The Human Genome Project-Babak Nami

8/3/2019 The Human Genome Project-Babak Nami

1/62


2/62

The Human Genome ProjectThe Human Genome Project BabakBabak NamiNami Department of MedicalDepartment of Medical

GeneticsGenetics SelSelukuk UniversityUniversity


3/62

Human GenomeHuman Genome The human genome is the genome of Homo sapiens, which isThe human genome is the genome of Homo sapiens, which is

stored on 23 chromosome pairs.stored on 23 chromosome pairs.

22 of these are22 of these are autosomalautosomal chromosome pairs, while thechromosome pairs, while theremaining pair is sexremaining pair is sex--determining.determining.

billion DNA basebillion DNA base pairespaires..

The haploid human genome contains ca.The haploid human genome contains ca. 23,000 protein23,000 protein--codingcodinggenesgenes, far fewer than had been expected before its sequencing., far fewer than had been expected before its sequencing.

In fact, only aboutIn fact, only about 1.5%1.5% of the genome codes for proteins,of the genome codes for proteins,while the rest consists ofwhile the rest consists ofnonnon--coding RNA genescoding RNA genes,, regulatoryregulatorysequencessequences intronsintrons,, andand noncodingnoncoding DNADNA (once known as "(once known as "junkjunkDNA")DNA")


4/62

Human GenomeHuman Genome Information content of the haploid human genome by chromosome:Information content of the haploid human genome by chromosome:

Haploid means we only count one of each chromosome pair. For thisHaploid means we only count one of each chromosome pair. For thisreason, the total information content for a woman (XX) is less than for areason, the total information content for a woman (XX) is less than for aman (XY), where both the X and the Y are counted.man (XY), where both the X and the Y are counted.


5/62

How much data make up the humanHow much data make up the humangenome?genome?

3 Bookcases with 403 Bookcases with 40BooksBooks

per bookcase x 5000per bookcase x 5000a esa es

per book x 5000 bases perper book x 5000 bases perpage = 3,000,000,000page = 3,000,000,000

bases!bases!


6/62

Human Genome ProjectHuman Genome Project The Human Genome Project (HGP) is anThe Human Genome Project (HGP) is an

international scientific research project with ainternational scientific research project with aprimary goal of determining the sequence ofprimary goal of determining the sequence ofchemical base airs which make u DNA andchemical base airs which make u DNA andto identify and map the approximately 20,000to identify and map the approximately 20,00030,000 gene of the human genome from both a30,000 gene of the human genome from both a

physical and functional standpoint.physical and functional standpoint.


7/62

HistoryHistory 1985.1985. Proposed.Proposed. 19881988. Initiated and funded by NIH and US Dept. of. Initiated and funded by NIH and US Dept. of

Energy ($3 billion set aside)Energy ($3 billion set aside)

19901990. Work begins.. Work begins... --project earlyproject early

2001.2001.Published in Science and Nature in February,Published in Science and Nature in February,

20022002. The quest for genome sequencing was being. The quest for genome sequencing was beingpursued simultaneously in over 20 laboratories in sixpursued simultaneously in over 20 laboratories in sixcountriescountries

20032003. the whole genome sequenced. the whole genome sequenced


8/62

HistoryHistory

Initiative Office of HGP


9/62

Human Genome Project Goals and Completion DatesHuman Genome Project Goals and Completion Dates

1994:

1998:Physical map

(3,000 markers)

2003:DNA sequence

(99% of gene-containing

2003:

3 millionmappedSNPs

1990 1995 2000 2005

Genetic map1 cM resolution(3,000 markers)

2003:15,000 full-length

cDNAs


10/62

NIHNIH put the human genomeput the human genomesequence on the web July 7,sequence on the web July 7,

20002000 Cyber geeksSearched forhiddenMessages,

and

UCSC put the

human genomesequence on CD in

October 2000, with

varying results


11/62


12/62

The first printout of the human genome to beThe first printout of the human genome to bepresented as a series of books, displayed at thepresented as a series of books, displayed at theWellcomeWellcome CollectionCollection, London, London


13/62

Goals of the ProjectGoals of the Project

identifyidentify all the approximately 30,000 genes inall the approximately 30,000 genes inhuman DNA,human DNA,

determinedetermine the sequences of the 3 billion chemicalthe sequences of the 3 billion chemical

base pairs that make up human DNA,base pairs that make up human DNA, storestore this information in databases,this information in databases, improveimprove tools for data analysis,tools for data analysis, transfertransferrelated technologies to the private sector,related technologies to the private sector,

andand addressaddress the ethical, legal, and social issues (ELSI)the ethical, legal, and social issues (ELSI)

that may arise from the project.that may arise from the project.


14/62


15/62

In BiotechnologyIn Biotechnology

Production of useful protein products for use inProduction of useful protein products for use inmedicine, agriculture, bioremediation andmedicine, agriculture, bioremediation and

pharmaceutical industries.pharmaceutical industries.

Protein replacement (factor VIII, TPA, streptokinase, insulin,Protein replacement (factor VIII, TPA, streptokinase, insulin,interferon)interferon)

BT insecticide toxin (fromBT insecticide toxin (fromBacillusBacillus thuringiensisthuringiensis))

Herbicide resistance (Herbicide resistance (glyphosateglyphosate resistance)resistance) BioengineeredBioengineered foods]foods] PharmPharm animals animals


16/62


17/62

ProteomicsProteomics

Investigates patterns and levels of geneInvestigates patterns and levels of geneexpression in diseased cells that can beexpression in diseased cells that can be

profiles.profiles.


18/62

DNA Chip TechnologyDNA Chip Technology


19/62


20/62


21/62


22/62

InIn PharmacogenomicsPharmacogenomics

Investigates DNA mutations associated withInvestigates DNA mutations associated withdisease susceptibility and drug sensitivities.disease susceptibility and drug sensitivities.

ProdrugProdrug gene therapy for cancersgene therapy for cancers


23/62

In DevelopmentalIn Developmental BiologyBiology

Regulation of embryonic development.Regulation of embryonic development.

Regulation of the aging processRegulation of the aging process..

..

Regulation of metabolism.Regulation of metabolism.


24/62

Evolutionary and ComparativeEvolutionary and ComparativeBiologistsBiologists

Because DNA mutates at a constant rate,Because DNA mutates at a constant rate,comparisons of DNA between differentcomparisons of DNA between different

..


25/62

Human Genome SequenceHuman Genome SequenceVariationVariation

Develop technologies for rapid, largeDevelop technologies for rapid, large--scalescale

identification and scoring of singleidentification and scoring of single--nucleotidenucleotide

polymorphisms and other DNA sequence variants.polymorphisms and other DNA sequence variants.

Identify common variants in the coding regions of theIdentify common variants in the coding regions of themajority of identified genes during this 5majority of identified genes during this 5--year period.year period.

Create a SNP map of at least 100,000 markers.Create a SNP map of at least 100,000 markers.

Develop the intellectual foundations for studies ofDevelop the intellectual foundations for studies of

sequence variation.sequence variation.

Create public resources of DNA samples and cellCreate public resources of DNA samples and cell

lines.lines.


26/62

Model organismsModel organisms

Bacteria (Bacteria (E. coliE. coli, influenza, several others), influenza, several others)

Yeast (Yeast (Saccharomyces cerevisiaeSaccharomyces cerevisiae))

Plant (Plant (Arabidopsis thalianaArabidopsis thaliana)) Roundworm (Roundworm (Caenorhabditis elegansCaenorhabditis elegans))

Fruit fly (Fruit fly (Drosophila melanogasterDrosophila melanogaster))

Mouse (Mouse (Mus musculusMus musculus))


27/62

How does the human genomeHow does the human genome

stack up?stack up?

Organism Genome Size (Bases) Estimated Genes

Human (Homo sapiens) 3 billion 30,000

Laboratory mouse (M. musculus) 2.6 billion 30,000

Mustard weed (A. thaliana) 100 million 25,000

Roundworm (C. elegans) 97 million 19,000

Fruit fly (D. melanogaster) 137 million 13,000

Yeast (S. cerevisiae) 12.1 million 6,000Bacterium (E. coli) 4.6 million 3,200

Human immunodeficiency virus (HIV) 9700 9


28/62

AAGTTC CTAAGC ATTCGG

AAGTTC CTAAGC

AAGTTC


29/62


30/62

Practical GoalsPractical Goals


31/62

http://www.genome.gov/Pages/News/PaceofDiseaseGeneDiscovery.pdf


32/62


33/62

Sequencing StrategySequencing Strategy Once a contig map of the genome wasOnce a contig map of the genome was

obtained, it was necessary to sequenceobtained, it was necessary to sequenceeach individual clone.each individual clone.

Most of the actual human genomeMost of the actual human genomesequencing was done on BAC clones,sequencing was done on BAC clones,which are less prone to rearrangement thanwhich are less prone to rearrangement thanYAC clones. BACs are about 100YAC clones. BACs are about 100--200200

kbp long.kbp long.

shotgun sequencingshotgun sequencing: The large cloned: The large clonedDNA is randomly broken up into a seriesDNA is randomly broken up into a seriesof small fragments ( less than 1 kb).of small fragments ( less than 1 kb).These fragments are cloned andThese fragments are cloned andsequenced. A computer program thensequenced. A computer program thenassembles them based on overlapsassembles them based on overlaps

between the sequences of each clone.between the sequences of each clone. To ensure that every bit has been covered,To ensure that every bit has been covered,

you need to sequence random clones untilyou need to sequence random clones untilyou have covered each spot 5you have covered each spot 5--10 times on10 times onaverage.average.


34/62


35/62

Sequencing: BACSequencing: BAC--based methodbased method

Each clone 150-200,000 bp

Cloned in bacteria ,

BAC clones mappedclones

subclones

Subclones 2,000 bp

Sequenced 10 times in 500 800 bpsegments

Subclone sequences re-assembled


36/62


37/62

Sequencing Technologies

The two basic sequencing approaches, Maxam-Gilbertand Sanger, differ primarily in the way the nested DNAfragments are produced.

Maxam-Gilbert sequencing (also called the

chemical degradation method) uses chemicals to cleave,

lengths. A refinement to the Maxam-Gilbert method knownas multiplex sequencing enables investigators to analyzeabout 40 clones on a single DNA sequencing gel.

Sanger sequencing (also called the chain termination ordideoxy method) involves using an enzymatic procedureto synthesize DNA chains of varying length in fourdifferent reactions, stopping the DNA replication atpositions occupied by one of the four bases, and then

determining the resulting fragment lengths.


38/62


39/62


40/62

Advanced TechniquesAdvanced Techniques

SOLiDSOLiD SequencingSequencing

HelicosHelicos High speed Gene SequencingHigh speed Gene Sequencing

Laser SequencingLaser Sequencing


41/62


42/62

How the Code was DecodedHow the Code was Decoded

DoubleTwistDoubleTwist Inc, an application service provider (ASP),Inc, an application service provider (ASP),devoted to empower life scientists, completed the firstdevoted to empower life scientists, completed the firstannotationannotation of the human genome.of the human genome.

TheThe DoubleTwistDoubleTwist human genome database was createdhuman genome database was created,,is, a total of more thanis, a total of more than 350 processors350 processors..

It brought to a close an extensive analysis of the availableIt brought to a close an extensive analysis of the availableHGP data that revealed genes and other valuableHGP data that revealed genes and other valuableinformation. The task was accomplished using Suninformation. The task was accomplished using SunEnterprise supercomputers, includingEnterprise supercomputers, including StarfireStarfire servers.servers.


43/62

Genome MapGenome Map

A genome map describes the order of genesor other markers and the spacing betweenthem on each chromosome. Human genome

maps are constructed on several differentscales or levels of resolution.


44/62

Genetic MapGenetic Map

Genetic linkage maps of eachchromosome are made bydetermining how frequently twomarkers are passed together

from parent to child. Becauseexchanged during theproduction of sperm and eggcells, groups of traits (ormarkers) originally together onone chromosome may not beinherited together.


45/62


46/62

. . . t o a mu l t i. . . toamul t i --resolution view . . .resolution view . . .


47/62

. . . at the gene cluster level . . .. . . at the gene cluster level . . .


48/62

. . . the single gene level . . .. . . the single gene level . . .


49/62

. . . and at the single base level. . . and at the single base level

caggcggactcagtggatctggccagctgtgacttgacaag

caggcggactcagtggatctagccagctgtgacttgacaag


50/62


51/62


52/62


53/62

XX--ray hybrid mappingray hybrid mapping

XX--ray hybrids are made by irradiating a human cell line with 3000 radray hybrids are made by irradiating a human cell line with 3000 radof Xof X--rays, fusion to hamster cells, and isolation of hybrid cell lines inrays, fusion to hamster cells, and isolation of hybrid cell lines incultureculture

A panel of 100A panel of 100--200 hybrids with 5200 hybrids with 5--10 different fragments of human10 different fragments of humanDNA in each gives about 1000 fragments in total, i.e. the humanDNA in each gives about 1000 fragments in total, i.e. the humangenome has been divided into 1000 bits.genome has been divided into 1000 bits.

,,that they will be present in the same hybrids (since they are less likelythat they will be present in the same hybrids (since they are less likelyto be separated by an Xto be separated by an X--ray induced break).ray induced break).

By doing a PCR assay for each marker on all the hybrids, a map can beBy doing a PCR assay for each marker on all the hybrids, a map can bemade. The units are called cR (centiray, where 1cR is a 1% chance thatmade. The units are called cR (centiray, where 1cR is a 1% chance thatthe markers will be separated by Xthe markers will be separated by X--ray breakage).ray breakage).


54/62


55/62

For each pair of markers in turn the "co-retention frequency" isthe number of hybrids in which both markers are present,divided by the number of hybrids in which one or other (or

both) markers are present. On the figure, there are 5 hybridscontaining both markers B and C, and 6 containing B and/or C.Therefore the co-retention frequency is 5/6 or 0.83. Likewise it

is 6/7 for markers E and F, and 2/10 for markers C and E. Thisshows that B and C are close to ether E and F are close


56/62

CloneClone contigscontigs

A clone contig is a series of cloned DNAA clone contig is a series of cloned DNAsegments that overlap each other, assembledsegments that overlap each other, assembledin the correct order along the genomein the correct order along the genome

cosmids (capacity 45 kb)cosmids (capacity 45 kb) BACs or YACs (Bacterial or Yeast ArtificialBACs or YACs (Bacterial or Yeast Artificial

Chromosomes) which can clone 100s of kb ofChromosomes) which can clone 100s of kb ofDNADNA -- more suitable for dealing with largemore suitable for dealing with largestretches of mammalian DNA.stretches of mammalian DNA.

M ki l ti b fi i ti


57/62

Making a clone contig by fingerprinting


58/62

What does the draft human genomesequence tell us?

By the Numbers

The human genome contains 3 billion chemical nucleotide bases (A, C, T,and G).

, ,largest known human gene being dystrophin at 2.4 million bases.

The total number of genes is estimated at around 30,000--much lower thanprevious estimates of 80,000 to 140,000.

Almost all (99.9%) nucleotide bases are exactly the same in all people.

The functions are unknown for over 50% of discovered genes.

What does the draft human genome


59/62


How It's Arranged

The human genome's gene-dense "urban centers" are predominantly composed ofthe DNA building blocks G and C.

In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T.

GC- and AT-rich regions usually can be seen through a microscope as light and.

Genes appear to be concentrated in random areas along the genome, with vastexpanses of noncoding DNA between.

Stretches of up to 30,000 C and G bases repeating over and over often occuradjacent to gene-rich areas, forming a barrier between the genes and the "junkDNA." These CpG islands are believed to help regulate gene activity.

Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest(231).

h d h d f h


60/62


The Wheat from the Chaff

Less than 2% of the genome codes for proteins.

Repeated sequences that do not code for proteins ("junk DNA").

Repetitive sequences are thought to have no direct functions, butthey shed light on chromosome structure and dynamics.

The human genome has a much greater portion (50%) of repeatsequences than the mustard weed (11%), the worm (7%), and thefly (3%).

What does the draft human genome


61/62


How the Human Compares with Other Organisms

Unlike the human's seemingly random distribution of gene-rich areas, many otherorganisms' genomes are more uniform, with genes evenly spaced throughout.

Humans have on average three times as many kinds of proteins as the fly or wormbecause of mRNA transcript "alternative splicing" and chemical modifications to the

proteins. This process can yield different protein products from the same gene. Humans share most of the same protein families with worms, flies, and plants; but the

number of gene family members has expanded in humans, especially in proteinsinvolved in development and immunity.

Although humans appear to have stopped accumulating repeated DNA over 50 million

years ago, there seems to be no such decline in rodents. This may account for some ofthe fundamental differences between hominids and rodents, although gene estimates aresimilar in these species. Scientists have proposed many theories to explain evolutionarycontrasts between humans and other organisms, including those of life span, litter sizes,inbreeding, and genetic drift.


62/62


Variations and Mutations

Scientists have identified about 3 million locations where single-baseDNA differences (SNPs) occur in humans. This information promises to

revolutionize the processes of finding chromosomal locations for disease-assoc a e sequences an rac ng uman s ory.

The ratio of germline (sperm or egg cell) mutations is 2:1 in males vsfemales. Researchers point to several reasons for the higher mutation ratein the male germline, including the greater number of cell divisions

required for sperm formation than for eggs.

The Human Genome Project-Babak Nami

Documents

Transcript of The Human Genome Project-Babak Nami