT(A/C/T)- TGG-3' and 5'-TA(CPT)GCN(CIT)TNAT(A/CPT)AA(T/C)'IT(T/C)(~)(G/ C)NTG(T/C)-3', respectively. Total RNA 15 pg) isolated from mIMCD-3 cells was reverse-transcribed at 37 "C for 1 h using random hexamers and the Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). The polymerase chain reaction contained 16.75 pl of water, 2.5 1.11 of PCR buffer (Perkin Elmer), 2 1.11 of MgCl, (25 mM), 0.5 pl of dNTPs (10 mM each), 1 pl of single-stranded cDNA, 1 pl of each primer (stock concentration of 0.250 pg/pl), and 1.25 units of Taq polymerase (Perkin Elmer). Cycling conditions were chosen as follows: 94 O (1 rnin), 56 "C (annealing temperature) (2 rnin), 72 "C (1 min) 35 times followed by a final extension step at 72 "C for 5 min. The reaction products were then separated in a 1% agarose gel, and the 1200-bp PCR fragment was extracted and subcloned into pCRlOOO (Invitrogen).

mIMCD-3 cDNA Libraries-Directional cDNA libraries were con- structed from 5 pg of mIMCD-3 poly(AY RNA using the plasmid vector pSPORTl (Superscript, Life Technologies, Inc.). Ligated clones were electroporated into ElectroMAX DHlOB cells (Life Technologies, Inc.), which were plated on agarlampicillin at a concentration of 5000 colonies per 150-mm plate. Colonies were lifted onto nitrocellulose transfer membrane (Schleicher & Schuell), lysed with 10% SDS for 5 min, 0.5 M NaOH for 5 min, neutralized with 0.5 M Tris for 5 min, and washed with 2 x SSC for 5 min (1 x SSC = 150 m~ NaCl, 15 mM sodium citrate). The membranes were uv-cross-linked and hybridized at 42 "C for 16 h with a 32P-labeled cDNA probe made from the 1200-bp PCR fragment. The filters were then washed twice for 20 min at room temperature with 2 x SSC, 0.1% SDS, once for 30 min a t 65 "C with 0.2 x SSC, 0.1% SDS, and then exposed to autoradiography film for 6-24 h. Positive colonies were then replated at low density (100-200 colonies/plates) for a sec- ondary screening. Approximately 200,000 primary colonies were screened, and two overlapping cDNAs were isolated and used to con- struct a 4,707-bp cDNA (mBSC2) using a mutual KpnI site. :

cDNA Sequencing-Sense and antisense strands of 4065-bp cDNA were sequenced by the dideoxynucleotide termination method using Tag polymerase and PCR. The sequencing reactions were run on an automated DNA sequencer ( A B 1 373A, Applied Biosystems) at the Biopolymers Facilities (Howard Hughes Medical Institute, Harvard Medical School). Due to sequencing problems with the Taq polymerase, the initial 650 bp at the 5'-end of the cDNA were sequenced in both directions using Sequenase DNA polymerase (Sequenase Version 2.0, U. S. Biochemical Corp.). The reactions were then run on 6% polyacryl- amide gels. Nucleotide and amino acid sequence analyses were per- formed using Geneworks 2.2 (IntelliGenetics, Inc., Mountain View, CA).

Northern Analysis-Total RNA samples were run on a 1% agarose, 0.63% formaldehyde gel and transferred to nylon membranes. The uv- cross-linked membranes were prehybridized at 42 "C for 2 h with 40% (dv) formamide, 10% dextran sulfate (American BioAnalytical), 4 x SSC, 7 mM Tris (pH 7.6), 0.8 x Denhardt's solution ( I x consists of 0.02% polyvinylpyrrolidone, 0.02% Ficoll, and 0.02% bovine serum albumin), 0.02 mg/ml salmon sperm DNA (Sigma), and 0.5% SDS. 32P-Labeled cDNA probe was prepared from -100 ng of the 1200-bp insert using random hexamer primers dATP, dGTP, dTTP (Pharmacia Biotech Inc.), and [P3'1dCTP (DuPont NEN). The probe was added to the hybridiza- tion solution (lo6 cpdml ) for an overnight incubation. Membranes were then subjected to two low stringency washes (2 x SSC, 0.1% SDS for 20 min a t room temperature) before a high stringency wash in 0.2 x SSC, 0.1% SDS for 30 min at 65 "C.

RNA Digestion Mapping-Poly(A)t RNA (5 pg) and 500 pmol of a specific 17-20 oligomer were denatured at 65 "C for 2 min in a solution containing 120 mM KC1 and 12 m~ MgCl,. The oligonucleotide was then allowed to hybridize with the RNAfor 30 min at room temperature. The RNA/DNA hybrid was then digested with 2 units of RNase H (Life Technologies, Inc.) for 30 min at 37 "C in a buffer containing 60 mM KCI, 12 mM MgCl,, 62.5 mM Tris (pH 7.81, and 5 mM dithiothreitol. The digestion was stopped by the addition of EDTA (20 mM finaI) and sodium acetate (pH 5.5, 300 mM final). The RNA was purified by phenol/ chloroform extraction, ethanol-precipitated, separated by agarose/ formaldehyde gel electrophoresis, and transferred to a nylon membrane for Northern analysis.

SSCP Analysis-Primers were designed to amplify a region corre- sponding to the 3"untranslated sequence of the mBSC2 cDNA to test for SSCPs between mouse strains. These were analyzed as previously described (Beier et al., 1992). Briefly, oligonucleotides (obtained from Research Genetics, Huntsville, A L ) were radiolabeled with [32P]ATP, and genomic DNA from a series of mouse strains was amplified using PCR. The PCR reaction mixture contained 10 mM Tris-HC1,50 mM KC], 1.5 mM MgCl,, 1 p~ of each primer, 1 pg of genomic DNA, 0.2 mM dNTP, and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer). 40 thermo- cycles (94 "C, 1 min; 55 "C, 1 min; and 72 "C, 2 min) were performed before a final extension reaction for 5 min at 72 "C. An aliquot of the PCR reaction (2 pl) was added to 8.5 pl of stop solution (U. S. Biochemi- cal Corp.) and denatured at 94 "C for 5 min; 2 pl of it was loaded on a 5% nondenaturing polyacrylamide gel containing 45 mM Tris borate and 1 mM EDTAand electrophoresed. The gel was transferred to filter paper, dried, and autoradiographed with an intensifying screen overnight. A primer pair with the sequence CCCACCGACCAGTTAGTG (forward) and GGGTAGATCATCAGTCATCTC (reverse) identified a series of polymorphisms. Since these primers identified a polymorphism be- tween strains C57BU6J and DBA/2J, they were used to analyze DNA prepared from the BxD recombinant inbred series (obtained from Jack- son Laboratory, Bar Harbor, ME). The stain distribution pattern was analyzed using the Map Manager program (Manley and Elliot, 1991).

RESULTS

Evidence for a Basolateral Na'-Ki-2Cl- Cotransporter in mZMCD-3 Cells-To demonstrate the existence of the Na+-K+- 2C1- cotransporter in the basolateral membrane of the inner medullary collecting duct (mIMCD-3) cell line, we grew the cells on polycarbonate supports in a transwell system. We pre- viously demonstrated that in these culture conditions, the cells form a very tight polarized epithelium with high electrical re- sistance (Rauchman et al., 1993). As indicated in Fig. 1, bumet- anide-sensitive 86Rb uptake was predominantly mediated from the basolateral membrane; a small component was attributable to apical entry. Additional evidence that the mIMCD-3 cell basolateral Na+-K+-2Cl- cotransporter may represent a differ- ent isoform from the apical BSCl cotransporter expressed in the outer medulla of the kidney (Gamba et al., 1994) was ob- tained by probing a Northern blot under low stringency condi- tions with the cDNA encoding the thiazide-sensitive NaCl co- transporter. Under these conditions, this probe detects the 4.6-kb BSCl transcript of the renal outer medulla. When used to probe the mIMCD-3 cell RNA under low stringency condi- tions, the flTSC probe revealed a significantly larger (6.5 kb) transcript (not shown), suggesting the existence of a second isoform.

Molecular Cloning of Mammalian Na+-K+-2Cl- Cotransporter 25679

1

ADical Basolateral

mIMCD-3 cells. s6Rb uptake was performed on mIMCD-3 cells grown FIG. 1. Evidence for a basolateral Na+-K+-2Cl- cotransporter in

on polycarbonate filters in the presence of 2 pWm1 86Rb, 3.8 mM K+ and in the presence or absence of 500 p~ bumetanide. The bumetanide- sensitive uptake represents the difference between the flux in the ab-

over three measurements on individual filters. Note that the bumet- sence and presence of the inhibitor. Each bur represents mean * S.D.

solateral side as compared with the apical side. anide-sensitive uptake was predominant when measured from the ba-

Cloning of the Basolateral Na’-Kt-2C1- Cotransporter-The cloning strategy was based on a high degree of homology exist- ing among flounder (Gamba et al., 1993) and rat thiazide-sen- sitive sodium chloride cotransporters and rat apical bumet- anide-sensitive Na+-K+-2Cl- cotransporter (Gamba et al., 1994). Degenerate primers were designed from highly homolo- gous transmembrane domains of these three proteins and used in a PCR reaction with cDNA reverse-transcribed from total RNA extracted from mIMCD-3 cells. A 1200-bp PCR fragment was isolated, cloned, and sequenced. DNA sequence analysis indicated it to be homologous to the other cotransporters (76 and 69% identity with rBSCl at the amino acid and nucleotide levels, respectively). The PCR fragment was then used to screen a size-selected (>1 kb) cDNA library prepared from mIMCD-3 cells. Two overlapping cDNA clones were isolated, and a cDNA of 4.7 kb was constructed. Sequence analysis of the 4.7-kb cDNA clone revealed the existence of a short 129-bp 5’-untranslated sequence, an open reading frame with a Kozak consensus sequence (CCATGG), and a 3’-untranslated se- quence containing a polyadenylation signal (AATAAA) 21 nucleotides upstream from the poly(A) tail (Fig. 2).

Deduced Amino Acid Sequence-The 4.7-kb mBSC2 cDNA encodes for a 1205-residue protein with a calculated molecular mass of about 130 kDa. Hydropathy analysis using the Kyte- Doolittle algorithm (Kyte and Doolittle, 1982) predicts 12 po- tential transmembrane domains and two large hydrophilic ter- mini, consistent with the hydropathy profile of the other members of this family of cotransporters (Gamba et al., 1993, 1994; Xu et al., 1994). The Eisenberg algorithm (Eisenberg et al., 1984) predicts 15 a helices. Three of them, characteristic of globular proteins, are located at the amino and carboxyl ter- mini; two helices, characteristic of surface proteins interacting with membranes, correspond to the 1st and 12th transmem- brane domains of the Kyte-Doolittle based model. Finally, the 10 remaining helices correspond to the 2nd to 11th membrane- spanning segments. Prosite analysis of the protein revealed two putative N-linked glycosylation sites, one potential CAMP- dependent protein kinase, and eight potential protein kinase C phosphorylation sites (Fig. 2). 11 casein kinase I1 consensus sites are also distributed in the amino and carboxyl termini of the protein. Analysis of amino acid clusters revealed the amino terminus to be rich in proline, arginine, and alanine with a

stretch of 15 consecutive alanine residues. Amino acid align- ment revealed the mBSC2 protein to be most closely related to the shark rectal gland NKCCl protein. Very high homology is found in the protein segment comprising the 12 membrane- spanning domains (83%) and surprisingly in the entire car- boxyl terminus portion of the proteins (78%). In contrast, very low homology exists in the NH, terminus of the proteins (47% overall) with the exception of the 85 residues closest to the first transmembrane segments (81% identity), which contain the putative CAMP-sensitive phosphoacceptor site previously de- scribed by Lytle and Forbush (1992).

Analysis of mRNA Danscripts-High stringency hybridiza- tion of a 32P-labeled cDNA probe made from the PCR fragment (nucleotides 989-2188) with a Northern membrane containing 3 pg of poly(A)+ RNA isolated from mIMCD-3 cells revealed the existence of a major transcript at 6.5 kb and two lesser abun- dant transcripts of 3.9 and 4.7 kb (Fig. 3A). Because the 4.7-kb mBSC2 cDNA is smaller than the predominant 6.5-kb tran- script, we performed additional experiments to elucidate the identity of the larger transcript. As indicated in Fig. 3B, the 6.5-kb transcript was also detected when cDNA probes were made from either the 3’-untranslated sequence (terminal 580 bp) or the 5’-end (initial 390 bp) of the 4.7-kb cDNA clone. This suggests that the 6.5-kb transcript represents a larger tran- script of the same mBSC2 gene. To determine the location of the additional 2.1-kb fragment

in the 6.5-kb message, we performed RNA mapping by using RNase H digestion of RNA/DNA hybrids. Two oligonucleotides were selected near the two ends of the 4.7-kb cDNA clone: 3’-oligo (position 3809, 5‘-ACGCTCTGATGATTCCCACG-3’) and 5’-oligo (position 610,5’-AAGCTCACACG’M’GGGCCC-3’). Provided that the 5’-end of our 4.7-kb cDNA corresponds to the 5‘-end of the 6.5-kb mRNA, digestion of poly(A)+ RNA at the position of the 5’-oligo should generate a 610-nucleotide RNA fragment. In contrast, if the 3’-end of the cDNA matches the 3’-end of the mRNA, digestion at the location of the 3’-oligo should generate an RNA fragment of 980 nucleotides. As indi- cated in Fig. 4, RNase H digestion in the presence of the 5’-oligo generated a small (600-700 nucleotides) fragment as expected, demonstrating that the larger transcript did not contain a sig- nificantly larger 5’-untranslated sequence than the mBSC2 cDNA. In contrast, digestion of the RNA at the 3’-oligo site generated a 2.7-kb fragment, 1700 nucleotides larger than ex- pected. This demonstrates that the 6.5-kb mRNA represents an extension of the 3‘-untranslated sequence with an alternative polyadenylation site.

Tissue Distribution-Tissue distribution was also examined by Northern analysis (Fig. 5). The 6.5-kb transcript was found in a wide variety of tissues including brain, thymus, trachea, lung, heart, skeletal muscle, kidney, testis, and colon. The high- est levels of expression were found in salivary gland and stom- ach. The tissues not expressing BSC2 were liver and spleen. In some samples, a transcript larger than 6.5 kb was also observed (e.g. stomach or Madin-Darby canine kidney cells). The signifi- cance of this transcript is unknown. However, the fact that it was not seen with poly(A)+ RNA samples (Fig. 3) suggests the absence of a significant poly(A) tail. We also examined the level of BSC2 expression in different cell lines (Fig. 6) and found high levels of expression in Madin-Darby canine kidney cells, mouse erythroleukemia cells, and mouse myocyte (C2C12) cells. Other cells such as rat glioma (C6), rat pituitary (GH3), and human colonic (T84) cells exhibited lower levels of expression while the transcript was absent in human umbilical vein endothelial cells, rat mesangial cells, and pig LLC-PK1 cells.

Chromosome Localization of the mBSC2 Gene-SSCP anal- ysis was used to map the mBSC2 gene (Beier et al., 1992). As

210 1 0 5

3 1 5

4 2 0

525

630

7 3 5

840

94 5

1050

1155

1260

1 3 6 5

1470

1575

1680

1785

1890

1 9 9 5

2100

2 2 0 5

2310

2 4 1 5

2520

2625

2730

2 8 3 5

2 9 4 0

3045

3150

3255

3 3 6 0

3465

3 5 7 0

3675

3 7 8 0

FIG. 2. Nucleotide and predicted amino acid sequence of the 4.7-kb cDNA clone, mBSC2, encoding the putative basolateral Na+-K+-2Cl- cotransporter. Nucleotide positions are numbered on the right. The 12 putative transmembrane domains are bold-underlined. Eight putative protein kinase C consensus phosphorylation sites (bold) and one CAMP-dependent (protein kinase A) consensus site (underzined) are indicated in three letters. T W O potential N-linked glycosylation sites (bold N , positions 546 and 555) are located in the potential extracellular

Molecular Cloning of Mammalian Na+-K+-2Cl- Cotransporter

9.5 - 7.5 - 4.4 - 2.37 - 1.35-

0.25 - A B C

FIG. 3. mRNA transcript analysis in mIMCD-3 cells. Northern membranes containing 3 pg of poly(A)+ RNA isolated from mIMCD-3 cells were hybridized with :I2P-labeled cDNA probes selected from the transmembrane domain of the protein (1200-bp PCR fragment) (A), the 3'-end (final 580 bp) (B) , or the 5'-end (initial 390-bp fragment) of the 4.7-kb cDNA clone (mBSC2) (C). All three membranes were washed a t high stringency (65 "C, 30 mM NaCI). Autoradiograph exposure times were 24, 6, and 24 h, respectively. Note the predominance of the 6.5-kb message with the three different probes. Also note the existence of two smaller transcripts of lesser abundance on the membrane probed with the 1200-bp probe (A). Longer exposures reveal that these two tran- scripts are also apparent with the 3' probe. In contrast, the GC-rich 5' probe generates much higher backgrounds, which do not uncover the lower abundance transcripts.

indicated in Fig. 7, polymorphism was observed for a 3'-un- translated fragment of the mBSC2 cDNA, three different con- formations of the PCR-amplified single-stranded DNA frag- ment were observed in the nine mouse strains analyzed. SSCP analysis was then performed in substrain members of the well defined BxD recombinant inbred series and compared with the distribution pattern of known chromosome markers. We found that the strain distribution pattern of the mBSC2 gene frag- ment unambiguously matches the pattern of microsatellite markers located on chromosome 18; one recombinant was found in 22 lines between mBSC2 and D18MIT10, which cor- responds to a genetic distance of 1.22 2 1.28 centimorgan.

DISCUSSION Epithelial salt secretion was shown early on to involve a

basolateral electroneutral Na+-K+-Cl- cotransport mechanism (for review, see Frizzell et al., 1979). Recent models of salt secretion consider the basolateral Na+-K+-2Cl- cotransporter to be the main entry pathway for Na+ and C1- in epithelial cells, e.g. respiratory mucosa (Welsh, 1987), salivary glands (Peterson, 1992), and lacrimal glands (Saito et al., 1987). The Na+ gradient is then maintained by actively extruding Na+ through the Na+/K+ pump, while C1- exits the cells through an apical C1- channel, and the transepithelial movement of Na+ occurs through the paracellular pathway driven by an electro- negative lumen. While the physiology of the mammalian baso- lateral Na+-K+-2Cl- cotransporter has been extensively stud- ied, the identity of this cotransport protein is unknown.

In the present work, we used a PCR homology-based strategy to isolate the cDNA encoding for this important basolateral cotransporter in mammalian C1- secretory epithelia. We based our approach on the hypothesis that the secretory form of the cotransporter constitutes a different isoform of the apical (renal specific) cotransporter, recently cloned by Gamba and co-work- ers (1994) as well as by Payne and Forbush (1994). Since we

9.5 - 6.2 - 3.9 - 2.8 - 1.9 - 0.87

25681

4

4 4

A B C 6.5-kb major mRNA transcript. Poly(A)' RNA (5 pg) was digested

FIG. 4. Evidence for a %'-extension of the 4.7-kb cDNA in the

with RNase H a t specific sites of the 4.7-kb mBSC2 cDNA clone. A, poly(A)+ RNA was digested with RNase H at a site corresponding to 690 bp from the 5'-end of the mBSC2 cDNA, 1 pg of untreated RNA was run in a parallel lane as control. The membrane was probed with a random hexamer-primed szP cDNA probe made from the full-length 4.7-kb mBSC2 cDNA. B and C, RNA digested with RNase H a t a site corre- sponding to 980 bp from the 3'-end of the mBSC2 cDNA. The digestion reaction was loaded on two separate gels with 1 pg of untreated RNAas control in each gel. RNA was transferred to nylon membranes and probed with either a 3' probe ( B ) or a more 5' probe (C). The 3' probe labels the small 3' fragment only whereas the more 5' probe (1200-bp fragment) labels the rest of the mRNA.

demonstrated Na+-K+-2Cl- cotransport in the basolateral mem- brane of mIMCD-3 cells (Fig. 1) and a 6.5-kb transcript was detected by low stringency Northern analysis of mIMCD-3 cells RNA using flTSC cDNA as a probe, we used the mIMCD-3 cell line to isolate the cDNA encoding the putative mammalian basolateral Na+-K+-2Cl- cotransporter. A 4.7-kb cDNA clone (mBSC2) was isolated.

Analysis of the deduced amino acid sequence of the 4.7-kb cDNA clone revealed a number of sites potentially important for the function of the protein. All these sites are consistent with the known biochemistry and regulation of the Na+-K+-2Cl- cotransport protein. In shark rectal gland (Lytle et al., 19921, cleavage of N-linked glycans reduced the size of the protein on SDS gel from 195 to 135 kDa. Note, however, that while the flTSC cotransporter and the shark rectal gland bumetanide- sensitive Na+-K+-2Cl- cotransporter possess three potential glycosylation sites on the corresponding loop, the mammalian rBSCl and mBSC2 proteins only conserve two of these three sites. The presence of a CAMP-dependent protein kinase con- sensus site is consistent with the various reports demonstrat- ing the role of CAMP in regulating the activity of the Na+-K+- 2C1- cotransporter (Pewitt et al., 1990; Lytle et al., 1992; Whisenant et al., 1991). Interestingly, although the shark rec- tal gland Na+-K+-2Cl- cotransporter activity is CAMP-depend- ent, the shark sequence did not reveal any protein kinase A consensus sites. In contrast, a high number of protein kinase C sites exist in both the shark and mouse proteins suggesting a role for protein kinase C in regulating the cotransporter. Both activation and inhibition of the Na+-K+-2Cl- cotransporter by

loop between transmembrane segments 7 and 8. The 1205-residue protein consists of a 277-residue putative cytoplasmic NH, terminus segment, a 467-amino acid membrane-spanning segment, and a cytoplasmic carboxyl terminus portion of 461 residues.

25682 Molecular Cloning of Mammalian Na+-K+-2Cl- Cotransporter

FIG. 5. Northern analysis of distribution in mouse tissues. Total RNA (10 pg) was run on a 1% agarose, 0.63% formaldehyde gel, trans- ferred to a nylon membrane, and probed with the "P-labeled 1200-bp PCR fragment. The Northern membranes were washed a t high strin- gency (65 "C, 30 mM NaCI). Autoradiographs were exposed for 24 ( top) and 8 h (bottom). The 6.5-kb transcript was detected in kidney, stomach, heart, lung, brain, and skeletal muscle. Faint bands were also detected in trachea and thymus at longer exposures (not shown). No bands smaller than 4.4 were observed.

FIG. 6. Nor thern analysis of different cell lines. The 6.5-kb tran-

was detected in C6, C2C12, GH3, mouse erythroleukemia (MEL), T84, script encoding for the putative basolateral Na+-K"2Cl- cotransporter

and Madin-Darby canine kidney (MDCK) cells (see text). The mem- branes were washed a t relatively low stringency (50 "C, 30 mM NaCI). The autoradiograph was exposed for 78 h. Only mouse and rat tissues that were positive on this panel remained positive when the membrane was reprobed with the 580-bp 3'-end probe (not shown).

protein kinase C activation have been reported (Franklin et al., 1989; Whisenant et al., 1991).

Using a mammalian expression system (human B lympho- cytes infected with an Epstein-Barr virus-derived vector), we were not able to demonstrate levels of expression greater than 1.5-2-fold over base line (not shown). These results are consist- ent with the low level of expression obtained by Xu and co- workers (1994) with the shark rectal gland cotransporter (3-4- fold activation over base line). It is not clear at this point why the putative basolateral isoforms (mBSC2 and NKCC1) result in such low levels of expression as compared with the apical isoform (rBSCl), where up to 100-fold activation can be ob- served (Gamba et al., 1994).

Sequence comparison of mBSC2 with the shark NKCCl (Xu et al., 1994), rat BSCl (Gamba et al., 19941, rabbit NKCC2 (Payne et al., 19941, and with the flounder and rat NaCl co-

BXD RI: 1 e M i t l O : UDDDD DDDBD DDDBD DDBBB BBBWJU mBsc2 : BDDDD DDDBD DDDBD DDDBB BBBDDD

FIG. 7. Single strand conformation polymorphism analysis of a 3'-untranslated fragment of the mBSC2 cDNA showing localiza- tion of mBSC2 on mouse chromosome 18. Top, SSCP pattern of mBSC2 in nine strains of mice. Three polymorphisms were observed as represented by AKR, C3H, and SP. Bottom, summary of a SSCP anal- ysis of the mBSC2 fragment in 26 recombinant inbred mouse substrains as compared with the Dl8 mitlO microsatellite. B, C57BU6J; D, DBA/ W ; U, unknown. The x denotes a crossover.

X

transporters (Fig. 8) unambiguously demonstrated mBSC2 to be most related to the shark NKCCl cDNA. This indicates that mBSC2 encodes a putative basolateral Na+-K+-2Cl- cotrans- porter. The highest regions of homology were found in the transmembrane domains and the carboxyl terminus of the pro- tein; the amino terminus was the most divergent portion of the protein. Fig. 8 also shows the calculated evolutionary relation- ships (as measured by unweighted pair group method with arithmetic mean) (Nei, 1987) of the six deduced proteins. I t can be observed that the estimated genetic distance between the fish and mammalian forms of the thiazide-sensitive sodium chloride cotransporters (TSCs, 68% identity) or the elasmo- branch and mammalian forms of the putative basolateral iso- form of the Na+-K+-2Cl- cotransporter (mBSC2 and NKCC1, 71% identity) are significantly shorter than the distance be- tween the two Na+-K+-2Cl- cotransporter isoforms (BSC1, BSC2, NKCC1, NKCC2; 45% identity). This sequence compar- ison implies that the two BSC isoforms diverged at a period of time prior to vertebrate evolution. I t also strongly suggests that these two isoforms are encoded by two different genes.

In the mouse, we mapped the mBSC2 gene by SSCP to chro- mosome 18, tightly linked to the microsatellite marker D18MIT10. This locus is flanked by the genes Fgf-1, which has been mapped to 5q31-33 in humans, and Pdgfrb, which has been mapped to 5q33. Since subchromosomal linkage relation- ships are conserved in many cases between mouse and man, this result suggests that the human homolog of mBSC2 will be found on chromosome 5q31-33. Recently, Baekgaard and co- workers isolated the mouse homolog of the rat (Gamba et al., 1994) and rabbit (Payne and Forbush, 1994) apical isoform of the cotransporter (BSC1) and mapped it to chromosome 2.' Thus, distinct chromosome localization for these two isoforms of the cotransporter unambiguously demonstrates the exist- ence of two separate genes, confirming our previous hypothesis based on very distinct tissue localization and transcript sizes as well as significant sequence differences (e.g. Fig. 8).

A. Baekgaard, M. Lombardi, M. Kaplan, D. R. Beier, E. K. Hoffman, and S. C. Hebert, unpublished results.

Molecular Cloning of Mammalian Na+-K+-2Cl- Cotramporter 25683

Homoloa Tree of Electroneutral Cotramporter Family

mBsc2 .Q 71%

shBsc2 e 45%

rabBSC1

ratSSC1

flTSC 0 86%

__ 2Vhidtntiiy

68% ratrsc Q

FIG. 8. Tree of homology based on the unweighted pair group method with arithmetic mean algorithm. mBSC2 nucleotide se- quence comparison was performed on the coding region with the follow- ing different members of the electroneutral cotransporter family: shBSC2 (NKCC1) (Xu et al., 1994), rabBSCl (NKCC2) (Payne and Forbush, 1994), flTSC (Gamba et al., 19931, ratTSC and ratBSCl (Gamba et al., 1994). The length of the horizontal lines connecting the cDNAs is proportional to the estimated genetic distance between the nucleotide sequences. The numbers indicate the percentage of identity between the nucleotide sequence of the coding region of the different proteins of this family of cotransporters.

The distribution of the mBSC2 transcript in mouse tissues revealed it to be widely expressed in a variety of epithelia as well as in non-polarized cells. Highest levels of expression of the cotransporter were found in the salivary gland and stom- ach. While an important role for a basolateral Na+-K’-ZCl- cotransporter has been demonstrated in salivary gland secre- tion (Cook and Young, 1989; Peterson, 1992), a role in the stomach is still unclear. High levels of mRNA expression were also found in kidney, colon, heart, lung, testis, brain, and skel- etal muscle. Low levels of expression were found in thymus, trachea, and jejunum. Finally, Northern analysis failed to de- tect any signal in the liver and spleen. While expression of this cotransporter in most of these tissues is compatible with the known physiology of these tissues and with the tissue distri- bution of NKCCl observed in shark tissues (Xu et al., 19941, we should emphasize significant differences exist between the lev- els of expression of the cotransporter in liver and skeletal mus- cle of the mouse and shark.

The wide tissue distribution of mBSC2 mRNA, in contrast to the unique location in the outer medulla of the kidney of the rBSCl mRNA (Gamba et al., 1994) and NKCC2 mRNA (Payne and Forbush, 19941, suggests that these two Na+-K+-2Cl- co- transporters possess different physiological functions. We pro- pose that BSCl and BSCB encode for apical and basolateral isoforms, respectively. Thus, in epithelia, the BSCl isoform located on the apical membrane would mediate reabsorption (e.g. sodium reabsorption in the thick ascending limb) (Greger, 19851, while the BSCB isoforms on the basolateral membrane would participate in salt and/or fluid secretion (e.g. salivary gland) (Cook and Young, 1989). In non-polarized cells such as muscle, red cells, etc., the “basolateral” isoform, known to be more sensitive to cell shrinkage (Hebert and Sun, 1988), likely plays a role in cell volume regulation (Palfrey and O’Donnell, 1992).

A role for a basolateral Na+-K+-2Cl- cotransporter in the inner medullary collecting duct is still unclear. The physiology

of this segment of the kidney has been deduced from mi- cropuncture studies (for review, see Zeidel, 1993). The IMCD segment in vivo mediates salt and water reabsorption. Na’ reabsorption is mediated through a conductive Na+ channel located on the apical membrane (entry pathway) and a baso- lateral Na+/K+ pump (exit pathway). These two pathways lo- cated on opposite membranes generate an electropositive in- terstitium, which constitutes the driving force for C1- movement. Studies in rat (Grupp et al., 1989) but not rabbit (Zeidel et al., 1986) IMCD suggested the existence of a basolat- era1 Na’-K+-ZCl- cotransporter whose role has not yet been defined. Our study clearly demonstrated the existence of the putative basolateral isoform (BSC2) in the mIMCD-3 cell line. Since the terminal portion of the IMCD is exposed to significant osmolarity changes that accompany fluctuations in urine os- molarity, one can postulate an important function for the trans- porter in the control of cell volume.

Acknowledgments-We thank Dr. Frederick Wang from the Division of Infectious Disease (Brigham and Women’s Hospital) for help in cre- ating the mBSC2-EBV construct and infecting human B lymphocytes.

REFERENCES

Beier, D. R., Dushkin, H., and Sussman, D. J. (1992) Proc. Natl. Acad. Sci. U. S. A.

Cook, D. I., andYoung J. A. (1989) in Handbook of Physiology. The Gastrointestinal 89,9102-9106

System: Saliuary, Pancreatic, Gastric and Hepatobiliary Secretion (Schultz, S. G., ed) pp. 1-23, American Physiological Society, New York, NY

Eisenherg, D., Schwarz, E., Komaromy, M., and Wall, R. (19841 J. Mol. Biol. 179, 125-142

Forhush, B. I., 11, and Palfrey, H. C. (1983) J. Biol. Chem. 258, 11787-11792

Frizzell, R. A,, Field, M., and Schultz, S. G. (1979) Am. J . Physiol. 236, Fl-FS Franklin, C. C., Turner, J. T., and Kim, H. D. (1989) J. Biol. Chem. 264,66674673

Gamba, G., Saltzberg, S. N., Lombardi, M., Miyanoshita,A., Lytton, J., Hediger, M. A,, Brenner, B. M., and Hebert, S. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2749-2753

Gamba, G., Miyanashita, A., Lombardi, M., Lytton, J., Lee, W.-S., Hediger, M. A,, and Hebert, S. C. (1994) J. Biol. Chem. 269, 17713-17722

Gough, N. M. (1988) Anal. Biochem. 173,93-95

Grupp, C., Pavenstadt-Grupp, I., Grunewald, R. W., Bevan, C., Stakes, J. B., and Greger, R. (1985) Physiol. Rev. 65, 760-797

Kinne, R. K. (1989) Kidney Int. 36, 201-209 Haas, M. (1989) Annu. Rev. Physiol. 51, 443457 Hebert, S. C., and Sun, A. (1988) Am. J. Physiol 255, F962-F969 Kinne, R., Hannafin, J. A., and Konig, B. (1985)Ann. N . E Acad. Sei. 456,198-206

Lytle, C., and Forbush, B., I11 (1992) J. Biol. Chem. 267, 25438-25443 Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132

Lytle, C., Xu, J.-C., Biemesderfer, D., Haas, M., and Forbush, B., 111 (1992) J. Bid.

Nei, M. (1987) Molecular Evolutionary Genetics, pp. 293-298, Columbia University Manley, K. F., and Elliot, R. W. (19911 Mamm. Genome 1, 123-126

O’Grady, S. M., Palfrey, H. C., and Field, M. (1987)Am. J . Physiol. 253, C177-C192

Payne, J., and Forbush, B., I11 (1994) Proc. Natl. Acad. Sci. U. S. A. 91,4544-4548 Palfrey, H. C., and O’Donnell, M. E. (1992) Cell. Physiol. Biochem. 2, 293307

Peterson. 0. H. (1992) J. Phvsiol. (Lond. ) 448. 1-51

Chem. 267,25428-25437

Press, New York

Pewitt, E. B., Hedge, R. S., Haas, M., and Palfrey, H. C. (1990) J , Bid. Chem. 265, 20747-20756

Rauchman, M. I., Nigam, S. K., Delpire, E., and Gullans, S. R. (19931 Am. J.

Saito, Y., Osawa, T., and Nishiyama, A. (1987) J. Membr Biol. 98, 135-144 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Labo-

Welsh, M. J. (1987) Physiol. Reu. 67, 1143-1184 ratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Whisenant, N., Zhang, €%.-X., Khademazad, M., Loessberg, P., and Muallem, S.

Xu, J.-C., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., and Forbush, B., I11 (1994)

Zeidel, M. L. (1993)Am. J. Physiol. 265, F159-F173 Zeidel, M. L., Seifter, J. L., Brenner, B. M., and Silva, P. (1986)Am. J. Physiol. 251,

Physiol. 265, F416F424

(1991) Am. J. Physiol. 261, C433-C440

Proe. Natl. Aead. Sci U. S. A. 91, 2201-2205

F379-F383