The importance of somatic mutations in the Vλ gene 2a2 in human monoclonal anti-DNA antibodies

doi:10.1006/jmbi.2001.4491 available online at http://www.idealibrary.com on J. Mol. Biol. (2001) 307, 149±160

The Importance of Somatic Mutations in the Vlll Gene2a2 in Human Monoclonal Anti-DNA Antibodies

Anisur Rahman1,2*, Joanna Haley1,2, Emma Radway-Bright1

Sylvia Nagl3, Douglas G. Low1,2, David S. Latchman2

and David A. Isenberg1

1Center for Rheumatology/Bloomsbury RheumatologyUnit, Division of MedicineUniversity College, LondonUK2Medical Molecular BiologyUnit, Institute of Child HealthLondon, UK3BBSRC Centre for StructuralBiology, Department ofBiochemistry and MolecularBiology, University CollegeLondon, UK

E-mail address of the [email protected]

Abbreviations used: SLE, systemierythematosus; dsDNA, double-straimmunoglobulin; CDR, complemenregion; VH, heavy chain variable revariable region; ssDNA, single-stran

0022-2836/01/010149±12 $35.00/0

2a2 is the most commonly rearranged gene in the human Vl locus. Ithas been postulated that certain immunoglobulin genes (including 2a2)are rearranged preferentially because their germline sequences encodestructures capable of binding to a range of antigens. Somatic mutationcould then increase the speci®city and af®nity of binding to a particularantigen.

We studied the properties of ®ve IgG molecules in which the sameheavy chain was paired with different light chains derived from 2a2. Thepattern of somatic mutations in 2a2 was shown to be crucial in conferringthe ability to bind DNA, but two different patterns of mutation each con-ferred this ability.

Computer-generated models of the three-dimensional structures ofthese antibodies illustrate the ability of 2a2 to form a DNA binding sitein different ways. Somatic mutations at the periphery of the DNA bind-ing site were particularly important. In two different light chains,mutations to arginine at different sites in the complementarity determin-ing regions (CDRs) enhanced binding to DNA. In a third light chain,however, mutation to arginine at a different site blocked binding toDNA.

# 2001 Academic Press

Keywords: systemic lupus erythematosus; anti-DNA antibody; somaticmutation; Vl gene; expression system
*Corresponding author
Introduction

Systemic lupus erythematosus (SLE) is an auto-immune rheumatic disease characterized by a widevariety of different clinical features and by the pre-sence of autoantibodies in the blood. Many differ-ent autoantibodies have been identi®ed, butantibodies to double-stranded DNA (anti-dsDNA)seem to be particularly important.1 Thus, the pre-sence of anti-dsDNA antibodies is practicallyexclusive to patients with SLE, levels of these anti-bodies tend to rise and fall in parallel with theactivity of the disease,2 and they can be shown to

ing author:

c lupusnded DNA; Ig,tarity determininggion; VL, light chainded DNA.

deposit in the in¯amed tissues, particularly thekidney.3,4

Not all anti-dsDNA antibodies are equallycapable of causing tissue damage. A number ofgroups have shown that monoclonal anti-dsDNAantibodies administered to mice can deposit in thekidneys of those animals to give changes similar tothose of lupus nephritis.5 ± 8 Not all the antibodiestested, however, could cause this renal damage. Asubset of anti-dsDNA antibodies appears to be par-ticularly pathogenic.

These pathogenic autoantibodies tend to be ofIgG isotype, to be positively charged, and to bindspeci®cally and with high af®nity to dsDNA.1

Sequence analysis of monoclonal anti-DNA anti-bodies derived from patients with SLE9 or frommouse models of the disease10 has shown thatthese isotype and binding properties are oftenassociated with the presence of multiple somaticmutations in the heavy chain variable region VH

and light chain variable region VL. The distributionof these mutations suggests that they are selected

# 2001 Academic Press

http://www.idealibrary.com

mailto:[email protected]

150 Mutations in V� Gene 2a2 in Anti-DNA Antibodies

mb MS 4491 [nutting_g 28/2/01]

by antigen, because replacement mutations areclustered in the complementarity determiningregions (CDRs) which encode the bulk of the anti-gen binding site. Silent mutations are not clusteredin the CDRs.

In many high af®nity monoclonal anti-dsDNAantibodies the effect of somatic mutations in theCDRs is to create increased numbers of certain resi-dues, notably arginine, lysine and asparagine,which have the potential to facilitate binding ofantibody to DNA by the formation of charge inter-actions or hydrogen bonds.10,11

A major dif®culty in studying a monoclonal anti-body derived from a single individual arises fromuncertainty as to whether that antibody is repre-sentative of pathogenic anti-dsDNA antibodiesfound in other patients with SLE. Recent work onthe differential utilization of human VH and VL

genes is relevant to this problem.It has been shown that some human VH, Vk and

Vl genes are considerably more likely to berearranged than others during B cell developmentand that this bias occurs whether the rearrange-ment is productive or not.12 ± 15 Single cell PCRapplied to peripheral B lymphocytes has been usedto investigate the frequency of expression of differ-ent VH/VL gene pairs.13,16 The results showed thatthe most likely ®nding in a single B cell wasexpression of a commonly rearranged VH genetogether with a commonly rearranged VL gene.The pattern of VH/VL gene usage and pairing isnot signi®cantly different in people with SLE incomparison to that seen in healthy people.17

It seems likely, therefore, that the human mono-clonal anti-dsDNA antibodies most likely to berepresentative of those which develop in a varietyof different patients with SLE are those in whichboth the VH and VL sequences are encoded bycommonly rearranged genes.

We have studied B3, an IgG monoclonal anti-body derived from a patient with SLE.18 B3 bindsdsDNA with high af®nity and deposits in the kid-neys of severe combined immunode®ciency (SCID)mice.7 These mice develop proteinuria. B3VH isencoded by the gene V3-23 and B3VL by the gene2a2. V3-23 and 2a2 are the most commonlyrearranged human VH and human Vl genes,respectively.12,15 There are multiple somaticmutations in both B3VH and B3Vl and the patternof these mutations is consistent with an antigen-driven process.18,19

We have previously published a computer-generated model of the structure of the B3/dsDNA complex.20 The model suggests that bind-ing is stabilized by the interaction of dsDNA withthree arginine residues at the margins of the anti-gen binding site. One of these arginine residuesarises from a somatic mutation at position 27a inCDR1 of the gene 2a2.

We have also expressed B3 in COS-7 cells bycloning its VH and Vl sequences into separateexpression vectors which were used to transfectthe cells by electroporation.19 In the current exper-

iment, we used this expression system to producevariants of B3 in which the heavy chain sequencewas unchanged but Vl was altered.

Some of the variants were produced by pairingB3VH with B3Vl sequences altered at speci®c sitesby mutagenesis. Others were produced by pairingB3VH with the Vl sequences of two other mono-clonal antibodies which are also encoded by 2a2but which differ from B3Vl at a number of sitesdue to somatic mutation. The two antibodies usedwere 33.H11, an anti-dsDNA antibody,11 andUK-4, which is an antiphospholipid antibody.21

The aim was to discover the effects of pointmutations or of large numbers of simultaneoussequence alterations on binding to DNA.

Results

Sequences of light chains expressed

The amino acid sequences of 2a2, B3Vl, 33-H11Vl, and UK-4Vl are shown in Figure 1. BothB3Vl and UK-4Vl have many somatic mutationsand previous analysis has shown that the observedclustering of replacement mutations in the CDRs ofthese sequences is consistent with antigen-drivenselection.18,19,21 33.H11Vl is less mutated. There arethree replacement mutations in the originallypublished sequence of 33.H11,11 all of which are inthe CDRs. This pattern may represent antigen-driven selection, though the small total numberof mutations makes a ®rm conclusion about thisdif®cult.

It should be noted that the 33.H11Vl sequenceexpressed here carries an extra two differencesfrom 2a2 (proline to leucine at position 44 andasparagine to threonine at position 53) which arosedue to previous PCR manipulations in our labora-tory. Since our intention was to express B3VH incombination with different Vl sequences derivedfrom 2a2, the fact that the 33H.11Vl sequence usedwas not exactly that of the original antibody didnot alter its usefulness for this purpose.

B3Vl contains adjacent arginine residues inCDR1 which have been produced by somaticmutations. 33.H11Vl contains two arginine resi-dues in CDR3, neither of which is germlineencoded. One arginine codon is created by somaticmutation while the other is formed by the junctionbetween 2a2 and Jl2. UK-4Vl has a single somaticmutation to arginine in CDR3.

Figure 1 also shows the sequences of the twovariant forms of B3Vl produced by mutagenesis ofthe CDR1 region. In the ®rst of these (B3Vla) theonly change is the point mutation converting argi-nine (R)27a to serine (S). In the second variant(B3Vlb) a second mutation was produced fortui-tously, presumably by a PCR error. This mutationconverts a germline-encoded glycine (G) residue atposition 29 to serine (S). As this G to S change alsooccurs as a somatic mutation in UK-4Vl ,wedecided that it would be interesting to express this

Figure 1. Sequences of expressedVl regions compared to 2a2. Theamino acid sequences are num-bered according to the Kabatstandard.37 Dots have been insertedto facilitate this alignment. A dashindicates identity of sequence withthat of 2a2.

Mutations in V� Gene 2a2 in Anti-DNA Antibodies 151


second variant to test for any additional effect ofthe second mutation on binding to DNA.

Results of anti-DNA ELISA

The following heavy/light chain combinationswere expressed in COS-7 cells; B3VH/B3Vl, B3VH/B3Vla, B3VH/B3Vlb, B3VH/33.H11Vl,and B3VH/UK-4Vl. Three expression experiments werecarried out for each combination.

The concentration of IgG in each COS-7 cellsupernatant was determined from the absorbance(A) detected in the whole IgG ELISA. This wasdone by comparison with the standard curve of Aagainst concentration derived from the positivecontrol sample of known concentration. For eachcombination, similar yields of intact antibody wereproduced in each of the three expression exper-iments. Mean yields (before concentration of thesupernatant) obtained were 6.8 ng/ml for B3VH/B3Vl, 21 ng/ml for B3VH/B3Vla, 18 ng/ml forB3VH/B3Vlb, 11 ng/ml for B3VH/33.H11Vl , and110 ng/ml for B3VH/UK-4Vl . In every case, thenegative control sample in which COS-7 cells wereelectroporated without any plasmid DNA con-tained no detectable IgG. The combination B3VH/UK-4Vl produced much higher yields of intactantibody than the other combinations on eachoccasion. The reason for this is not clear, thoughdifferences between yields from different con-structs have previously been noted both in thisantibody expression system and in others (dis-cussed in19).

Binding of each of these heavy/light combi-nations to dsDNA is shown in Figure 2(a). In eachcase, similar results were found in each of the threeexpression experiments and the Figures showmean A results from these experiments. The stron-gest binding was seen with the combination con-taining the wild-type sequence of B3Vl. Theintroduction of the single R to S mutation in CDR1led to a reduction in binding to dsDNA such that

approximately double the concentration of IgGwas required to produce the same A reading. Intro-duction of the second (G to S) mutation reducedbinding to DNA further. Figure 2(b) shows thatbinding to ssDNA gave similar results for thesedifferent combinations, though the overall A read-ings were lower.

Despite being tested at a range of concentrationsbetween twice and 35 times higher than thosewhich gave maximal DNA binding for the othercombinations, B3VH/UK-4Vl showed no bindingto dsDNA (Figure 2(a)) or ssDNA (Figure 2(b)).Conversely, the combination B3VH/33.H11Vlbound to both these antigens. The binding ofB3VH/33.H11Vl to both ssDNA and dsDNA wasweaker than that of B3VH/B3Vl , similar to that ofB3VH/B3Vla and stronger than that of B3VH/B3Vlb.

Modelling of three-dimensional structures

The original model of the B3/dsDNA complex20

suggested that the double helix would bind in agroove between VL and VH as illustrated inFigure 3(a). The R residues at positions 27a and 54of the light chain and position 53 of the heavychain would stabilize this interaction.

Figure 3(b) and (c) shows the effects onthe model of replacing B3Vl with 33.H11Vl andUK-4Vl, respectively. Differences in amino acidsequence between these light chains and that of B3are shown in red. The groove in B3VH/UK-4Vl isobstructed by residues arising from the light chain,particularly the bulky positively charged R at pos-ition 94. In addition, the S residue at position 29introduces a destabilising electrostatic interactionwith the phosphate backbone of DNA. This modelwould predict poor binding of B3VH/UK-4Vl todsDNA.

As shown in Figure 3(b), however, the moleculeB3VH/33.H11Vl would be expected to bind DNA.An important interaction is between the DNA and

Figure 2. Results of anti-DNA ELISA. The graphs show binding of IgG in COS-7 cell supernatants containing eachheavy/light chain combination to (a) dsDNA and (b) ssDNA. The negative control in each case was supernatantfrom COS-7 cells to which no plasmid DNA had been added during electroporation and contained neither IgG noranti-DNA activity on testing by ELISA. Standard deviations were as follows: (a) SD < 0.18 A units for all points oncurve B3VH/B3Vl,. Similarly, at all points, SD < 0.18 for B3VH/B3Vla, SD < 0.29 for B3VH/B3Vlb, SD < 0.12 forB3VH/33.H11Vl, and SD < 0.0045 for B3VH/UK-4Vl. (b) SD < 0.037 A units for all points on curve B3VH/B3Vl,. Simi-larly, at all points, SD < 0.099 for B3VH/B3Vla, SD < 0.35 for B3VH/B3Vlb, SD < 0.094 for B3VH/33.H11Vl, andSD < 0.002 for B3VH/UK-4Vl.



the R residue at position 92 of Vl. This R is theresult of a somatic mutation in CDR3 of 2a2.

Figure 3(d) shows the effect of substituting S forR at position 27a in B3Vla. The R residue shown in

blue in the upper Figure can form an interactionwith the phosphate backbone of DNA. Mutation ofthe arginine residue at position 27a would result inthe loss of this speci®c electrostatic interaction. Fur-



thermore, replacement by serine (as shown ingreen in the lower Figure) would cause additionalunfavourable electrostatic interactions between thebackbone phosphate group and the antibody. Thissubstitution would therefore be expected to reduceaf®nity for DNA. The effect of the additional G toS substitution at position 29 in B3Vlb would be todestabilize the antibody/DNA complex as notedabove when considering S29 in UK-4Vl.

Discussion

The results described here are interesting for tworeasons. First, they are relevant to the study of ®nestructure of pathogenic antibodies in SLE. Sec-ondly, they provide evidence supporting recenttheories regarding the importance and utilizationof the gene 2a2 in human antibodies.

A number of authors have studied the ®ne struc-ture of mouse monoclonal anti-DNA antibodies. Ina review of over 300 such antibodies derived fromdifferent mouse models, Radic & Weigert10

stressed the importance of the presence of certainamino acid residues, including arginine, asparagineand lysine, at particular positions within the VH orVL sequences. Fewer human monoclonal anti-DNAantibodies have been sequenced, but the same resi-dues seem to be important.9,11 It must be stressed,however, that the presence of these amino acidresidues is not a prerequisite for the formation of aDNA-binding site. There are many examples ofanti-DNA antibodies that bind DNA withouthaving such residues in the CDRs.

Computer-generated models of the three-dimen-sional structures of some anti-DNA antibodies(mostly murine) have shown predicted sites of con-tact between dsDNA and certain amino acid resi-dues at the antigen binding site.10,20 The validity ofthese predictions can be tested by altering theseamino acid residues by mutagenesis, expressingthe mutagenized sequences either as whole immu-noglobulin, Fab or single chain Fv fragments andthen assaying the effect of the mutation on bindingto DNA (reviewed in22). If whole antibodies areexpressed, the effect on pathogenicity can also beassayed.23

In a number of experiments,23,24 these methodshave been been used to alter the numbers of argi-nine residues or other charged residues in the CDRsequences of murine anti-DNA antibodies. In gen-eral, a reduction in the number of these arginineresidues does lead to a decrease in af®nity,24 butthere are also examples where mutations thatreduce the number of positively charged CDR resi-dues do not hamper binding to DNA.23

Although many of these studies were directedprimarily at investigating sequence features in theheavy chains of anti-DNA antibodies, there is alsoevidence to show that light chains play a signi®-cant role. Radic et al.25 transfected expressionvectors containing the VH sequence of a murineanti-DNA antibody (designated 3H9) into a range

of different heavy chain loss variant lines. Theselines are derived from hybridomas but have lostthe ability to secrete heavy chain. This experimentenabled analysis of the binding properties of anti-bodies in which 3H9VH was paired with differentlight chains. Whereas all these products werecapable of binding DNA, af®nity for dsDNA and®ne speci®city were different in antibodies withdifferent light chains. In a similar experiment,Pewzner-Jung et al.26 showed that the heavy chainof a different murine anti-DNA antibody, D42,would produce an anti-DNA antibody if trans-fected into a cell secreting D42 light chain. Combi-nation with other light chains did not produce aDNA binding site.

Mice carrying a transgene encoding the sequenceof 3H9VH produce serum anti-DNA antibodies.27

Monoclonal antibodies derived from these trans-genic mice contain 3H9VH in combination with awide range of different light chains. Certainsequence features in the light chain were found tocorrelate with ability of these monoclonal anti-bodies to bind DNA.28 These included presence ofarginine at position 96 in CDR3 and of arginineand asparagine in CDR1.

Despite the extensive data from the study ofmouse antibodies, questions remain regardinghuman SLE which can only be answered by thestudy of human antibody molecules. In particular,the evidence from the mouse studies concentrateson sequence features of VH and Vk regions. This isbecause the vast majority of murine antibodiescarry kappa light chains. In tabulating sequencefeatures of 87 murine monoclonal anti-DNA anti-bodies, Radic & Weigert10 reported only one witha lambda light chain. In humans, however, about40 % of antibodies carry lambda chains.29 Six of the17 human IgG monoclonal anti-DNA antibodieswhose light chain sequences have been reporteduse lambda genes.9 The difference in usage ofkappa and lambda genes between humans andmice probably arises because the three most com-monly expressed human Vl gene families have nocorrelates in the mouse.30

Of these three families (Vl1,2 and 3), genes ofthe the Vl2 family are the most commonlyexpressed. Thus, 36 to 49 % of 7600 clones from VlcDNA libraries derived from ®ve different healthydonors expressed Vl2 genes.14 Vl2 genes are alsoof particular interest in SLE. Genes of this familyencode the idiotype 8.12. Titres of 8.12� antibodiesare elevated in the serum of up to 50 % of patientswith SLE and the presence of 8.12� antibodies hasbeen demonstrated in SLE glomerular lesions.31

Several groups have described high af®nity mono-clonal IgG anti-dsDNA antibodies with light chainsencoded by Vl2 genes.11,18,31

It is therefore a reasonable proposition that anti-DNA antibodies encoded by Vl2 genes may play apathogenic role in a signi®cant proportion ofpatients with active SLE. B3 is likely to be repre-sentative of such antibodies since it is 8.12 Id posi-tive, is encoded by the Vl2 gene 2a2 and deposits

Figure 3 (legend shown on page 156)



in the kidneys of SCID mice. It is also of IgGisotype and was derived from a patient with activeSLE and high serum levels of anti-dsDNA anti-bodies.

The results of the ELISA tests correlate withthe predictions of the computer models in show-ing that the ability of B3 to bind dsDNA is criti-cally dependent upon the placement of somatic

Figure 3 (legend shown on page 156)





mutations in the CDRs of 2a2. The R residue atposition 27a in CDR1 is able to form a speci®celectrostatic interaction with the DNA phosphatebackbone which, critically, is lost by mutation toS. The introduction of a second S in place of Gat position 29 creates additional unfavourableelectrostatic interactions such that binding toDNA is hampered still further. This underlinesthe fact that CDR residues other than arginine,asparagine and lysine may play major roles atthe DNA binding site.

S29 is also present in UK-4Vl, in which there isan asparagine (N) rather than R at 27a. The overallpattern of mutations is such that there is no bind-ing to DNA at all, even when this light chain ispaired with the heavy chain of an anti-DNA anti-body such as B3. It appears that the additional ster-ic hindrance resulting from the introduction of theR residue at position 94 in addition to the changesat 27a and 29 makes it very dif®cult for DNA tobind. This con®rms the point made by previousauthors that the mere presence of arginine residuesin the CDRs is not suf®cient to confer DNA bind-ing ability. Arginine residues in some positions canclearly hamper binding of this antigen.20,23,24

33.H11Vl contains S rather than R at position27a. Despite this, 33.H11Vl is able to create a DNAbinding site in combination with B3VH. It is tempt-ing to speculate that the presence of R residues inCDR3 of 33.H11Vl could compensate for theirabsence from CDR1. The model of B3VH/33.H11Vlshows that the R at position 92 in CDR3 can inter-act with the backbone of DNA and might wellexert such a compensatory effect. It would be inter-esting to see whether the addition of an R residueto CDR1 of 33.H11Vl in place of the S at position27a would increase its ability to bind DNA.

These results suggest that in a 2a2 encoded lightchain such as B3Vl which has been extensivelymodi®ed by somatic mutation, the ability to bindDNA is sensitive to even small changes insequence. This is particularly true where thesechanges involve residues such as arginine 27a,which interact directly with the DNA molecule.The 2a2 encoded light chain of 33.H11Vl, whichhas been modi®ed in a different way, is also ableto combine with B3 heavy chain to produce aDNA binding site. In this case, mutation to argi-nine at a different site (position 92) seems to play amajor role.

As shown in Figure 3(a), the heavy chain of B3also contributes to the antigen binding site. It isimportant to note that not all heavy chains will

Figure 3. Computer-generated models of the expressed stdouble helix of the DNA molecule is shown in the centredsDNA. (c) B3VH/UK-4Vl; no complex with dsDNA coulddark blue, VL; light blue, VH; red, VL residues which differupper diagram shows the interaction of R27a (shown in bluegram shows the same region of B3VH/B3Vla. S27a (shown in

combine with the B3Vl light chain to form a DNAbinding site. In previous experiments we haveshown that B3Vl is capable of combining with theVH chain of a different anti-DNA antibody (desig-nated WRI176) to produce a whole IgG molecule,but the combination WRI176VH/B3Vl does notbind either ssDNA or dsDNA.19

By studying more than 500 human Vl cDNAsequences, Ignatovitch et al.14 noted that theexpressed Vl repertoire is dominated by a smallnumber of genes which encode light chains sharinga common three-dimensional fold structure. It wastherefore postulated that such gene products arefavoured in evolution by their ability to form bind-ing sites for a range of different antigens. 2a2 is themost commonly rearranged of this small group ofgenes.

Sequence diversity data derived from thesecDNA sequences was plotted onto the surface of aknown Vl structure.14 The map producedsuggested that diversity due to somatic mutationwas particularly prominent in positions at the per-iphery of the proposed antigen binding site.Somatic mutations tend to occur at these codonsbecause they are preferentially targeted by thehypermutation mechanism in B lymphocytes.Analysis of large numbers of somatically mutatedsequences has shown that these mutational ``hot-spots'' often have the the nucleotide sequenceRGYW (where R is a purine, Y is a pyrimidine andW is A or T).32,33 Codons for serine include AGCand AGT, both of which can be constituents ofthese hotspots. In the gene 2a2, both CDR1 andCDR3 contain successive AGY codons which aretargets for hypermutation. The two arginine resi-dues in B3Vl CDR1 and the arginine at position 92in 33.H11Vl are the results of mutation from serineat these codons.

Thus, whereas the germline sequence of 2a2 mayenable expression of a structure which can bind arange of antigens, somatic mutations at hotspots in2a2 would be expected to cause sequence altera-tions at the periphery of this antigen binding site.Such modi®cations could potentially act toalter af®nity and speci®city of binding to particularantigens.

The antigen binding and modelling datadescribed here are consistent with the above the-ory. Two different patterns of mutation in gene 2a2allow combination with the same heavy chain(B3VH) to produce an anti-dsDNA molecule. Asshown in Figure 3(a) and (b), the importantmutations to arginine at positions 27a of B3Vl and

ructures. (a) Complex of B3VH/B3Vl with dsDNA. Theof the Figure. (b) Complex of B3 VH/33.H11Vl with

be modelled. The colour code in (a) to (c) is as follows:from those found at the same positions in B3Vl. (d) The) with the DNA molecule in B3VH/B3Vl. The lower dia-green) is unable to interact with the DNA molecule.



92 of 33.H11Vl are indeed at the periphery of theDNA binding site. If the 2a2 sequence is modi®edby mutation in a different way (UK-4Vl) it losesthe ability to encode a DNA binding site in combi-nation with B3VH. This pattern of mutations, how-ever, is compatible with the formation of aphospholipid binding site in the antibody UK-4.

This expression system offers the potential totest these hypotheses by designing new lightchains and combining them with B3VH. Forexample, ligations at a unique, germline encodedKpnI site in FR2 will allow the construction ofsequences in which CDR1 is derived from B3Vlbut the other CDRs are derived from 33H11Vl orUK-4Vl. One might thereby investigate whetherthe arginine residues in B3Vl CDR1 and those in33H11Vl CDR3 have an additive effect in enhan-cing binding to DNA and whether the suggestedeffect of the arginine in UK-4Vl CDR3 to blockbinding of DNA is dominant.

Materials and Methods

Human monoclonal antibodies

B3,18 33.H1111 and UK-421 are all human IgG mono-clonal antibodies derived by fusion of peripheral B lym-phocytes from patients with SLE with cells of the mousehuman heteromyeloma line CB-F7. 33.H11 was a kindgift from Dr Thomas Winkler (Erlangen, Germany). Thethree antibodies were derived from lymphocytes of threedifferent patients. 33.H11 is speci®c for dsDNA, B3 bindsboth ssDNA and dsDNA and UK-4 binds negativelycharged (but not neutral) phospholipids. UK-4 does notbind DNA.

The VL regions of all three antibodies are encodedby the gene 2a2. B3VH is encoded by V3-23,33.H11VH by V3-07 and UK-4VH by V3-74. These areall members of the VH3 family and share strongsequence homology.

Assembly of constructs for expression

The method for preparing these constructs was exactlythe same as that detailed fully in a previous paper.19

Brie¯y, the method can be summarized as follows.The VH sequence of B3 and Vl sequences of B3, UK-4

and 33.H11 were ampli®ed by PCR such that an S®Irestriction site was added at the 50 end and a splicedonor site followed by a BamHI site was added at the 30end. The sequences of the PCR primers used were thesame for all three antibodies. This was possible becauseall have VL regions encoded by the same Vl and Jl genesand because there are no somatic mutations in the partsof these sequences that bind to the primers. The primersequences and their design have been described pre-viously.19 The S®I and BamHI sites were used to cloneeach PCR product into an intermediate vectorpBCVHCass4, which contains a mammalian immunoglo-bulin leader sequence 50 to the insert and in frame withit. The contiguous leader and VHDHJH (or Vl/Jl)sequence was then excised from pBCVH Cass4 usingHindIII and BamHI, and the HindIII/BamHI fragmentwas ligated into a ®nal expression vector. The sequenceof each cloned V region was con®rmed by sequencing in

the ®nal expression vector from primers on either side ofthe insert.

B3VH was ligated into expression vector pG1D1,which contains the cDNA sequence of the entire humanIgG1 constant region 30 to the insert. This sequence isimmediately preceded by a splice acceptor site so thatthe DNA between the splice donor site in the insert andthe splice acceptor site is treated as an intron by mam-malian cells and is unrepresented in the expressed heavychain peptide.

Each of the Vl sequences was ligated into expressionvector pLN10, which is analagous to pG1D1 describedabove, except that Cl constant region cDNA is includedinstead of Cg1.

pBCVH Cass4, pLN10 and pG1D1 were all kind giftsfrom Dr Katy Kettleborough (MRC Collaborative Unit,Mill Hill, London).

Site-directed mutagenesis of B3Vlll

The aim of mutagenesis was to produce a variant ofB3Vl in which the positively charged arginine (R) resi-due at position 27a had been altered to serine (S), whichis uncharged and which is present at that position in theunmutated sequence of 2a2. The method used was themodi®ed megaprimer method described by Seraphin& Kandels-Lewis.34 This involved two successive PCRreactions.

The template for the ®rst stage PCR was plasmidpLN10 containing the sequence of B3Vl (produced asdescribed in the previous section). This was ampli®edusing a back primer which binds to pLN10 at a position50 to the ¯anking HindIII and SacI sites and a forwardprimer which binds to the CDR1 sequence of 2a2 but hasa mismatch at the codon for R27a. The mismatch is suchthat serine is encoded instead. The sequence of theback primer was 50TTTGACCTCCATAGAAGACACC30and the sequence of the forward primer was 50ACCAACGTCACTTCTGGTACCAGTGCAGGA30. PCR wascarried out in 100 ml of reaction mixture containing3 mM MgCl2, 100 pmol of each primer and 5 nmol ofeach dNTP. Taq polymerase, PCR buffer and MgCl2were all supplied by Promega (Madison WI, USA). Afteran initial denaturation step of ®ve minutes at 94 �C, reac-tion conditions were one minute at 94 �C, then one min-ute at 55 �C, then two minutes at 72 �C, repeated for 30cycles. There was a ®nal extension step of ®ve minutesat 72 �C.

The product of the ®rst PCR was a 300 bp oligonu-cleotide containing a 50 ¯anking region derived frompLN10 followed by the sequence of B3Vl up to themutagenized CDR1. This product was treated with ®veunits Klenow polymerase at 37 �C for 45 minutes toreduce the concentration of primers left from the ®rstPCR. The product was then used as the back primer(megaprimer) in a second PCR. The template in this PCRwas again pLN10 containing B3Vl. This plasmid hadbeen digested with HindIII prior to PCR so that it wouldnot bind to any residual 50 primer remaining from the®rst PCR step. The forward primer in the second PCRwas designed to bind to pLN10 in the region 30 to theB3Vl insert. The sequence of this primer was50AAGTAACAAAGTTCTGCCCTTG30 and 100 pmol ofprimer were used in each reaction. The PCR mix con-tained MgCl2 at 1.5 mM and 5 nmol of each dNTP. Afterthe initial denaturation step, reaction conditions were94 �C for one minute, 55 �C for ten minutes and 72 �C forone minute, repeated for 29 cycles and followed by ®ve



minutes extension at 72 �C. The long annealing time isnecessary to allow the bulky megaprimer to anneal moreef®ciently.35

The product of the second PCR was approximately600 bp long. This was puri®ed by gel electrophoresisand ligated into the plasmid pGEMT Easy (Promega,Madison WI, USA) by TA cloning. Sequencing in thisplasmid con®rmed the presence of the desired mutation.Since the insert contained the HindIII, SacI and BamHIsites from the original template, it was possible to excisethe mutagenized B3Vl sequence with HindIII and BamHIor SacI and BamHI and to clone it into plasmid pLN10.The recombinant pLN10 could then be used forexpression in COS-7 cells.

Expression of whole IgG molecules

Expression in COS-7 cells was carried out as describedpreviously.19 Equal quantities (10 mg) of recombinantheavy chain and recombinant light chain vector weretransfected into 107 COS-7 cells in 700 ml phosphate buf-fered saline (PBS) by electroporation (1.9 kV, 25 mF). Ineach transfection experiment, a negative control samplewas prepared by subjecting a similar aliquot of COS-7cells to the same treatment in the absence of plasmidDNA. The cells were allowed to recover at roomtemperature for ten minutes, then added to 8 ml ofDulbecco's modi®ed Eagle medium (Gibco, Paisley, UK)containing 580 mg/ml L-glutamine, 50 units/ml penicil-lin, 50 mg/ml streptomycin and 5 % (v/v) Ultra-Low IgGfetal calf serum.

After incubation at 37 �C for 72 hours the COS-7 cellsupernatants were centrifuged to remove cell debris andtreated with 60 units DNase I at 37 �C for one hour. Thepurpose of this treatment was to digest DNA that isreleased from dying cells and could otherwise bind theexpressed anti-DNA antibodies in the supernatant. Inprevious experiments,19 this method had been found toenhance the detection of the anti-DNA antibodies. TheDNase was then inactivated by the addition of EDTA toa ®nal concentration of 15 mM. The treated supernatantswere concentrated using Centricon-30 centrifugal con-centrators (Amicon) according to the manufacturersinstructions.

Detection and quantitation of whole IgG moleculesby ELISA

96 well plates (Nunc Maxisorp) were coated with400 ng/ml goat-anti-human IgG (Fc fragment speci®c)and incubated overnight at 4 �C. The plates were washedwith PBS/0.1 % Tween and blocked with PBS containing2 % (w/v) BSA. Samples of COS-7 cell supernatant wereadded to the plate and diluted serially. The dilution buf-fer contained 0.1 M Tris, 0.1 M Na Cl, 0.02 % Tween and0.2 % BSA. Puri®ed human IgG1l (Sigma, Poole,UK) ofknown concentration was used as a positive control forquantitation of IgG in the supernatant. Bound antibodywas detected using goat anti-human lambda alkalinephosphatase conjugate (Sigma) followed by addition of pnitrophenyl phosphate substrate (Sigma) in pH 9.6 bicar-bonate buffer. After 60 minutes at 37 �C the plates wereread at 405 nm.

Since binding to the plate depends on Fc whereasdetection by the alkaline phosphatase conjugate dependson the light chain, this method will only detect wholeantibodies.

Detection of binding to dsDNA or ssDNA by ELISA

A 96 well plate (Nunc Maxisorp) was marked verti-cally to divide it into two halves.Wells in one half of theplate (the test half) were coated with either ssDNA(500 mg/ml) or dsDNA (500 mg/ml) in citrate buffer(0.15 M sodium chloride, 0.015 M sodium citrate, pH 8.0).Wells in the other half (the control half) were coatedwith citrate buffer alone. dsDNA was obtained fromSigma. ssDNA was produced by boiling dsDNA at100 �C for 30 minutes.

The plate was incubated for two hours at 37 �C andwashed twice with PBS/0.1 % Tween . Samples of COS-7cell supernatant were diluted in the same dilution bufferused in the anti-IgG assay (see above) to produce con-centrations of 15 %, 20 %, 30 %, 40 %, 60 % and 80 %.Each of these concentrations was loaded in two wells onthe plate, one in the test half and one in the control half.Human serum known to bind dsDNA or ssDNA wasloaded in several wells as a positive control. Bound anti-body was detected with goat anti-human IgG alkalinephosphatase conjugate (Sigma) followed by addition ofsubstrate and reading at 405 nm as described above. Toexclude effects of non-speci®c binding the A value foreach sample in the control well was subtracted from thevalue obtained from the same sample in the test well toobtain the ®nal result.

Computer modelling of antibody structures

The three-dimensional structures of these VH/VL

combinations were modelled by the minimum pertur-bation procedure (36 and references therein) using thepreviously published model of antibody B320 as atemplate.

Acknowledgements

We thank Katy Kettleborough, Alison Levy andAndrew Martin for help and advice in carrying out thiswork.

A.R. was supported by Wellcome Research TrainingFellowship no. 040 366/Z/94/Z. J.H. and D.L. were sup-ported by the Arthritis Research Campaign. E.R.-B. wassupported by the Special Trustees of University CollegeHospitals, London. S.N. acknowledges support from theBBSRC Centre Grant.

References

1. Isenberg, D. A., Ravirajan, C. T., Rahman, A. &Kalsi, J. K. (1997). The role of antibodies to DNAin systemic lupus erythematosus. Lupus, 6, 290-304.

2. Okamura, M., Kanayama, Y., Amastu, K., Negoro,N., Kohda, S., Takeda, T. & Inoue, T. (1993). Signi®-cance of enzyme linked immunosorbent assay(ELISA) for antibodies to double stranded and singlestranded DNA in patients with lupus nephritis:correlation with severity of renal histology. Annu.Rheum. Dis. 52, 14-20.

3. Kof¯er, D., Schur, P. H. & Kunkel, H. G. (1967).Immunological studies concerning the nephritis ofsystemic lupus erythematosus. J. Exp. Med. 126, 607-624.



4. Win®eld, J. B., Faiferman, I. & Kof¯er, D. (1977).Avidity of anti-DNA antibodies in serum and IgGglomerular eluates from patients with systemiclupus erythematosus. Association of high af®nityanti-native DNA antibody with glomerulonephritis.J. Clin. Invest. 59, 90-96.

5. Madaio, M. P., Carlson, J., Cataldo, J., Ucci, A.,Migliorini, P. & Pankewycz, O. (1987). Murinemonoclonal anti-DNA antibodies bind directly toglomerular antigens and form immune deposits.J. Immunol. 138, 2883-2889.

6. Raz, E., Brezis, M., Rosenmann, E. & Eilat, D. (1989).Anti-DNA antibodies bind directly to renal antigensand induce kidney dysfunction in the isolatedperfused rat kidney. J. Immunol. 142, 3076-3082.

7. Ehrenstein, M. R., Katz, D. R., Grif®ths, M. H.,Papadaki, L., Winkler, T. H., Kalden, J. R. &Isenberg, D. A. (1995). Human IgG anti-DNA anti-bodies deposit in kidneys and induce proteinuria inSCID mice. Kidney Int. 48, 705-711.

8. Ravirajan, C. T., Rahman, M. A. A., Lucienne, P.,Kalsi, J. K., Martin, A. C. R., Ehrenstein, M. R.,Grif®ths, M., Latchman, D. S. & Isenberg, D. A.(1998). Genetic, structural and functional propertiesof a human IgG anti-DNA antibody. Eur. J. Immunol.28, 339-350.

9. Rahman, A., Latchman, D. S. & Isenberg, D. A.(1998). Immunoglobulin variable region sequencesof human monoclonal anti-DNA antibodies. Semin.Arth. Rheum. 28, 141-154.

10. Radic, M. Z. & Weigert, M. (1994). Genetic andstructural evidence for antigen selection of anti-DNA antibodies. Annu. Rev. Immunol. 12, 487-520.

11. Winkler, T. H., Fehr, H. & Kalden, J. R. (1992).Analysis of immunoglobulin variable region genesfrom human IgG anti-DNA antibodies. Eur. J.Immunol. 22, 1719-1728.

12. Brezinschek, H-P., Foster, S. J., Brezinschek, R. I.,Dorner, T., Domiati-Saad, R. & Lipsky, P. E. (1997).Analysis of the human VH gene repertoire: differen-tial effects of selection and somatic hypermutationin human peripheral CD5 � /IgM� and CD5-/IgM� B cells. J. Clin. Invest. 97, 2488-2501.

13. Brezinschek, H-P., Foster, S. J., Dorner, T.,Brezinschek, R. I. & Lipsky, P. E. (1998). Pairing ofvariable heavy and variable k chains in individualnaive and memory B cells. J. Immunol. 160, 4762-4767.

14. Ignatovitch, O., Tomlinson, I. M., Jones, P. T. &Winter, G. (1997). The creation of diversity in thehuman immunoglobulin Vl repertoire. J. Mol. Biol.268, 69-77.

15. Ignatovitch, O., Tomlinson, I. M., Popov, A. V.,Bruggemann, M. & Winter, G. (1999). Dominance ofintrinsic genetic factors in shaping the humanimmunoglobulin Vl repertoire. J. Mol. Biol. 294, 457-465.

16. De Wildt, R. M. T., Hoet, R. M. A., van Venrooij,W. J., Tomlinson, I. M. & Winter, G. (1999). Analysisof heavy and light chain pairing indicates thatreceptor editing shapes the human antibody reper-toire. J. Mol. Biol. 285, 895-901.

17. De Wildt, R. M. T., Tomlinson, I. M., van Venrooij,W. J., Winter, G. & Hoet, R. M. A. (2000). Compar-able heavy and light chain pairings in normal andsystemic lupus erythematosus IgG� B cells. Eur. J.Immunol. 30, 254-261.

18. Ehrenstein, M. R., Longhurst, C. M., Latchman, D. S.& Isenberg, D. A. (1994). Serological and genetic

characterization of a human monoclonal immuno-globulin G anti-DNA idiotype. J. Clin. Invest. 93,1787-1797.

19. Rahman, M. A. A., Kettleborough, C. A., Latchman,D. S. & Isenberg, D. A. (1998). Properties of wholehuman IgG molecules produced by the expressionof cloned anti-DNA antibody cDNA in mammaliancells. J. Autoimm. 11, 661-671.

20. Kalsi, J. K., Martin, A. C. R., Hirabayashi, Y.,Longhurst, C., Ehrenstein, M. R., Ravirajan, C.,Stollar, D., Thornton, J. & Isenberg, D. A. (1996).Functional and modelling studies of the binding ofhuman monoclonal anti-DNA antibodies to DNA.Mol. Immunol. 33, 471-483.

21. Menon, S., Rahman, M. A. A., Ravirajan, C. T.,Kandiah, D., Longhurst, C. M., McNally, T.,Williams, W. M., Latchman, D. S. & Isenberg, D. A.(1997). The production, binding characteristics andsequence analysis of four human IgG monoclonalantiphospholipid antibodies. J. Autoimmun. 10, 43-57.

22. Rahman, A., Latchman, D. S. & Isenberg, D. A.(1998b). The role of in-vitro expression systems inthe investigation of antibodies to DNA. Semin. Arth.Rheum. 28, 130-139.

23. Katz, J. B., Limpanasithikul, W. & Diamond, B.(1994). Mutational analysis of an autoantibody:differential binding and pathogenicity. J. Exp. Med.180, 925-932.

24. Radic, M. Z., Mackle, J., Erikson, J., Mol, C.,Anderson, W. F. & Weigert, M. (1993). Residues thatmediate DNA binding of autoimmune antibodies.J. Immunol. 150, 4966-4977.

25. Radic, M. Z., Mascelli, M. A., Erikson, J., Shan, H. &Weigert, M. (1991). Ig H and L chain contributionsto autoimmune speci®cities. J. Immunol. 146, 176-182.

26. Pewzner-Jung, Y., Simon, T. & Eilat, D. (1996).Structural elements controlling anti-DNA antibodyaf®nity and their relationship to anti-phosphorylcho-line activity. J. Immunol. 156, 3065-3073.

27. Radic, M. Z., Ibrahim, S. M., Rauch, J., Camper, S. A.& Weigert, M. (1995). Constitutive secretion oftransgene-encoded IgG2b autoantibodies leads tosymptoms of autoimmune disease. J. Immunol. 155,3213-3222.

28. Ibrahim, S. M., Weigert, M., Basu, C., Erikson, J. &Radic, M. Z. (1995). Light chain contribution tospeci®city in anti-DNA antibodies. J. Immunol. 155,3223-3233.

29. Williams, S. C. & Winter, G. (1993). Cloning andsequencing of human Vl gene segments. Eur. J.Immunol. 23, 1456-1461.

30. Williams, S. C., Frippiat, J. P., Tomlinson, I. M.,Ignatovitch, O., Lefranc, M-P. & Winter, G. (1996).Sequence and evolution of the human germline Vl

repertoire. J. Mol. Biol. 264, 220-232.31. Paul, E., Iliev, A. A., Livneh, A. & Diamond, B.

(1992). The anti-DNA-associated idiotype 8.12 isencoded by the VlII gene family and maps to thevicinity of L chain CDR1. J. Immunol. 149, 3588-3595.

32. Neuberger, M. S. & Milstein, C. (1995). Somatichypermutation. Curr. Opin. Immunol. 7, 248-254.

33. Dorner, T., Foster, S. J., Brezinschek, H-P. & Lipsky,P. E. (1998). Analysis of the targeting of the hyper-mutational machinery and the impact of subsequentselection on the distribution of nucleotide changes inhuman VHDHJH rearrangements. Immunol. Revs. 162,161-171.



34. Seraphin, B. & Kandels-Lewis, S. (1996). An ef®cientPCR mutagenesis strategy without gel puri®cationstep that is amenable to automation. Nucl. Acids Res.24, 3276-3277.

35. Good, L. & Nazar, R. N. (1992). An improvedthermal cycle for two-step PCR-based targetedmutagenesis. Nucl. Acids Res. 20, 4934.

36. Martin, A. C., Cheetham, J. C. & Rees, A. R. (1991).Molecular modelling of antibody combining sites.Methods Enzymol. 303, 121-153.

37. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesmann,K. S. & Foeller, C. (1991). Sequences of Proteins ofImmunological Interest, 5th edit., US Department ofHealth and Human Sciences.

Edited by I. B. Holland

(Received 11 August 2000; received in revised form 19 January 2001; accepted 22 January 2001)

The importance of somatic mutations in the Vλ gene 2a2 in human monoclonal anti-DNA antibodies

Documents

Transcript of The importance of somatic mutations in the Vλ gene 2a2 in human monoclonal anti-DNA antibodies