THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI...
Transcript of THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI...
![Page 1: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/1.jpg)
I
THE GENETICS OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
Saba Shahid
Centre of Human Genetics and Molecular Medicine
Sindh Institute of Medical Sciences
Sindh Institute of Urology and Transplantation (SIUT)
Karachi Pakistan
2013
II
THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
Thesis submitted to the Sindh Institute of Medical Sciences
for the degree of Doctor of Philosophy
BY
Saba Shahid
Centre of Human Genetics and Molecular Medicine
Sindh Institute of Medical Sciences
Sindh Institute of Urology and Transplantation (SIUT)
Karachi Pakistan
2013
III
IV
Table of Contents
page
Acknowledgments i
List of abbreviations iii
Publications v
List of Tables vi
List of Figures viii
Summary ix
1 Literature review on nephrotic syndrome (NS) 1
11 The Kidney 2
111 Structure of the kidney 2
112 Glomerular filtration barrier 4
113 Fenestrated endothelial cells 4
114 Glomerular basement membrane 6
115 Podocyte 6
12 Glomerular diseases of the filtration system 7
121 Nephrotic syndrome 9
122 Definition 9
123 Classification 9
13 Genetics of nephrotic syndrome 13
131 Autosomal recessive mode of steroid resistant NS 14
132 Congenital NS caused by the NPHS1 gene (nephrin) 14
133 NS caused by NPHS2 gene (podocin) 18
134 NS caused by LAMB2 gene (laminin) 21
135 NS caused by PLCE1 gene (phospholipase C epsilon 1) 23
V
136 NS caused by PTPRO gene (protein tyrosine phosphatase
receptor-type O) 24
14 Autosomal dominant mode of steroid resistant NS 24
141 NS caused by ACTN4 gene (α-actinin 4) 24
142 NS caused by WT1 gene (Wilmrsquos tumor) 26
143 NS caused by CD2AP gene (CD2 associated protein) 27
144 NS caused by TRPC6 gene (transient receptor potential
canonical channel 6) 29
145 NS caused by INF2 gene (inverted formin-2) 30
15 Nephrotic syndrome caused by other genetic factors 31
151 Angiotensin converting enzyme (ACE) gene
insertiondeletion polymorphism 31
152 Methyltetrahydrofolate reductase enzyme
(MTHFR) gene polymorphism 32
16 References 33
2 Materials and Methods 48
21 Sample collection 49
22 Extraction of DNA from blood samples 49
221 Quantification of DNA 50
23 Polymerase chain reaction (PCR) 51
24 Agarose gel electrophoreses 52
25 Automated fluorescence DNA sequencing 53
251 Precipitation for sequencing reaction 53
252 Sequencing reaction 53
26 Polyacrylamide gel electrophoresis (PAGE) 54
27 Restriction fragment length polymorphism (RFLP) 55
28 Statistical analysis 57
29 References 58
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 2: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/2.jpg)
II
THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
Thesis submitted to the Sindh Institute of Medical Sciences
for the degree of Doctor of Philosophy
BY
Saba Shahid
Centre of Human Genetics and Molecular Medicine
Sindh Institute of Medical Sciences
Sindh Institute of Urology and Transplantation (SIUT)
Karachi Pakistan
2013
III
IV
Table of Contents
page
Acknowledgments i
List of abbreviations iii
Publications v
List of Tables vi
List of Figures viii
Summary ix
1 Literature review on nephrotic syndrome (NS) 1
11 The Kidney 2
111 Structure of the kidney 2
112 Glomerular filtration barrier 4
113 Fenestrated endothelial cells 4
114 Glomerular basement membrane 6
115 Podocyte 6
12 Glomerular diseases of the filtration system 7
121 Nephrotic syndrome 9
122 Definition 9
123 Classification 9
13 Genetics of nephrotic syndrome 13
131 Autosomal recessive mode of steroid resistant NS 14
132 Congenital NS caused by the NPHS1 gene (nephrin) 14
133 NS caused by NPHS2 gene (podocin) 18
134 NS caused by LAMB2 gene (laminin) 21
135 NS caused by PLCE1 gene (phospholipase C epsilon 1) 23
V
136 NS caused by PTPRO gene (protein tyrosine phosphatase
receptor-type O) 24
14 Autosomal dominant mode of steroid resistant NS 24
141 NS caused by ACTN4 gene (α-actinin 4) 24
142 NS caused by WT1 gene (Wilmrsquos tumor) 26
143 NS caused by CD2AP gene (CD2 associated protein) 27
144 NS caused by TRPC6 gene (transient receptor potential
canonical channel 6) 29
145 NS caused by INF2 gene (inverted formin-2) 30
15 Nephrotic syndrome caused by other genetic factors 31
151 Angiotensin converting enzyme (ACE) gene
insertiondeletion polymorphism 31
152 Methyltetrahydrofolate reductase enzyme
(MTHFR) gene polymorphism 32
16 References 33
2 Materials and Methods 48
21 Sample collection 49
22 Extraction of DNA from blood samples 49
221 Quantification of DNA 50
23 Polymerase chain reaction (PCR) 51
24 Agarose gel electrophoreses 52
25 Automated fluorescence DNA sequencing 53
251 Precipitation for sequencing reaction 53
252 Sequencing reaction 53
26 Polyacrylamide gel electrophoresis (PAGE) 54
27 Restriction fragment length polymorphism (RFLP) 55
28 Statistical analysis 57
29 References 58
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 3: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/3.jpg)
III
IV
Table of Contents
page
Acknowledgments i
List of abbreviations iii
Publications v
List of Tables vi
List of Figures viii
Summary ix
1 Literature review on nephrotic syndrome (NS) 1
11 The Kidney 2
111 Structure of the kidney 2
112 Glomerular filtration barrier 4
113 Fenestrated endothelial cells 4
114 Glomerular basement membrane 6
115 Podocyte 6
12 Glomerular diseases of the filtration system 7
121 Nephrotic syndrome 9
122 Definition 9
123 Classification 9
13 Genetics of nephrotic syndrome 13
131 Autosomal recessive mode of steroid resistant NS 14
132 Congenital NS caused by the NPHS1 gene (nephrin) 14
133 NS caused by NPHS2 gene (podocin) 18
134 NS caused by LAMB2 gene (laminin) 21
135 NS caused by PLCE1 gene (phospholipase C epsilon 1) 23
V
136 NS caused by PTPRO gene (protein tyrosine phosphatase
receptor-type O) 24
14 Autosomal dominant mode of steroid resistant NS 24
141 NS caused by ACTN4 gene (α-actinin 4) 24
142 NS caused by WT1 gene (Wilmrsquos tumor) 26
143 NS caused by CD2AP gene (CD2 associated protein) 27
144 NS caused by TRPC6 gene (transient receptor potential
canonical channel 6) 29
145 NS caused by INF2 gene (inverted formin-2) 30
15 Nephrotic syndrome caused by other genetic factors 31
151 Angiotensin converting enzyme (ACE) gene
insertiondeletion polymorphism 31
152 Methyltetrahydrofolate reductase enzyme
(MTHFR) gene polymorphism 32
16 References 33
2 Materials and Methods 48
21 Sample collection 49
22 Extraction of DNA from blood samples 49
221 Quantification of DNA 50
23 Polymerase chain reaction (PCR) 51
24 Agarose gel electrophoreses 52
25 Automated fluorescence DNA sequencing 53
251 Precipitation for sequencing reaction 53
252 Sequencing reaction 53
26 Polyacrylamide gel electrophoresis (PAGE) 54
27 Restriction fragment length polymorphism (RFLP) 55
28 Statistical analysis 57
29 References 58
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 4: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/4.jpg)
IV
Table of Contents
page
Acknowledgments i
List of abbreviations iii
Publications v
List of Tables vi
List of Figures viii
Summary ix
1 Literature review on nephrotic syndrome (NS) 1
11 The Kidney 2
111 Structure of the kidney 2
112 Glomerular filtration barrier 4
113 Fenestrated endothelial cells 4
114 Glomerular basement membrane 6
115 Podocyte 6
12 Glomerular diseases of the filtration system 7
121 Nephrotic syndrome 9
122 Definition 9
123 Classification 9
13 Genetics of nephrotic syndrome 13
131 Autosomal recessive mode of steroid resistant NS 14
132 Congenital NS caused by the NPHS1 gene (nephrin) 14
133 NS caused by NPHS2 gene (podocin) 18
134 NS caused by LAMB2 gene (laminin) 21
135 NS caused by PLCE1 gene (phospholipase C epsilon 1) 23
V
136 NS caused by PTPRO gene (protein tyrosine phosphatase
receptor-type O) 24
14 Autosomal dominant mode of steroid resistant NS 24
141 NS caused by ACTN4 gene (α-actinin 4) 24
142 NS caused by WT1 gene (Wilmrsquos tumor) 26
143 NS caused by CD2AP gene (CD2 associated protein) 27
144 NS caused by TRPC6 gene (transient receptor potential
canonical channel 6) 29
145 NS caused by INF2 gene (inverted formin-2) 30
15 Nephrotic syndrome caused by other genetic factors 31
151 Angiotensin converting enzyme (ACE) gene
insertiondeletion polymorphism 31
152 Methyltetrahydrofolate reductase enzyme
(MTHFR) gene polymorphism 32
16 References 33
2 Materials and Methods 48
21 Sample collection 49
22 Extraction of DNA from blood samples 49
221 Quantification of DNA 50
23 Polymerase chain reaction (PCR) 51
24 Agarose gel electrophoreses 52
25 Automated fluorescence DNA sequencing 53
251 Precipitation for sequencing reaction 53
252 Sequencing reaction 53
26 Polyacrylamide gel electrophoresis (PAGE) 54
27 Restriction fragment length polymorphism (RFLP) 55
28 Statistical analysis 57
29 References 58
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 5: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/5.jpg)
V
136 NS caused by PTPRO gene (protein tyrosine phosphatase
receptor-type O) 24
14 Autosomal dominant mode of steroid resistant NS 24
141 NS caused by ACTN4 gene (α-actinin 4) 24
142 NS caused by WT1 gene (Wilmrsquos tumor) 26
143 NS caused by CD2AP gene (CD2 associated protein) 27
144 NS caused by TRPC6 gene (transient receptor potential
canonical channel 6) 29
145 NS caused by INF2 gene (inverted formin-2) 30
15 Nephrotic syndrome caused by other genetic factors 31
151 Angiotensin converting enzyme (ACE) gene
insertiondeletion polymorphism 31
152 Methyltetrahydrofolate reductase enzyme
(MTHFR) gene polymorphism 32
16 References 33
2 Materials and Methods 48
21 Sample collection 49
22 Extraction of DNA from blood samples 49
221 Quantification of DNA 50
23 Polymerase chain reaction (PCR) 51
24 Agarose gel electrophoreses 52
25 Automated fluorescence DNA sequencing 53
251 Precipitation for sequencing reaction 53
252 Sequencing reaction 53
26 Polyacrylamide gel electrophoresis (PAGE) 54
27 Restriction fragment length polymorphism (RFLP) 55
28 Statistical analysis 57
29 References 58
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 6: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/6.jpg)
VI
3 A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome patients from Pakistan 59
31 Introduction 60
32 Materials and methods 62
321 Patient recruitment and data collection 62
322 Mutation analysis 63
33 Results 67
331 Clinical characteristics of patients 67
332 Mutations in the NPHS1 gene 67
333 Mutations in the NPHS2 gene 83
34 Discussion 86
35 References 90
4 Association of the ACE-II genotype with the risk of nephrotic
syndrome in Pakistani children 94
41 Introduction 95
42 Subjects and Methods 96
421 Sample collection 96
422 Genotyping 97
423 Statistical analysis 99
43 Results 99
44 Discussion 103
45 References 106
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 7: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/7.jpg)
VII
5 Association of the MTHFR gene polymorphisms
(C677T amp A1298C) with the nephrotic syndrome in Pakistani
children 109
51 Introduction 110
52 Materials and Methods 113
521 Genotyping 113
53 Results 115
54 Discussion 118
55 References 122
6 General Discussion 125
61 Genetic screening and counseling 129
62 Therapeutic options 131
63 Future perspectives 133
64 Conclusion 135
65 References 136
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 8: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/8.jpg)
i
Acknowledgments
All praise for Allah the most compassionate and the most merciful
I would like to express my sincerest gratitude to my mentor Dr Syed Qasim Mehdi
HI SI (Centre for Human Genetics and Molecular Medicine) for his guidance
advice and for provision of excellent laboratory facilities for doing scientific work
I gratefully acknowledge my supervisor Dr Aiysha Abid for her support and
valuable suggestions throughout this research work
I admire Dr Shagufta Khaliq (Co-supervisor) for her dedicated attitude towards
research and her encouragement and advice that has been a great source of
inspiration for me
I am thankful to my senior lab colleague Dr Sadaf Firast for her help and
cooperation
I thank all my lab colleagues for their help Miss Sadia Ajaz who helped me in
statistical analysis Mr Ali Raza for his help in DNA extraction and also great
ldquofightsrdquo with him that makes the environment lively Mr Hajan Shah for his
support and friendship
I am grateful to Dr Ali Lanewala and his team of the pediatric nephrology
department SIUT who provided samples and did clinical analysis of all the
nephrotic syndrome patients I am also very grateful to all the patients who
participated in this study
I thank our lab attendant Mr Mohammad Imran Baig for his support and hard
work
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 9: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/9.jpg)
ii
I am grateful to my best friend Sajida Batool (Nottinghum University UK) for her
constant love and support at every step in my life and especially for sharing
valuable research articles that were not available in Pakistan
It has been a privilege for me to work at the Sindh Institute of Urology and
Transplantation (SIUT) the worldrsquos largest kidney transplant centre I am
especially thankful to Dr Adeeb-ul-Hassan Rizvi HI SI Director SIUT for his kind
guidance laboratory facilities and funding for my research work
I acknowledge the love and support of my parents and family without which the
completion of this work would have not been possible
iii
List of abbreviations
ACD Acid Citrate Dextrose
ACE Angiotensin Converting Enzyme
ACEI Angiotensin Converting Enzyme Inhibitor
ACTN4 α-Actinin 4
AD Autosomal Dominant
Ang-I Angiotensin I
Ang-II Angiotensin II
APS Ammonium Persulphate
ARB Angiotensin Receptor Blocker
CBEC Centre for Biomedical Ethics and Culture
CD2AP CD2 Associated Protein
CNF Nephrotic Syndrome of Finnish Type
CNS Congenital Nephrotic Syndrome
CRF Chronic Renal Failure
CsA Cyclosporine
DAG Diacylglyecerol
DDS Denys-Drash Syndrome
DMS Diffuse Mesengial Sclerosis
DNA Deoxyribonucleic Acid
eGFR Estimated Glomerular Filtration Rate
EDTA Ethylenediaminetetraacetic Acid
ESRD End Stage Renal Disease
FECs Fenestrated Endothelial Cells
FS Frasier Syndrome
FSGS Focal Segmental Glomerulosclerosis
GBM Glomerular Basement Membrane
GFB Glomerular Filtration Barrier
GLEP1 Glomerular Epithelial Protein 1
Hcy Homocysteine
HSPG Heparin Sulfate Proteoglycans
HWE Hardy-Weinberg Equilibrium
ID InsertionDeletion Polymorphism
Ig Immunoglobulin
INF2 Inverted Formin 2
IP3 Inositol 1 4 5-Triphosphate
IRB Institutional Review Board
iv
LAMB2 Laminin Beta 2
MCD Minimal Change Disease
MCGN Mesengio Capillary Glomerulonephritis
MesPGN Mesengial Proliferative Glomerular Nephropathy
MGN Membranous Glomerulonephritis
MTHFR Methylenetetrahydrofolate Reductase
NPHS1 Nephrotic Syndrome Type 1
NPHS2 Nephrotic Syndrome Type 2
NS Nephrotic Syndrome
OD Optical Density
PAGE Polyacrylamide Gel Electrophoresis
4-PBA Sodium 4-Phenylbutyrate
PLC Phospholipase C
PLCE1 Phospholipase C Epsilon 1
PTPRO Protein Tyrosine Phosphatase
RAAS Renin-Angiotensin-Aldosterone System
RCLB Red Cell Lysis Buffer
RFLP Restriction Fragment Length Polymorphism
RTx Renal Transplantation
SD Slit Diaphragm
SDS Sodium Dodecyl Sulfate
SIUT Sindh Institute of Urology and Transplantation
SNPs Single Nucleotide Polymorphisms
SPSS Statistical Package for Social Sciences
SRNS Steroid Resistant Nephrotic Syndrome
SSNS Steroid Sensitive Nephrotic Syndrome
TBE Tris Boric Acid EDTA Buffer
TEMED N N N N Tetramethylethylenediamine
TRP Transient Receptor Potential
TRPC-6 Transient Receptor Potential Canonical Channel 6
WT1 Wilmrsquos Tumor
v
Publications
Saba Shahid Aiysha Abid S Qasim Mehdi Sadaf Firasat Ali Lanewala
S Ali Anwar Naqvi S Adeebul Hasan Rizvi Shagufta Khaliq (2012)
Association of the ACE-II genotype with the risk of nephrotic syndrome in
Pakistani children Gene 493 165-168 Erratum in Gene 2012 495 93
Aiysha Abid Shagufta Khaliq Saba Shahid Ali Lanewala Mohammad
Mubarak Seema Hashmi Javed Kazi Tahir Masood Farkhanda Hafeez S
Ali Anwar Naqvi S Adeebul Hasan Rizvi S Qasim Mehdi (2012) A
spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic
syndrome patients from Pakistan Gene 502 133-137
vi
List of Tables
Table Title
Page
11 Summary of genes that cause inherited NS
13
31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
65
32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
66
33 Clinical characteristics of children with idiopathic nephrotic
syndrome
68
34 Clinical characteristics of all 145 patients examined
69
35 List of homozygouscompound heterozygous mutations
identified in the NPHS1 gene
81
36 List of heterozygous mutationsvariants identified in the
NPHS1 gene
82
37 List of mutations identified in the NPHS2 gene
85
41 The clinical parameters of NS patients
99
42 Genotypic and allelic frequencies of the ACE ID
polymorphism and their distribution in terms of II ID and
IIDD genotypes with respect to DD genotype in NS patients
and controls
101
43 Frequency distribution of the ACE ID polymorphism in
SRNSSSNS FSGSnon-FSGS and MCDnon-MCD patients
102
51 The clinical parameters of NS patients
113
52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and
vii
CCCT genotypes with respect to TT genotype in NS patients
and controls
116
53 Frequency distribution of the MTHFR C677T polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
117
54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and
CCCA genotypes with respect to AA genotype in NS patients
and controls
119
55 Frequency distribution of the MTHFR A1298C polymorphism
in SRNSSSNS FSGSnon-FSGS and MCDnon-MCD
patients
120
viii
List of Figures
Figure Title
Page
11 Systemic diagram of the kidney and nephron structure
3
12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and
podocyte
5
13 Diagrammatic representation of the podocyte structure and SD
composed of nephrin podocin α-actinin 4 TRPC6 CD2AP
and PLCE1
8
14 Protein leakage through the GFB in nephrotic syndrome
10
15 Diagrammatic structure of the NPHS1 protein
15
16 An illustration of the membranous localization of podocin
protein
19
31 Illustration of the identified mutations in the NPHS1 gene and
their respective locations in the gene and protein domains
80
32 Illustration of the identified mutations in the NPHS2 gene and
their locations
84
41 ACE gene ID polymorphism genotyping on agarose gel
98
51 Dysregulation of MTHFR leads to the accumulation of
homocysteine
112
52 MTHFR gene C677T polymorphism genotyping on agarose
gel
114
53 MTHFR gene A1298C polymorphism genotyping on agarose
gel
114
ix
SUMMARY
x
SUMMARY
The kidneys play a central role in removing water soluble metabolic waste
products from the organism Many acquired and inherited renal diseases in humans
lead to kidney dysfunctions such as nephrotic syndrome (NS) It is a common
pediatric kidney disease associated with heavy proteinuria The underlying causes
of hereditary NS are the presence of defects in the podocyte architecture and
function Recent genetic studies on hereditary NS have identified mutations in a
number of genes encoding podocyte proteins In the work presented here genetic
screening of nephrotic syndrome was carried out for the first time in a cohort of
paediatric Pakistani patients The analyses conducted are (1) Mutation screening of
the nephrotic syndrome type 1 (NPHS1) and type 2 (NPHS2) genes (2) The
association studies of NS with insertiondeletion (ID) polymorphism of the
angiotensin converting enzyme (ACE) gene and (3) The C677T and A1298C
polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene
All the studies described in this thesis were approved by the Institutional
Ethical Review Committee and were according to the tenets of the Declaration of
Helsinki Informed consent was obtained from all the participants
1- A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric
nephrotic syndrome (NS) patients from Pakistan
This study was designed to screen the disease causing mutations in the
NPHS1 and NPHS2 genes in a Pakistani steroid resistant nephrotic syndrome
(SRNS) cohort For this study 145 cases of early onset and familial SRNS were
collected from the pediatric nephrology department at the Sindh Institute of
xi
Urology and Transplantation (SIUT) Mutation analysis was performed by direct
DNA sequencing of all exons of the NPHS1 and NPHS2 genes This study has
identified six novel homozygous mutations in the NPHS1 gene and four in the
NPHS2 gene The main findings of this work are mutations in the NPHS1 gene that
accounted for around 20 of the cases and the NPHS2 gene for 55 of the cases
with early onset NS Another important finding is the absence of disease-causing
mutations in the NPHS2 gene in the familial SRNS and congenital nephrotic
syndrome (CNS) cases These novel findings of a low mutation rate in the NPHS1
and NPHS2 genes are in contrast to the higher mutation rate reported from Europe
and America (39-55 and 10-28 respectively) and suggest that other genetic
causes of the disease remain to be identified
2- Association of the angiotensin converting enzyme (ACE) - II genotype with
the risk of nephrotic syndrome in Pakistani children
This study examined the association of insertiondeletion (ID)
polymorphism of the angiotensin converting enzyme (ACE) gene with nephrotic
syndrome in Pakistani children A total of 268 blood samples from NS patients and
223 samples from control subjects were used The genotyping of ACE gene
polymorphism was performed by the PCR method The results show a significant
association of the II genotype and the I allele of the ACE gene with NS in the
Pakistani children (OR=6755 CI= 3-149) These results suggest that the analysis
of ACE polymorphism should be performed for the early diagnosis of NS patients
in South Asian patients
xii
3- Association of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with nephrotic syndrome in Pakistani
children
The associations of methylenetetrahydrofolate reductase (MTHFR) gene
polymorphisms (C677T and A1298C) with NS were also examined in this study
Blood samples were obtained from 318 children with NS and 200 normal controls
and were analyzed using the polymerase chain reaction (PCR) and restriction
fragment length polymorphism (RFLP) methods A positive association between
NS and the C677T and A1298C polymorphisms of the MTHFR gene were not
observed in this study This too is in contrast to the higher incidence of the TT
genotype found to be associated with the early development of childhood focal
segmental glomerulosclerosis (FSGS) in Japanese children
In view of the results presented in this thesis genetic testing of the NPHS1
and NPHS2 genes following the diagnosis of NS may have important applications
regarding possible response to steroid treatment The low prevalence of mutations
in these genes in the Pakistani cohort compared to that in other populations of
Europe and the United States suggest the need of finding other genetic markers that
may be involved in disease pathogenesis
1
1 LITERATURE REVIEW ON NEPHROTIC
SYNDROME
2
11 THE KIDNEY
The kidney plays a central role in the regulation of blood pressure acid base
balance and the excretion of metabolic waste products from the blood In addition
the kidneys produce and secrete the hormones renin erythropoietin and 1 25-
dihydroxy vitamin D3 that play an important role in the regulation of the bodyrsquos
calcium and phosphate balance (Greenberg et al 2009)
111 STRUCTURE OF THE KIDNEY
Kidneys are bean shaped organs located in the retroperitoneal space They
exist in pairs each weighing about 150gm In adult humans 180 liters of blood is
filtered through the kidneys every 24 hours producing 1-15 liters of urine The
functional unit of the kidney is the nephron and each kidney has approximately 1
million of them Each nephron consists of a glomerular tuft and a long tubule that is
segmented into different parts the proximal tubule loop of Henle the distal tubule
and the collecting duct (Figure-11) The main filtration unit of the nephron is the
glomerulus It is composed of parietal epithelial cells of the Bowmanrsquos capsule
endothelial cells podocyte (visceral epithelial cells) and mesangial cells The blood
enters the glomerulus through an afferent blood vessel which branches into a
capillary tuft These capillaries form the glomerular filtration barrier (GFB)
responsible for the filtration of blood and the formation of urine The filtrate passes
through the GFB and is collected in the Bowmanrsquos capsule It is finally processed
in the tubular system of the kidney (Greenberg et al 2009)
3
Figure- 11 Systemic diagram of the kidney and nephron structure
(httpwwwpfizercozaruntimepopcontentrunaspxpageidref=2551)
4
112 GLOMERULAR FILTRATION BARRIER (GFB)
The glomerular filtration barrier (GFB) regulates the outflow of solutes
from the blood capillaries to the urinary space (Caulfield and Farquhar 1974) It
selectively permits the ultra filtration of water and solutes and prevents leakage of
large molecules (MW gt 40KDa) such as albumin and clotting factors etc
(Ruotsalainen et al 1999) GFB comprises of fenestrated endothelium glomerular
basement membrane (GBM) and podocyte foot process (Ballermann and Stun
2007 and see Figure-12) The integrity of each of these structural elements is
important for the maintenance of normal ultrafiltration The components of the
GFB are described in detail below
113 FENESTRATED ENDOTHELIAL CELLS (FECs)
The glomerular capillary endothelial cells form the inner lining of the
GBM They contain numerous pores (fenestrae) with a width of up to 100 nm
These pores are large enough to allow nearly anything smaller than a red blood cell
to pass through (Deen and Lazzara 2001) They are composed of negatively
charged proteoglycans and sialoproteins (Weinbaum et al 2007) These charged
molecules have been reported to restrict the filtration of albumin and other plasma
proteins They play an important role in the filtration of blood through the
glomeruli The dysregulation of the endothelial cells may be associated with
proteinuria as well as renal failure (Satchell and Braet 2009)
5
Figure-12 The glomerular filtration barrier comprises of the glomerular
basement membrane fenestrated endothelial cells and podocytes
(httpwwwbiodavidsoneducoursesimmunologyStudentsspring2000carterrest
rictedpaperhtml)
6
114 GLOMERULAR BASEMENT MEMBRANE (GBM)
The glomerular basement membrane (GBM) is a 300-350 nm thick
extracellular matrix It is located between the podocyte and the endothelial cell
layers It is made up of a meshwork of collagen type IV laminin nidogenentactin
and heparin sulfate proteoglycans (HSPG Gubler 2008) The laminin-collagen IV
and nidogen network provides structural support to the GBM and is involved in cell
adhesion and differentiation The HSPG consists of anionic perlecan and agrin
moieties This network forms an electric barrier for plasma protein (Groffen et al
1999) The GBM was initially thought to have a central role in macromolecular
filtration in a size and charge-selective manner (Caulfield and Farquhar 1974)
However recent studies have suggested their major role as a support structure for
the attachment of endothelial cells and podocyte (Goldberg et al 2009)
115 PODOCYTE
The podocytes are specialized epithelial cells that cover the outer surface of
the GBM They play an important role in the size and charge selective
permeability They are also involved in the synthesis and maintenance of the GBM
(Patrakka and Tryggvason 2009) The podocyte is composed of the cell body
which contains a nucleus golgi apparatus mitochondria and rough and smooth
endoplasmic reticulum (Pavenstadt et al 2003) It has several foot processes that
are interconnected with each other and coated with negatively charged molecules
called glycocalyx Glycocalyx is an anti-adhesive protein that is important for the
preservation of normal podocyte architecture and for limiting albumin leakage
(Doyonnas et al 2001) Foot processes are functionally defined by three
7
membrane domains the apical membrane domain the slit diaphragm (SD) and the
basal membrane domain associated with the GBM (Faul 2007) The SD bridges
the space between the adjacent podocyte foot processes It forms a zipper-like
structure with a constant width of 300-450 A and acts as a major size barrier to
prevent protein leakage (Rodewald and Karnovsky 1974) The slit diaphragm is
formed by several proteins including nephrin podocin ά-actinin 4 CD2-associated
protein transient receptor potential 6 channel protein etc (Hinkes et al 2006
Buumlscher and Weber 2012) These proteins play key roles in maintaining the
structural and functional integrity of the podocyte as shown in Figure-13 (Buumlscher
and Weber 2012) Several studies have suggested that the dysfunction of the SDndash
associated molecules cause proteinuria in nephrotic syndrome and some other
glomerular diseases (Shih et al 2001 Reiser et al 2005 Winn et al 2005)
12 GLOMERULAR DISEASES OF THE FILTRATION SYSTEM
Glomerular disorders are a major cause of kidney diseases Renal
dysfunction may be due to genetic factors infections or exposure to toxins Recent
studies have indicated that inherited impairment in the structure and function of the
glomerular filtration barrier ultimately leads to nephrotic syndrome (Clark and
Baratt 1999)
8
Figure- 13 Diagrammatic representation of podocyte structure and slit
diaphragm composed of nephrin podocin α-actinin 4 TRPC6 CD2AP and
PLCE1 (Buumlscher and Weber 2012)
9
121 NEPHROTIC SYNDRME (NS)
122 DEFINITION
Nephrotic syndrome (NS) is a set of symptoms associated with kidney
dysfunction It can be caused by several different defects that affect the kidneys It
is characterized by heavy proteinuria hypoalbuminemia hypercholesterolemia and
edema (Tune and Mendoza 1997) In humans nephrotic range proteinuria is
generally defined as the excretion of more than 35 gm of protein per 24 hours The
decrease in serum albumin level is secondary to the loss of protein in the urine The
underlying mechanism in the majority of patients with NS is permeability defect in
the GFB that allows the loss of proteins from the plasma into the urine (Clark and
Barrat 1999 see Figure-14)
NS is the most common glomerular disease in children (Braden et al
2000) The estimated incidence of pediatric NS is 20 to 27 per 100000 in the
USA with a cumulative frequency of 16 per 100000 Geographic or ethnic
differences have also been reported to contribute towards the incidence of NS with
a 6-fold higher incidence in the Asian than European populations (Sharples et al
1985)
123 CLASSIFICATIONS
NS can be clinically classified on the basis of the age of disease onset as
congenital (CNS) infantile and childhood CNS appears in utero or during the first
three months of life Infantile and childhood onset NS are diagnosed during and
after the first year of life respectively (Eddy and Symons 2003)
10
Figure-14 Protein leakage through the GFB in nephrotic syndrome
(httpwwwunckidneycenterorgkidneyhealthlibrarynephroticsyndromehtml)
11
NS in children is generally divided into steroid resistant (SRNS) and steroid
sensitive nephrotic syndrome (SSNS) depending on the patientrsquos response toward
steroid therapy 80-90 patients with sporadic NS respond well to steroid therapy
However approximately 10-20 children and 40 adults fail to do so and hence
are at a higher risk of developing end stage renal disease (ESRD Ruf et al 2004)
NS can also be categorized histologically into minimal change disease
(MCD) and focal segmental glomerosclerosis (FSGS Obedova et al 2006) MCD
is the most common cause of NS affecting 77 of children followed by FSGS
(8 International Study of Kidney Diseases in Children 1978) However recent
studies have shown a rise in the incidence of FSGS in the NS patients According
to the data available in Pakistan MCD and its variants are the leading cause of NS
in children (43 of cases) followed by FSGS (38 Mubarak et al 2009) Patients
with MCD usually respond to steroid treatment but are accompanied by more or
less frequent relapses FSGS is a histological finding that appears as focal (some of
the glomeruli) and segmental (part of an entire glomerulus) sclerosis of the
glomerular capillary tuft and manifests in proteinuria This histological finding has
been typically shown in steroid resistant NS patients The less frequent lesions are
diffuse mesangial sclerosis (DMS) mesengial membranoproliferative
glomerulonephritis (MesPGN) and membrane glomerulopathy (MG McTaggart
2005)
Most of the children with NS have been found to have a genetic
predisposition for developing this disease NS can occur sporadically but large
numbers of familial cases have also been reported (Eddy and Symons 2003) and
their mode of inheritance can either be autosomal dominant or recessive (Boute et
12
al 2002 Pollak et al 2007) Recent studies on NS have lead to the discovery of
several novel genes that encode proteins that are crucial for the establishment and
maintenance for podocyte Mutations found in different forms of NS are in the
NPHS1 (nephrin) NPHS2 (podocin) LAMB2 (laminin β2) PLCE1 (phospholipase
Cέ1) and PTPRO genes (protein tyrosine phosphatase) in the autosomal recessive
mode of inheritance The ACTN4 (alpha-actinin 4) WT1 (Wilmrsquos tumor) CD2AP
(CD2-associated protein) TRPC6 (transient receptor potential 6) and INF2 genes
(inverted formin-2) are involved in disease etiology are inherited in the autosomal
dominant mode (Buumlscher and Weber 2012)
Mutations in the NPHS1 and NPHS2 genes mainly cause a severe form of
NS in children with congenital and childhood onset The WT1 and LAMB2 genes
have been involved in syndromic forms of NS with other external manifestations
(Hinkes et al 2007) Mutations in the ACTN CD2AP and TRPC6 genes have been
involved in alterating the structure and function of podocyte (Patrie et al 2002
Reiser et al 2005 Winn et al 2005) Recently mutations in the PLCE1 INF2
PTPRO and MYO1E have been reported in the childhood familial cases of NS
(Hinkes et al 2006 Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
13
13 GENETICS OF NEPHROTIC SYNDROME
A brief overview of the different forms of NS caused by mutations in various genes (Table-11)
Tabe-11 Summary of genes that cause inherited NS
Inheritance Gene Protein Chromosome
Location Age of onset Pathology References
Autosomal
recessive
(AR)
NPHS1 Nephrin 19q131 Congenital
Childhood MCDFSGS
Kestila et al
1998
NPHS2 Podocin 1q25-q31 Childhood
Adulthood FSGSMCD
Boute et al
2000
LAMB2 Laminin 2 3p21 Congenital
Childhood DMSFSGS
Hinkes et al
2007
PLCE1 Phospholipase C epsilon 1 10q23 Childhood DMSFSGS Hinkes et al
2006
PTPRO Protein tyrosine
phosphatase 12p123 Childhood FSGSMCD
Ozaltin et
al 2011
Autosomal
dominant
(AD)
ACTN4 -actinin 4 19q13 Adulthood FSGS Kaplan et
al 2000
WT1 Wilmsrsquo tumor 1 11p13 Congenital
Childhood DMSFSGS
Mucha et al
2006
CD2AP CD2 associated protein 6p123 Adulthood FSGS Lowik et al
2007
TRPC6 Transient receptor
potential channel 6 11q21-22 Adulthood FSGS Winn et al
2005
INF2 Inverted formin-2 14q32 Adulthood FSGS Brown et al
2010
14
131 AUTOSOMAL RECESSIVE INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
132 CONGENITAL NEPHROTIC SYNDROME CAUSED BY THE NPHS1
GENE (NEPHRIN)
Congenital nephrotic syndrome (CNS) appears in utero or during the first
three months of life (Jalanko 2009) The most common form of CNS first
described by Hallman and colleagues (1956) was congenital nephrotic syndrome of
the Finnish type (CNF) It is characterized by massive proteinuria and nephrosis
which starts in utero (Hallman et al 1973) It rapidly progresses toward ESRD by
the age of 2 to 3 years (Heeringa et al 2008) The resulting phenotype includes
FSGS MCD and DMS (Koziell et al 2002 Lahdenkari et al 2004 Schultheiss et
al 2004)
Mutations in the nephrin gene (NPHS1 OMIM-602716) have been shown
to cause autosomal recessive SRNS worldwide but in Finland the incidence is
approximately 1 in 10000 newborns (Holmberg et al 1995) NPHS1 was
identified in 1998 by the positional cloning method It is localized on chromosome
19q131 and contains 29 exons (Kestila et al 1998) It encodes the multifunctional
protein nephrin which has a molecular weight of 180 KDa It belongs to the
immunoglobulin (Ig) family (Wartiovaara et al 2004) It contains eight
extracellular IgG like motifs a fibronectin III-like domain and a cytosolic C-
terminal tail (Figure-15 Koziell et al 2002 Tryggvason et al 2006)
15
Figure-15 Diagrammatic structure of the NPHS1 protein (Koziell et al
2002)
16
Nephrin is one of the most important structural protein of the podocyte
(Hinkes et al 2006) It is exclusively expressed in the kidney podocyte and is a
key functional component of the SD (Patrakka et al 2001) It plays an important
role in signaling between adjacent podocytes by interacting with podocin and
CD2AP (Khoshnoodi et al 2003 Sellin et al 2003) In the nephrin knockout
mice model the effacement of the podocyte foot processes caused deleterious
proteinuria and neonatal death (Putaala et al 2001) Thus nephrin is essential for
the development and function of the normal GFB
NPHS1 has been identified as the major gene involved in CNF The two
most important mutations found are Fin major (the deletion of nucleotides 121 and
122 leading to a frame shift mutation or stop codon) and Fin minor (nonsense
mutation encoding a truncated protein of 90 and 1109 amino acids Kestila et al
1998) These two mutations account for 95 of the CNF cases in the Finnish
population but are uncommon in other ethnic groups However in other studies on
European North American and Turkish children mutations in the NPHS1 gene
account for 39-55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri
et al 1999 Hinkes et al 2007 Heeringa et al 2008) To date more than 173
different mutations have been identified in the NPHS1 gene including deletions
insertions nonsense and missense mutations (Beltcheva et al 2001 Benoit et al
2010 Ovunc et al 2012)
The homozygous pR1160X mutation in the NPHS1 gene also leads to the
production of a truncated protein causing severe CNS in the first three months
(Koziell et al 2002) It is also reported to develop partial or complete remission in
17
adult hood with a milder phenotype in some patients (Koziell et al 2002) In
recent studies mutations in the NPHS1 gene have been identified in patients with
the age of disease onset ranging from 6 months to 8 years (Philippe et al 2008)
Another study in a Spanish cohort identified more disease causing mutations in the
NPHS1 than in the NPHS2 gene in patients with childhood onset diseases Further
compound heterozygous mutations (pR827X pR979S) were identified in patients
with childhood and adulthood glomerular disorder that also enhanced the clinical
severity in NS (Santin et al 2009)
The variability in disease onset is explained by functional and
computational studies Philippe and colleagues classified the nephrin mutations into
ldquosevererdquo or ldquomildrdquo mutations The severe mutations include nonsense truncated
frame shift splice-site (c609ndash2ArarrC) and missense (pL832P) mutations These
mutations cause a defect in the intracellular transport so that the mutant protein is
retained in the endoplasmic reticulum instead of being transported to the cell
surface This results in the loss of nephrin function which causes severe and early
onset NS On the other hand the milder mutations include missense mutations
(pLp96V pA107T pP575Q pR460Q and pR976S) that allow the mutant
protein to be targeted to the cell surface and to maintain partial protein function
Another splice site mutation (c2072ndash6CrarrG) allows some correct splicing and is
therefore considered a mild mutation This also explains the later onset of disease
in such cases (Philippe et al 2008) Mutation analysis in 15 families of Japanese
and Korean origin excluded the involvement of NPHS1 and NPHS2 in SRNS
(Kitamura et al 2006) This suggests an ethnic diversity in the involvement of
these genes in Asian SRNS patients
18
NS patients with the NPHS1 gene mutations generally show resistance to
steroid therapy (Jalanko 2009) However heterozygous mutations have been found
to respond to therapy and may therefore have a better long-term survival compared
to patients with compound heterozygous and homozygous mutations (Caridi et al
2004) Steroid therapy does not induce remission and the only treatment of choice
is kidney transplantation (Holmberg et al 1995) The recurrence of CNS may
account for 20ndash25 of the patients after renal transplantation (Patrakka et al
2002) However recently it has been reported that gt20 of CNS patients including
patients with NPHS1 mutations may respond to antiproteinuric treatment (Schoeb
et al 2010) Angiotensin-converting enzyme inhibitors are also beneficial in
reducing protein excretion (Sredharan and Bockenhauer 2005 Copelovitch et al
2007) Mutations identified in this gene provide greater insight in understanding of
the clinical manifestation and pathology of NS
133 NEPHROTIC SYNDROME CAUSED BY NPHS2 GENE (PODOCIN)
Mutations in the podocin gene (NPHS2 OMIM-604766) have been shown
to cause autosomal recessive SRNS This gene was identified in year 2000 by
positional cloning It is localized on chromosome 1q25-31 and comprises of 8
exons (Boute et al 2000) It encodes the integral membrane protein podocin (MW
42 KDa) that belongs to the stomatin family It has a single membrane domain
forming a hairpin like structure and both the N and C domains are in the cytosol
(Roselli et al 2002 Figure-16)
19
Figure-16 An illustration of the membranous localization of the
podocin protein (Rellel et al 2011)
20
It is specifically expressed in the podocyte at the foot processes It closely
interacts with nephrin CD2-associated protein and NEPH1 (Huber et al 2003
Roselli et al 2004) Mice lacking podocin develop proteinuria and die after a few
days of life due to fused foot processes and loss of SD that suggests their crucial
role in glomerular filtration (Roselli et al 2004)
Mutations in the podocin gene were originally found in infancy or
childhood but have also been reported in adult onset NS (Caridi et al 2001)
These NPHS2 gene mutations have generally been found with childhood onset
diseases but have also been reported in 51 of CNS cases of European origin
(Heringa et al 2008) These patients show characteristic NS presentation from
birth to 6 years of age and progress to ESRD before the end of the first decade of
life (Berdeli et al 2007 Hinkes et al 2007) Renal biopsies show either MCD or
FSGS and patients are generally steroid resistant (Ruf et al 2004)
Mutations are found in a high proportion in nephrotic syndrome patients
both in familial and sporadic cases (Weber et al 2004) They represent 45-55 of
familial cases and 8-20 of sporadic cases More than 100 pathogenic mutations
have been reported that include missense nonsense and deletion mutations (Caridi
et al 2004 Ruf et al 2004 Benoit et al 2010) Patients with frame shift or
truncation mutations have an early onset whereas patients with missense mutations
have a late onset nephropathy (Huber et al 2003 Roselli et al 2004) The most
frequent pathogenic mutation (pR138Q) has been found to cause earlier onset of
the disease (Weber et al 2004 Hinkes et al 2008) The mutant protein thus
produced is retained in the endoplasmic reticulum and fails to recruit nephrin to the
lipid raft (Huber et al 2003 Roselli et al 2004)
21
An NPHS2 gene variant (pR229Q) has been shown to cause late-onset NS
when found in association with another pathogenic NPHS2 mutation (Machuca et
al 2010 Santin et al 2011) This variant has been found commonly as a
nonsynonymous NPHS2 variant in Caucasians and is particularly common among
Europeans with an observed frequency of heterozygotes that ranges from 003-
013 (Pareira et al 2004 Franceschini et al 2006 Kottgen et al 2008) The
variability in disease severity suggests that some other non genetic or
environmental factors may also influence the disease presentation
The incidence of mutations in familial SRNS cases were found to be 40 in
European and American children 29 in Turkish 76 in Tunisian Libyan and
Moroccan families (Hinkes et al 2008 Ismaili et al 2009 Mbarek et al 2011)
The prevalence of mutations in the SRNS patients is higher in the Europeans and
Turks than in Asian children (Maruyama et al 2003)
Patients with homozygous or compound heterozygous mutations in the
NPHS2 gene do not respond to standard steroid therapy for NS Therefore genetic
testing for the NPHS2 gene mutations is recommended for every child upon
diseases presentation (Ruf et al 2004 Weber et al 2004) Thus podocin may be a
major contributor to the genetic heterogeneity of NS
134 NEPHROTIC SYNDROME CAUSED BY LAMB2 GENE (LAMININ
BETA 2)
Mutations in the laminin gene (LAMB2 OMIM-150325) have been shown
to cause autosomal recessive NS with or without ocular and neurological sclerosis
(Zenker et al 2004) In 1963 Pierson first described the association of glomerular
22
kidney disease with ocular abnormalities (Pierson et al 1963) The characteristic
clinical ophthalmic sign is microcoria or the fixed narrowing of the pupils (Zenker
et al 2004) The LAMB2 gene is localized on chromosome 3p21 and comprises of
32 exons It encodes the basement membrane protein laminin 2 (Tunggal et al
2000)
LAMB2 gene mutations are common in patients with NS manifesting in
their first year of life (Hinkes et al 2007) The histology showed characteristic
patterns of DMS and FSGS The disease causing nonsense and splices site
mutations lead to the formation of truncated protein and complete loss of laminin
β2 expression in patients with Pierson syndrome (Zenker et al 2004) Milder
phenotype of the disease has been shown in some cases of infantile NS with
homozygous or compound heterozygous mutations (Hasselbacher et al 2006
Matejas et al 2006 Choi et al 2008 Kagan et al 2008 Chen et al 2011) This
syndrome shows early progression to ESRD during the first 3 months of life and
the only treatment of choice is kidney transplantation The recurrence of DMS has
not been observed in transplanted patients (Matejas et al 2010) In animal models
of the Pierson syndrome the laminin knockout mice present a disorganized GBM
with proteinuria whereas podocyte foot processes and SD are normal (Noakes et
al 1995) These studies strongly suggest that laminin β2 has an important role in
maintaining the structural and functional integrity of the GFB
23
135 NEPHROTIC SYNDROME CAUSE BY PLCE1 GENE
(PHOSPHOLIPASE C EPSILON-1)
Mutations in the phospholipase C epsilon-1 gene (PLCE1 OMIM-608414)
have been shown to cause childhood onset recessive form of NS with DMS andor
FSGS as histological presentations It is localized on chromosome 10q23 and
comprises of 35 exons (Hinkes et al 2006) It encodes the phospholipase C (PLC)
enzyme that catalyzes the hydrolysis of phosphatidylinositides to the second
messenger inositol 1 4 5-triphosphate (IP3) and diacylglyecerol (DAG) The
second messenger IP3 is involved in intracellular signaling that is important for cell
growth and differentiation (Wing et al 2003) In the kidney PLCE1 is expressed
in the podocyte (Hinkes et al 2006) Mutations in the PLCE1 gene have been
identified in 286 of 35 famillies that showed a histological pattern of DMS in a
worldwide cohort (Gbadegesin et al 2008) Recent studies have found
homozygous mutations in phenotypically normal adults and have suggested that
some other factors could also be involved in disease presentation (Gilbert et al
2009 Boyer et al 2010) Hinkes and colleagues have reported that some patients
carrying the PLCE1 gene mutation respond to steroid therapy (Hinkes et al 2006)
NS caused by mutations in the PLCE1 gene is the only type that can be treated by
steroid therapy thus providing the clinicians an opportunity to treat hereditary NS
(Weins and Pollak 2008)
24
136 NEPHROTIC SYNDROME CAUSED BY PTPRO GENE (PROTEIN
TYROSINE PHOSPHATASE RECEPTOR-TYPE O)
Mutations in the protein tyrosine phosphatase receptor-type O gene
(PTPRO OMIM-600579) have been shown to cause autosomal recessive NS It is
localized on chromosome 12p123 and contains 26 exons It encodes a receptor-like
membrane protein tyrosine phosphatase that is also known as glomerular epithelial
protein 1 (GLEPP1) It is expressed at the apical membrane of the podocyte foot
processes in the kidney (Ozaltin et al 2011) The splice site mutations in the
PTPRO gene were identified in familial cases of Turkish origin with childhood
onset of disease (Ozaltin et al 2011) The Ptpro null mice showed altered
podocyte structure and low glomerular filtration rate This study has suggested its
role in the regulation of podocyte structure and function (Wharram et al 2000)
14 AUTOSOMAL DOMINANT INHERITANCE OF STEROID
RESISTANT NEPHROTIC SYDROME (SRNS)
141 NEPHROTIC SYNDROME CAUSED BY ACTN4 GENE ( -
ACTININ- 4)
Mutations in the α-actinin 4 gene (ACTN-4 OMIM-604638) have been
reported to cause the familial form of infantile or adult onset NS with an autosomal
dominant (AD) mode of inheritance (Kaplan et al 2000 Pollak et al 2007) It is
localized on chromosome 19q13 and contains 21 exons (Kaplan et al 2000) It
encodes ά-actinin 4 a 100 KDa homodimeric cytoskeletal protein It is an actin
25
binding and cross linking protein that is essential for the podocyte cytoskeleton and
for motility (Weins et al 2007) It is highly expressed in the podocyte in the
glomeruli and interacts with the β integren protein cell adhesion molecules and
signaling proteins (Otey and Carpen 2004) The ά-actinin 4 is responsible for the
interaction between the actin cytoskeleton and the cellular membrane of podocyte
(Honda et al 1998) Actinin knockout mice develop proteinuria and die after 10
weeks with progressive glomerulosclerosis (Kos et al 2003) suggesting their role
in glomerular disease (Yau et al 2004)
Mutations in the ACTN4 gene are less frequent than in the NPHS1 and
NPHS2 genes in associated nephropathies (Obedova et al 2006) The ACTN4 gene
mutations (pI149del pW59R pV801M pR348Q pR837Q pR310Q pK228E
pT232I and pS235P) have been identified in five different families with an AD
mode of inheritance These mutations cause mild proteinuria in teen ages of the
patients and slow progression to ESRD in later life (Kaplan et al 2000 Weins et
al 2005) Most of the mutations in this gene are missense with increased affinity
towards F-actin that alters the mechanical characteristics of the podocyte (Kaplan et
al 2000) However a novel de novo mutation (pS262F) has also been identified
in familial cases of the age of 3-5 years with rapid progression toward ESRD (Choi
et al 2008) Recent studies have also reported a positive association of the
promoter region SNPs in this gene with idiopathic FSGS (Dai et al 2009 2010)
The recurrence of FSGS was not observed after renal transplantation in ACTN4
associated disease
26
142 NEPHROTIC SYNDROME CAUSED BY WT1 GENE (WILMrsquos
TUMOR)
Mutations in the Wilmrsquos tumor gene (WT1 OMIM-607102) have been
reported to cause AD form of SRNS (Mucha et al 2006) WT1 is a zinc finger
tumor suppressor gene and was identified in 1990 The WT1 gene spans
approximately 50 kb on chromosome 11p13 and encodes a 52-54 KDa transcription
factor (Call et al 1990) It contains 10 exons (Haber and Buckler 1992) Exons 1ndash
6 of the gene encode a prolineglutamine rich transcriptional regulatory region
whereas exons 7ndash10 encode the four zinc fingers of the DNA-binding domain
(Reddy and Licht 1996) WT1 expression is critically involved in the normal
development of the kidney and gonads In the kidney it is specifically expressed in
podocyte (Pritchard-Jones et al 1990) Mutations in this gene cause idiopathic
SRNS kidney tumor and glomerular nephropathy in children (Denamur et al
2000 Mucha et al 2006)
The WT1 gene mutations have been identified in patients with Wilmrsquos
tumor Denys-Drash syndrome (DDS OMIM-194080) and Frasier syndrome (FS
OMIM-136680 McTaggart et al 2001) In DDS the clinical presentations include
early onset NS rapid progression toward ESRD urogenital abnormalities XY
pseudohermaphrodism (female phenotype and male genotype) and Wilmrsquos tumor
DDS usually starts within the first year of life with a characteristic histology of
DMS (Habib et al 1985 Mueller 1994) In this gene deletion insertion nonsense
and frame shift mutations have been identified (Little et al 2005) Approximately
95 of the reported mutations are missense and are mainly found in exons 8 and 9
that code for the zinc finger domains 2 and 3 respectively (Jeanpierre et al 1998
27
Koziell et al 1999 Orloff et al 2005) The most common mutation found in this
syndrome is (pR394W) that affects the zinc finger domain 3 resulting in the loss or
alteration of its DNA binding ability (Hastie 1992)
Frasier syndrome is characterized by male pseudohermaphrodism
progressive glomerulopathy with FSGS and late onset ESRD Patients usually
present normal female external genitalia streak gonads and XY karyotype (Niaudet
and Gubler 2006) The knockout mice model showed the absence of both kidneys
and gonads suggesting a crucial role of the WT1 gene in the development of the
genitourinary tract (Patek et al 2003) The splice site mutations in WT1 gene
specifically insertion or deletion of a three amino acids lysine threonine and serine
(KTS) region seems important for normal glomerulogenesis and sex determination
(Barbaux et al 1997 Hammes et al 2001 Lahiri et al 2006) This splice site
mutation has been found in 12 young females with SRNS (Aucella et al 2006)
Several single nucleotide polymorphisms (SNPs) in the WT1 gene have been shown
to be associated with FSGS in the high-risk group of African Americans (Orloff et
al 2005) However further studies are needed to confirm the association of these
SNPs with the pathogenesis of NS by altering the WT1 function
143 NEPHROTIC SYNDROME CAUSED BY CD2AP GENE (CD2
ASSOCIATED PROTEIN)
Mutations in the CD2AP gene (CD2AP OMIM-604241) have been
reported to cause adult onset NS with FSGS CD2AP gene is localized on
chromosome 6p123 and comprises of 18 exons It encodes a multifunctional
adaptor protein of 80 KDa and is presents in the cytoplasm membrane ruffles and
28
leading edges of cells (Kirsch et al 1999) It was initially identified as a ligand
molecule for the T cells adhesion protein CD2 (Dustin et al 1998 Shih et al
1999) It is expressed primarily in podocyte at the site of SD The CD2 associated
protein specifically interacts with nephrin and plays an important role in the
maintenance of the podocyte structure (Shih et al 1999) The specificity of
nephrin and CD2 associated protein interaction was confirmed by the finding that
the C-terminal domain of CD2AP specifically interacts with the cytoplasmic
domain of nephrin (Dustin et al 1998 Shih et al 2001) CD2AP also acts as a
scaffolding protein in the dynamic regulation of the actin cytoskeleton of the
podocyte (Lowik et al 2007)
Mutations in the CD2AP gene cause pediatric and adult onset FSGS To
date five heterozygous and one homozygous mutations have been identified in the
NS patients Lowik and colleagues have provided the first supportive data of a
direct involvement of CD2AP in NS with the identification of a homozygous
truncating (pR612X) mutation of the CD2AP gene in a 10 months old NS child
(Lowik et al 2008) The splice site heterozygous mutation has also been identified
in two African Americans with FSGS (Kim et al 2003) Recent studies in Italy
have found three heterozygous mutations (pK301M pT374A and pdelG525) in
NS patients (Gigante et al 2009) The CD2 associated protein knockout mice have
been shown to develop proteinuria after 2 weeks and they died of renal failure at 6
weeks of age indicating the role of CD2AP in the pathogenesis of NS (Shih et al
1999) Thus further studies are required for confirming the true association with
CD2AP in NS pathogenesis
29
144 NEPHROTIC SYNDROME CAUSED BY TRPC6 GENE (TRANSIENT
RECEPTOR POTENTIAL CANONICAL CHANNEL 6)
Mutations in the transient receptor potential canonical channel 6 gene
(TRPC6 OMIM-603652) have been reported to cause adult onset FSGS with an
AD mode of inheritance (Reiser et al 2005 Winn et al 2005) It is localized on
chromosome 11q21-22 and comprises of 13 exons (Drsquo Esposito et al 1998) It
encodes the transient receptor potential canonical channel 6 (TRPC6) a member of
the transient receptor potential (TRP) ions channels that regulates the amount of
calcium pumped inside the cells It is expressed in the tubules and the glomeruli of
the kidney including podocyte and glomerular endothelial cells It interacts with
nephrin signaling molecules and cytoskeleton elements to regulate SD and
podocyte (Reiser et al 2005) The increased expression of TRPC6 in glomerular
podocyte causes a verity of glomerular diseases including MCD FSGS and MG
(Moller et al 2007) Mutations in the TRPC6 gene were first identified in a family
from Newzeland with an AD form of FSGS A missense (pP112Q) mutation
causes higher calcium influx in response to stimulation by Ang II The increased
signaling of calcium is responsible for podocyte injury and foot processes
effacement Mutation in the TRPC6 gene causes a later onset of diseases and milder
phenotype (Winn et al 2005)
Reiser and colleagues (2005) have reported mutations in the TRPC6 gene
(pN143S pS270T pR895C pE897K and pK874X) in five unrelated families of
Western European African and Hispanic ancestries The recent studies also
reported novel mutations in children and in adults with sporadic cases of FSGS
(Heeringa et al 2009 Santin et al 2009 Mir et al 2011) Zhu and colleagues
30
(2009) have found a novel mutation (pQ889K) in Asians that is associated with
FSGS (Zhu et al 2009) Mutation analysis studies have shown that TRPC6
mutations alter podocyte function control of cytoskeleton and foot process
architecture (Reiser et al 2005) Thus mutations in the TRPC6 gene are
responsible for massive proteinuria and ultimately lead to kidney failure in FSGS
145 NEPHROTIC SYNDROME CAUSED BY INF2 GENE (INVERTED
FORMIN-2)
Mutations in the inverted formin-2 gene (INF2 OMIM-610982) have been
reported to cause the familial AD form of FSGS (OMIM-603278) It is localized on
chromosome 14q3233 and comprises of 22 exons (Brown et al 2010) It encodes
a member of the formin family of actin regulating proteins that plays an important
role in actin filament assembly (Faix and Grosse 2006) The INF2 protein has the
distinctive ability to accelerate both polymerization and depolarization of actin It is
highly expressed in the glomerular podocyte It plays a key role in the regulation of
podocyte structure and function (Faul et al 2007)
Mutations in the INF2 gene have been found in families showing moderate
proteinuria and FSGS lesion in early adolescence or adulthood (Boyer et al 2011)
They account for about 12-17 of familial dominant FSGS cases The disease
often progresses to ESRD All of the mutations identified todate effect the N-
terminal end of the protein suggesting a critical role of this domain in INF2
function (Brown et al 2011) Thus mutation screening provides additional insight
into the pathophysiologic mechanism connecting the formin protein to podocyte
dysfunction and FSGS
31
15 NEPHROTIC SYNDROME CAUSED BY OTHER GENETIC
FACTORS
151 ANGIOTENSIN CONVERTING ENZYME (ACE) GENE
INSERTIONDELETION POLYMORPHISM
The angiotensin converting enzyme (ACE) gene insertiondeletion (ID)
polymorphisms have been extensively investigated in the pathogenesis of NS
(Luther et al 2003) The insertion or deletion of a 287 bp Alu repeat sequence in
intron 16 of the ACE gene is defined as an ID polymorphism (Rigat et al 1990)
ACE catalyzes the conversion of an inactive angiotensin I (AngndashI) into a
vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem et
al 2004) The deletion allele (D) has been associated with the higher
concentration of plasma ACE and AngndashII levels (Rigat et al 1990) An increased
ACE level has deleterious effects on renal hemodynamics and enhances
proteinuria (Oktem et al 2004) The use of ACE inhibitors reduces proteinuria in
patients with NS The reduction of proteinuria in these patients has suggested the
involvement of ACE inhibitors in the pathogenesis of NS (White et al 2003)
Therefore this study was carried out to determine the association of this
polymorphism with the risk of NS in Pakistani children The present study also
evaluates the effect of this polymorphism on the response to steroid therapy and
histological findings for FSGS and MCD in these patients
32
152 METHYLTETRAHYDROFOLATE REDUCTASE ENZYME
(MTHFR) GENE POLYMORPHISMS
The methyltetrahydrofolate reductase (MTHFR) enzyme plays an important
role in homocysteine and folate metabolism It catalyzes the NADPH-linked
reduction of 5 10 methyltetrahydrofolate to 5-methyltatrahydrofolate (Goyette et
al 1994) The two most common single nucleotide polymorphisms (SNPs C677T
and A1298C) in the MTHFR gene are known to cause elevated homocysteine levels
in the blood (Weisberg et al 1998 Lucock 2000) Hyperhomocysteinemia is an
independent risk factor for thrombosis atherosclerosis cardiovascular and renal
diseases etc (Buyukcelik et al 2008 Ferechide and Radulescu 2009 Kniazewska
et al 2009 Ciaccio and Bellia 2010) and similar complications are also associated
with the nephrotic syndrome (Louis et al 2003 Kniazewska et al 2009) These
observations emphasize the role of homocysteine metabolism in the NS patients
The present study investigated the role of these polymorphisms for the first time in
Pakistani NS children
For the population based studies described here the Hardy-Weinberg
Equlibrium (HWE) was examined The HW law is an algebraic expression for
genotypic frequencies in a population If the population is in HWE the allele
frequencies in a population will not change generation after generation The allele
frequencies in this population are given by p and q then p + q = 1
Genotype frequencies are given as p + q = 1rarr p2 + 2pq + q
2 = 1
33
16 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) Spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Aucella F Bisceglia L De Bonis P Gigante M Caridi G Barbano G Mattioli G
Perfumo F Gesualdo L Ghiggeri GM (2006) WT1 mutations in nephrotic
syndrome revised High prevalence in young girls associations and renal
phenotypes Pediatr Nephrol 21 1393-1398
Ballermann BJ Stan RV (2007) Resolved capillary endothelium is a major
contributor to the glomerular filtration barrier J Am Soc Nephrol18 2432-2438
Barbaux S Niaudet P Gubler MC Gruumlnfeld JP Jaubert F Kuttenn F Feacutekeacuteteacute CN
Souleyreau-Therville N Thibaud E Fellous M McElreavey K (1997) Donor
splice-site mutations in WT1 are responsible for Frasier syndrome Nat Genet 17
467-470
Beltcheva O Martin P Lenkkeri U Tryggvason K (2001) Mutation spectrum in
the nephrin gene (NPHS1) in congenital nephrotic syndrome Hum Mutat 17 368-
373
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Berdeli A Mir S Yavascan O Serdaroglu E Bak M Aksu N Oner A Anarat A
Donmez O Yildiz N Sever L Tabel Y Dusunsel R Sonmez F Cakar N (2007)
NPHS2 (podocin) mutations in Turkish children with idiopathic nephrotic
syndrome Pediatr Nephrol 22 2031-2040
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the Glomerular
protein podocin is mutated in autosomal recessive steroid-resistant NS Nat Genet
24 349-354
Boute N Roselli S Gribouval O Niaudet P Gubler MC Antignac C (2002)
Characterization of the NPH2 gene coding for the glomerular protein podocin
implicated in a familial form of cortico-resistant nephrotic syndrome transmitted as
an autosomal recessive Nephrologie 23 35-36
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
34
Boyer O Benoit G Gribouval O Nevo F Tecircte MJ Dantal J Gilbert-Dussardier B
Touchard G Karras A Presne C Grunfeld JP Legendre C Joly D Rieu P Mohsin
N Hannedouche T Moal V Gubler MC Broutin I Mollet G Antignac C (2011)
Mutations in INF2 are a major cause of autosomal dominant focal segmental
glomerulosclerosis J Am Soc Nephrol 22 239-245
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Jr Germain MJ
(2000) Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35
878-883
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr 171 1151-1160
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Call KM Glaser T Ito CY Buckler AL Pelletier J Haber DA Rose EA Krai A
Yeger H Lewis WH Jones C Housman DE (1990) Isolation and characterization
of zinc finger polypeptide gene at the human chromosome 11 Wilmsrsquo tumor locus
Cell 60 509-520
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant non familial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin
of proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Caulfield JP Farquhar MG (1974) The permeability of Glomerular capillaries to
graded dextrans Identification of the basement membrane as the primary filtration
barrier J Cell Biol 63 883-903
35
Chen YM Kikkawa Y Miner JH (2011) A Missense LAMB2 Mutation Causes
Congenital Nephrotic Syndrome by Impairing Laminin Secretion J Am Soc
Nephrol 22 849-858
Choi HJ Lee BH Kang JH Jeong HJ Moon KC Ha IS Yu YS Matejas V
Zenker M Choi Y Cheong HI (2008) Variable phenotype of Pierson syndrome
Pediatr Nephrol 23 995-1000
Choi HJ Lee BH Cho HY Moon KC Ha IS Nagata M Choi Y Cheong HI
(2008) Familial focal segmental glomerulosclerosis associated with an ACTN4
mutation and paternal germ line mosaicism Am J Kidney Dis 51 834-838
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Clark AG Barratt TM Steroid-responsive nephritic syndrome In Pediatric
Nephrology 4th
Edition Baratt TM Avner ED Harmon WE Baltimore Lippincott
Williams amp Wilkins 1999 731-747
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Dai S Wang Z Pan X Chen X Wang W Ren H Feng Q He JC Han B Chen N
(2009) ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic
focal segmental glomerulosclerosis Nephron Clin Pract 111 c87-94
Dai S Wang Z Pan X Wang W Chen X Ren H Hao C Han B Chen N (2010)
Functional analysis of promoter mutations in the ACTN4 and SYNPO genes in
focal segmental glomerulosclerosis Nephrol Dial Transplant 25 824-835
Deen WM Lazzara MJ (2001) Effects of plasma proteins on sieving of tracer
macromolecules in glomerular basement membrane Am J Physiol Renal Physiol
281 F860-868
Denamur E Bocquet N Baudouin V Silva FD Veitia R Peuchmaur M Elion J
Gubler MC Fellous M Niaudet P Loirat C (2000) WT1 splice-site mutations are
rarely associated with primary steroid-resistant focal and segmental
glomerulosclerosis Kidney Int 57 1868-1872
DrsquoEsposito M Strazzullo M Cuccurese M Spalluto C Rocchi M DrsquoUrso M
Ciccodicola A (1998) Identification and assignment of the humantransient
receptor potential channel 6 gene TRPC6 to chromosome 11q21ndashgtq22 Cytogenet
Cell Genet 83 46-47
Doyonnas R Kershaw DB Duhme C Merkens H Chelliah S Graf T McNagny
KM (2001) Anuria omphalocele and perinatal lethality in mice lacking the
CD34-related protein podocalyxin J Exp Med 194 13-27
36
Dustin ML Olszowy MW Holdorf AD Li J Bromley S Desai N Widder P
Rosenberger F van der Merwe PA Allen PM Shaw AS (1998) A novel adaptor
protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts
Cell 94 667-677
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Faul C Asanuma K Yanagida-Asanuma E Kim K Mundel P (2007) Actin up
regulation of podocyte structure and function by components of the actin
cytoskeleton Trends Cell Biol 17 428-437
Faix J Grosse R (2006) Staying in shape with formins Dev Cell 10 693-706
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Franceschini N North KE Kopp JB McKenzie L Winkler C (2006) NPHS2
gene nephrotic syndrome and focal segmental glomerulosclerosis a HuGE review
Genet Med 8 63-75
Gbadegesin R Hinkes BG Hoskins BE Vlangos CN Heeringa SF Liu J Loirat
C Ozaltin F Hashmi S Ulmer F Cleper R Ettenger R Antignac C Wiggins RC
Zenker M Hildebrandt F (2008) Mutations in PLCE1 are a major cause of
isolated diffuse mesangial sclerosis (IDMS) Nephrol Dial Transplant 231291-
1297
Gilbert RD Turner CL Gibson J Bass PS Haq MR Cross E Bunyan DJ Collins
AR Tapper WJ Needell JC Dell B Morton NE Temple IK Robinson DO
(2009) Mutations in phospholipase C epsilon 1 are not sufficient to cause diffuse
mesangial sclerosis Kidney Int 75 415-419
Gigante M Pontrelli P Montemurno E Roca L Aucella F Penza R Caridi G
Ranieri E Ghiggeri GM Gesualdo L (2009) CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis (FSGS)
Nephrol Dial Transplant 24 1858-1864
Goldberg S Harvey SJ Cunningham J Tryggvason K Miner JH (2009)
Glomerular filtration is normal in the absence of both agrin and perlecan-heparan
sulfate from the glomerular basement membrane Nephrol Dial Transplant 24
2044-2051
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
37
Greenberg A Cheung AK Coffman TM Falk RJ Jennette JC Overview of
kidney function and structure In Primer on kidney diseases 5th
Edition The
National Kidney Foundation Saunders Philadelphia PA 2009 3-4
Groffen AJ Veerkamp JH Monnens LA van den Heuvel LP (1999) Recent
insights into the structure and functions of heparan sulfate proteoglycans in the
human glomerular basement membrane Nephrol Dial Transplant 14 2119-2129
Gubler MC (2008) Inherited diseases of the glomerular basement membrane Nat
Clin Pract Nephrol 4 24-37
Haber DA Buckler AJ (1992) WT1 a novel tumor suppressor gene inactivated in
wilmsrsquo tumor New Biol 4 97-106
Habib R Loirat C Gubler MC Niaudet P Bensman A Levy M Broyer M
(1985) The nephropathy associated with male pseudohermaphrodism and Wilmrsquos
tumor (Drash syndrome) a distinctive glomerular lesion-report of 10 cases Clin
Nephrol 24 269-278
Hallman N Norio R Rapola J (1973) Congenital nephrotic syndrome Nephron
11 101-110
Hammes A Guo JK Lutsch G Leheste JR Landrock D Ziegler U Gubler MC
Schedl A (2001) Two splice variants of the Wilmsrsquo tumor 1 gene have distinct
functions during sex determination and nephron formation Cell 106 319-329
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the
clinical spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hastie ND (1992) Dominant negative mutations in the Wilms tumour (WT1) gene
cause Denys-Drash syndrome--proof that a tumour-suppressor gene plays a crucial
role in normal genitourinary development Hum Molec Genet 1 293-295
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
Heeringa SF Moumlller CC Du J Yue L Hinkes B Chernin G Vlangos CN Hoyer
PF Reiser J Hildebrandt F (2009) A novel TRPC6 mutation that causes
childhood FSGS PLoS 4 e7771
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
38
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Hinkes B Vlangos C Heeringa S Mucha B Gbadegesin R Liu J Hasselbacher K
Ozaltin F Hildebrandt F APN Study Group (2008) Specific podocin mutations
correlate with age of onset in steroid-resistant nephrotic syndrome J Am Soc
Nephrol 19 365-371
Holmberg C Antikainen M Ronnholm K Ala Houhala M Jalanko H (1995)
Management of congenital nephrotic syndrome of the Finnish type Pediatr
Nephrol 9 87-93
Honda K Yamada T Endo R Ino Y Gotoh M Tsuda H Yamada Y Chiba H
Hirohashi S (1998) Actinin-4 a novel actin-bundling protein associated with cell
motility and cancer invasion J Cell Biol 140 1383-1393
Huber TB Simons M Hartleben B Sernetz L Schmidts M Gundlach E Saleem
MA Walz G Benzing T (2003) Molecular basis of the functional podocin-
nephrin complex mutations in the NPHS2 gene disrupt nephrin targeting to lipid
raft microdomains Hum Mol Genet 12 3397-3405
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Ismaili K Pawtowski A Boyer O Wissing KM Janssen F Hall M (2009)
Genetic forms of nephrotic syndrome a single-center experience in Brussels
Pediatr Nephrol 24 287-294 Erratum in Pediatr Nephrol 2009 24 425
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Jeanpierre C Denamur E Henry I Cabanis MO Luce S Ceacutecille A Elion J
Peuchmaur M Loirat C Niaudet P Gubler MC Junien C (1998) Identification of
constitutional WT1 mutations in patients with isolated diffuse mesangial sclerosis
39
and analysis of genotypephenotype correlations by use of a computerized mutation
database Am J Hum Genet 62 824-833
Kagan M Cohen AH Matejas V Vlangos C Zenker M (2008) A milder variant
of Pierson syndrome Pediatr Nephrol 23 323-327
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin-4 cause familial focal segmental
glomerulosclerosis Nature Genet 24 251-256
Karle SM Uetz B Ronner V Glaeser L Hildebrandt F Fuchshuber A (2002)
Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant
nephrotic syndrome J Am Soc Nephrol 13 388-393
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Khoshnoodi J Sigmundsson K Ofverstedt LG Skoglund U Obrink B
Wartiovaara J Tryggvason K (2003) Nephrin promotes cell-cell adhesion through
homophilic interactions Am J Pathol 163 2337-2346
Kitamura A Tsukaguchi H Iijima K Araki J Hattori M Ikeda M Honda M
Nozu K Nakazato H Yoshikawa N Kagami S Muramatsu M Choi Y Cheong
HI Doi T (2006) Genetics and clinical features of 15 Asian families with steroid-
resistant nephrotic syndrome Nephrol Dial Transplant 21 3133-3138
Kim JM Wu H Green G Winkler CA Kopp JB Miner JH Unanue ER Shaw
AS (2003) CD2-associated protein haploinsufficiency is linked to glomerular
disease susceptibility Science 300 1298-1300
Kirsch KH Georgescu MM Ishimaru S Hanafusa H (1999) CMS an adapter
molecule involved in cytoskeletal rearrangements Proc Natl Acad Sci USA 96
6211-6216
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kos CH Le TC Sinha S Henderson JM Kim SH Sugimoto H Kalluri R
Gerszten RE Pollak MR (2003) Mice deficient in alpha-actinin-4 have severe
glomerular disease J Clin Invest 111 1683-1690
40
Kottgen A Hsu CC Coresh J Shuldiner AR Berthier-Schaad Y Gambhir TR
Smith MW Boerwinkle E Kao WH (2008) The association of podocin R229Q
polymorphism with increased albuminuria or reduced estimated GFR in a large
population-based sample of US adults Am J Kidney Dis 52 868-875
Koziell AB Grundy R Barratt TM Scambler P (1999) Evidence for the genetic
heterogeneity of nephropathic phenotypes associated with Denys-Drash and Frasier
syndromes Am J Hum Genet 64 1778-1781
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahiri D Dutton JR Duarte A Moorwood K Graham CF Ward A (2006)
Nephropathy and defective spermatogenesis in mice transgenic for a single isoform
of the Wilmsrsquo tumour suppressor protein WT1-KTS together with one disrupted
Wt1 allele Mol Reprod Dev 74 300-311
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Mauml nnikkouml M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Little S Hanks S King-Underwood L Picton S Cullinane C Rapley E Rahman
N Pritchard-Jones K (2005) A WT1 exon 1 mutation in a child diagnosed with
Denys-Drash syndrome Pediatr Nephrol 20 81-85
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Loumlwik M Levtchenko E Westra D Groenen P Steenbergen E Weening J Lilien
M Monnens L van den Heuvel L (2008) Bigenic heterozygosity and the
development of steroid-resistant focal segmental glomerulosclerosis Nephrol Dial
Transplant 23 3146-3151
41
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Luther Y Bantis C Ivens K Fehsel K Kolb-Bachhofen V Heering P (2003)
Effects of the genetic polymorphisms of the renin-angiotensin system on focal
segmental glomerulosclerosis Kidney Blood Press Res 26 333-337
Matejas V Al-Gazali L Amirlak I Zenker M (2006) A syndrome comprising
childhood-onset glomerular kidney disease and ocular abnormalities with
progressive loss of vision is caused by mutated LAMB2 Nephrol Dial Transplant
21 3283-3286
Matejas V Hinkes B Alkandari F Al-Gazali L Annexstad E Aytac MB Barrow
M Blahova K Bockenhauer D Cheong HI Maruniak-Chudek I Cochat P Dotsch
J Gajjar P Hennekam RC Janssen F Kagan M Kariminejad A Kemper MJ
Koenig J Kogan J Kroes HY Kuwertz-Broking E Lewanda AF Medeira A
Muscheites J Niaudet P Pierson M Saggar A Seaver L Suri M Tsygin A Wuhl
E Zurowska A Uebe S Hildebrandt F Antignac C Zenker M (2010) Mutations
in the human laminin beta2 (LAMB2) gene and the associated phenotypic
spectrum Hum Mutat 31 992-1002
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Maruyama K Iijima K Ikeda M Kitamura A Tsukaguchi H Yoshiya K Hoshii
S Wada N Uemura O Satomura K Honda M Yoshikawa N (2003) NPHS2
mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children
Pediatr Nephrol 18 412-416
Mbarek IB Abroug S Omezzine A Pawtowski A Gubler MC Bouslama A
Harbi A Antignac C (2011) Novel mutations in steroid-resistant nephrotic
syndrome diagnosed in Tunisian children Pediatr Nephrol 26 241-249
McTaggart SJ Algar E Chow CW Powell HR Jones CL (2001) Clinical
spectrum of Denys-Drash and Frasier syndrome Pediatr Nephrol 16 335-339
McTaggart SJ (2005) Childhood urinary conditions Aust Fam Physician 34
937-941
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
42
Mir S Yavascan O Berdeli A Sozeri B (2011) TRPC6 gene variants in Turkish
children with steroid-resistant nephrotic syndrome Nephrol Dial Transplant 27
205-209
Moller CC Wei C Altintas MM Li J Greka A Ohse T Pippin JW Rastaldi MP
Wawersik S Schiavi S Henger A Kretzler M Shankland SJ Reiser J (2007)
Induction of TRPC6 channel in acquired forms of proteinuric kidney disease J Am
Soc Nephrol 18 29-36
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Mucha B Ozaltin F Hinkes BG Hasselbacher K Ruf RG Schultheiss M Hangan
D Hoskins BE Everding AS Bogdanovic R Seeman T Hoppe B Hildebrandt F
(2006) Mutations in the Wilms tumor 1 gene cause isolated steroid resistant
nephrotic syndrome and occur in exons 8 and 9 Pediatr Res 59 325-331
Mueller RF (1994) The Denys-Drash syndrome J Med Genet 31 471-477
Niaudet P Gubler MC (2006) WT1 and glomerular diseases Pediatr Nephrol 2
1653-1660
Noakes PG Gautam M Mudd J Sanes JR Merlie JP (1995) Aberrant
differentiation of neuromuscular junctions in mice lacking s-lamininlaminin beta-
2 Nature 374 258-262
Obedova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
Orloff MS Iyengar SK Winkler CA Goddard KA Dart RA Ahuja TS
Mokrzycki M Briggs WA Korbet SM Kimmel PL Simon EE Trachtman H
Vlahov D Michel DM Berns JS Smith MC Schelling JR Sedor JR Kopp JB
(2005) Variants in the Wilms tumor gene are associated with focal segmental
glomerulosclerosis in the African American population Physiol Genomics 21
212-221
Otey CA Carpen O (2004) Alpha-actinin revisited a fresh look at an old player
Cell Motil Cytoskeleton 58 104-111
Ovunc B Ashraf S Vega-Warner V Bockenhauer D Soliman Elshakhs NA
Joseph M Hildebrandt F (2012) Mutation Analysis of NPHS1 in a Worldwide
Cohort of Congenital Nephrotic Syndrome Patients Nephron Clin Pract 120
c139-146
43
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Patek CE Fleming S Miles CG Bellamy CO Ladomery M Spraggon L Mullins
J Hastie ND Hooper ML (2003) Murine Denys-Drash syndrome evidence of
podocyte de-differentiation and systemic mediation of glomerulosclerosis Hum
Mol Genet 12 2379-2394
Patrakka J Ruotsalainen V Ketola I Holmberg C Heikinheimo M Tryggvason
K Jalanko H (2001) Expression of nephrin in pediatric kidney diseases J Am Soc
Nephrol 12 289-296
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Patrakka J Tryggvason K (2009) New insights into the role of podocytes in
proteinuria Nat Rev Nephrol 5 463-468
Patrie KM Drescher AJ Welihinda A Mundel P Margolis B (2002) Interaction
of two actin-binding proteins synaptopodin and alpha-actinin-4 with the tight
junction protein MAGI-1 J Biol Chem 277 30183-30190
Pavenstaumldt H Kriz W Kretzler M (2003) Cell biology of the glomerular
podocyte Physiol Rev 83 253-307
Pereira AC Pereira AB Mota GF Cunha RS Herkenhoff FL Pollak MR Mill
JG Krieger JE (2004) NPHS2 R229Q functional variant is associated with
microalbuminuria in the general population Kidney Int 65 1026-1030
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Pierson M Cordier J Hervouet F Rauber G (1963) Une curieuse association
malformative congenitale et familiale atteignant loeil et le rein J Genet Hum 12
184-213
Pollak MR Alexander MP Henderson JM (2007) A case of familial kidney
disease Clin J Am Soc Nephrol 2 1367-1374
Pritchard-Jones K Fleming S Davidson D Bickmore W Porteous D Gosden C
Bard J Buckler A Pelletier J Housman D (1990) The candidate Wilmsrsquo tumour
gene is involved in genitourinary development Nature 346 194-197
44
Putaala H Soininen R Kilpelaumlinen P Wartiovaara J Tryggvason K (2001) The
murine nephrin gene is specifically expressed in kidney brain and pancreas
inactivation of the gene leads to massive proteinuria and neonatal death Hum Mol
Genet 10 1-8
Reddy JC Licht JD (1996) The WT1 Wilms tumor suppressor gene how much
do we really know Biochim Biophys Acta 1287 1-28
Reiser J Polu KR Moller CC Kenlan P Altintas MMWei C Faul C Herbert S
Villegas I Avila-Casado C McGee M Sugimoto H Brown D Kalluri R Mundel
P Smith PL Clapham DE Pollak MR (2005) TRPC6 is a glomerular slit
diaphragm-associated channel required for normal renal function Nat Genet 37
739-744
Relle M Cash H Brochhausen C Strand D Menke J Galle PR Schwarting A
(2011) New perspectives on the renal slit diaphragm protein podocin Mod Pathol
24 1101-1110
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Rodewald R Karnowsky M (1974) Porous substructure of the glomerular slit
diaphragm in the rat and mouse J Cell Biol 60 423-433
Roselli S Gribouval O Boute N Sich M Benessy F Attieacute T Gubler MC
Antignac C (2002) Podocin localizes in the kidney to the slit diaphragm area Am
J Pathol 160 131-139
Roselli S Heidet L Sich M Henger A Kretzler M Gubler MC Antignac C
(2004) Early glomerular filtration defect and severe renal disease in podocin-
deficient mice Mol Cell Biol 24 550-560
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Ruotsalainen V Ljungberg P Wartiovaara J Lenkkeri U Kestila M Jalanko H
Holmberg C Tryggvason K (1999) Nephrin is specifically located at the slit
diaphragm of glomerular podocytes Proc Natl Acad Sci USA 96 7962-7967
Ryan MC Christiano AM Engvall E Wewer UM Miner JH Sanes JR Burgeson
RE (1996) The functions of laminins lessons from in vivo studies Matrix Biol 15
369-381
45
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Satchell SC Braet F (2009) Glomerular endothelial cell fenestrations an integral
component of the glomerular filtration barrier Am J Physiol Renal Physiol 296
F947- 956
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schultheiss M Ruf RG Mucha BE Wiggins R Fuchshuber A Lichtenberger A
Hildebrandt F (2004) No evidence for genotypephenotype correlation in NPHS1
and NPHS2 mutations Pediatr Nephrol 19 1340-1348
Sellin L Huber TB Gerke P Quack I Pavenstaumldt H Walz G (2003) NEPH1
defines a novel family of podocin interacting proteins FASEB J 17 115-117
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Shih NY Li J Karpitskii V Nguyen A Dustin ML Kanagawa O Miner JH Shaw
AS (1999) Congenital nephrotic syndrome in mice lacking CD2 associated
protein Science 286 312-315
46
Shih NY Li J Cotran R Mundel P Miner JH Shaw AS (2001) CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain Am J
Pathol 159 2303-2308
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tryggvason K Patrakka J wartiovaara J (2006) Hereditary proteinuria
syndromes and mechanisms of proteinuria N Engl J Med 354 1387-1401
Tune BM Mendoza SA (1997) Treatment of the idiopathic nephrotic syndrome
regimens and outcomes in children and adults J Am Soc Nephrol 8 824-832
Tunggal P Smyth N Paulsson M Ott MC (2000) Laminins structure and genetic
regulation Microsc Res Tech 51 214-227
Wartiovaara J Ofverstedt LG Khoshnoodi J Zhang J Makela E Sandin S
Ruotsalainen V Cheng RH Jalanko H Skoglund U Tryggvason K (2004)
Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by
electron tomography J Clin Invest 114 1475-1483
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weinbaum S Tarbell JM Damiano ER (2007) The structure and function of the
endothelial glycocalyx layer Annu Rev Biomed Eng 9 121-167
Weins A Kenlan P Herbert S Le TC Villegas I Kaplan BS Appel GB Pollak
MR (2005) Mutational and Biological Analysis of alpha-actinin-4 in focal
segmental glomerulosclerosis J Am Soc Nephrol 16 3694-3701
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Saunders Elsevier Philadelphia PA
2008 142-145
Weins A Schlondorff JS Nakamura F Denker BM Hartwig JH Stossel TP
Pollak MR (2007) Disease-associated mutant alphaactinin-4 reveals a mechanism
for regulating its F-actin-binding affinity Proc Natl Acad Sci USA 104 16080-
16085
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Wharram BL Goyal M Gillespie PJ Wiggins JE Kershaw DB Holzman LB
Dysko RC Saunders TL Samuelson LC Wiggins RC (2000) Altered podocyte
47
structure in GLEPP1 (Ptpro)-deficient mice associated with hypertension and low
glomerular filtration rate J Clin Invest 106 1281-1290
White CT Macpherson CF Hurley RM Matsell DG (2003) Antiproteinuric
effects of enalapril and losartan a pilot study Pediatr Nephrol18 1038-1043
Winn MP Conlon PJ Lynn KL Farrington MK Creazzo T Hawkins AF
Daskalakis N Kwan SY Ebersviller S Burchette JL Pericak-Vance MA Howell
DN Vance JM Rosenberg PB (2005) A mutation in the TRPC6 cation channel
causes familial focal segmental glomerulosclerosis Science 308 1801-1804
Wing MR Bourdon DM Harden TK (2003) PLC-epsilon a shared effector
protein in Ras- Rho- and G alpha beta gamma-mediated signaling Mol Interv 3
273-280
Yao J Le TC Kos CH Henderson JM Allen PG Denker BM Pollak MR (2004)
Alpha-actinin-4-mediated FSGS an inherited kidney disease caused by an
aggregated and rapidly degraded cytoskeletal protein PLoS Biol 2 167
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Mol Genet 13 2625-2632
Zhu B Chen N Wang ZH Pan XX Ren H Zhang W Wang WM (2009)
Identification and functional analysis of a novel TRPC6 mutation associated with
late onset familial focal segmental glomerulosclerosis in Chinese patients Mut Res
664 84-90
48
2 MATERIALS AND METHODS
49
21 SAMPLES COLLECTION
Blood samples of patients and controls were obtained from the pediatric
nephrology OPD at the Sindh Institute of Urology and Transplantation (SIUT)
with their informed consent or that of their parents The blood samples were
collected in 4 ml ethylenediaminetetraacetic acid (EDTA) treated vacutainers
(Beckton Dickinson) All the studies reported in this thesis were approved by the
Institutional Review Board (IRB) Centre for Biomedical Ethics and Culture
(CBEC) SIUT and conformed to the tenets of the Declaration of Helsinki
22 EXTRACTION OF DNA FROM FRESH BLOOD
Isolation of the genomic deoxyribonucleic acid (DNA) was carried out by
using a modified organic extraction protocol (Sambrook amp Russell 2001) The
blood samples were mixed with thrice the volumes of red cell lysis buffer (RCLB
001 M potassium bicarbonate 015 M ammonium chloride and 05 M EDTA pH-
74) and then kept on ice for 30 minutes The samples were centrifuged in an
AllegraTM
25R (Beckman Coulter USA) centrifuge at 1200 rpm for 10 minutes at
4˚C The pellets were then washed with 10 ml of RCLB and resuspended in 475 ml
saline TrisndashEDTA (STE pH-80) 250 microl of 10 sodium dodecyl sulfate (SDS)
was slowly added drop wise with vortexing followed by 5 microl proteinase K (20
mgml) The tubes were then incubated overnight in a rotary water bath at 55˚C
The next day equal volumes of Tris-equilibrated phenol (pH 80) was
added (Maniatis et al 1982) mixed gently for 10 minutes and kept on ice for 10
minutes After centrifugation at 3200 rpm for 30 minutes at 4oC the aqueous layer
was carefully removed with the help of 1ml micropipette tips The samples were
50
then extracted a second time with equal volumes of chloroform-isoamyl alcohol
(241 vv) The samples were mixed gently for 10 minutes placed on ice for 10
minutes and then centrifuged at 3200 rpm for 30 minutes at 4oC The aqueous layer
was again collected in another tube DNA was precipitated by adding one tenth
volume of 10 M ammonium acetate followed by two volumes of absolute ethanol
(or an equal volume of isopropanol) and stored overnight at -20oC The precipitated
DNA was centrifuged at 3200 rpm for 60 minutes at 4oC The DNA pellet was then
washed with 70 ethanol and centrifuged again at 3200 rpm for 40 minutes The
pellet was air dried or vacuum dried for 10 minutes to remove traces of ethanol
The purified DNA was resuspended in 500 microl of TrisndashEDTA (pH 80) and placed in
a shaking water bath at 55oC
221 QUANTIFICATION OF DNA
The optical density (OD) was measured at 260 and 280 nm using a USVIS
spectrometer (Lambda Ez201 Perkin Elmer)
The concentration of DNA in the sample was calculated using the formula
Absorbance at 260 nm X dilution factor X 50 = ngmicrol DNA
(Where 50 is the correction factor for double stranded DNA)
If the ratio OD260OD280 was found to be 17ndash20 the DNA was considered
pure and free of contaminating phenol or protein The samples were then
transferred to an appropriately labeled Eppendorf tube and stored at 4oC
51
23 POLYMERASE CHAIN REACTION (PCR)
Polymerase chain reaction was first described by the efforts of Saiki et al
(1985) and this method was widely used in this thesis to amplify the fragments of
interest from genomic DNA
The polymerase chain reaction was performed with GoTaqreg Flexi DNA
Polymerase kit from Promegareg (Madison WI USA) Briefly the PCR master mix
containing 1X PCR buffer 15 mM magnesium chloride 01 mM dNTPs
(Promega) 025 units of GoTaqTM
DNA polymerase 04 microM of each primer
(MEG Operon) and 60 ng of the genomic DNA were added in a total PCR reaction
volume of 25 microl A negative (master mix only) and a positive control (master mix +
successfully amplified DNA containing target sequence) were set up for each
experiment
The amplification reactions were carried out in the Veriti 96 well thermal
cycler (Applied Biosystemsreg California
reg USA) using the following PCR program
initial denaturation at 95˚C for 5 minutes followed by 35 cycles of denaturation at
95˚C for 1 minute annealing at 55˚C for 1 minute and extension at 72˚C for 1
minute The final extension was at 72˚C for 10 minutes The PCR products were
kept at 4˚C for electrophoresis
A number of precautions were taken to minimize the possibility of
obtaining non-specific PCR products eg varying the concentration of MgCl2 or
annealing temperature etc as described in this thesis where necessary In some
instances where required a lsquohot-startrsquo PCR method was used that involves the
addition of Taq polymerase after the first denaturation step
52
24 AGAROSE GEL ELECTROPHORESIS
A 1-2 solution of agarose (LE analytical grade Promegareg
) was
prepared in TBE electrophoresis buffer (06 M trizma base 09 M boric acid 0024
M EDTA pH 80) The solution was heated in a loosely stoppered bottle to
dissolve the agarose in a microwave oven After mixing the solution and cooling to
about 55oC ethidium bromide was added to the solution at a concentration of 05
microgml and poured onto the casting platform of a horizontal gel electrophoresis
apparatus An appropriate gel comb was inserted at one end The bottom tip of the
comb was kept 05ndash10 mm above the base of the gel After the gel had hardened
the gel comb was withdrawn Sufficient electrophoresis buffer was added to cover
the gel to a depth of approximately 1 mm Each DNA sample in an appropriate
amount of loading dye (0125 Orange G 20 ficoll and 100 mM EDTA) was
then loaded into a well with a micro-pipettor Appropriate DNA molecular weight
markers (100 bp DNA ladder Promega) were included in each run Electrophoresis
was carried out at 100 volts for 30ndash40 minutes The gel was visualized and
recorded using a gel documentation system (Bio Rad system)
On occasions when a particular DNA fragment was required to be isolated
the appropriate band was cut out using a sterile blade or scalpel DNA was
recovered from the agarose gel band using the QIA quick gel extraction kit
(QIAGEN Germany)
53
25 AUTOMATED FLUORESCENT DNA SEQUENCING
Automated DNA sequencing (di-deoxy terminator cycle sequencing
chemistry) method was carried out using a 3100 genetic analyzer (ABI) and the
BigDye terminator cycle sequencing kit (version 31) DNA was first amplified by
polymerase chain reaction in a 25 microl reaction volume The PCR reaction and
thermal cycler conditions were described earlier in the PCR method
251 PRECIPITATION FOR SEQUENCING REACTION
Amplified PCR products were checked on a 2 agarose gel and then
precipitated with 14 volumes of 75 of isopropanol (analytical grade Scharlau)
Samples were washed with 250 microl of 75 isopropanol and the pellets were
resuspended in autoclaved deionized water as required The PCR products were
also purified with the Wizard SV gel and PCR clean-up system (Promegareg)
according to the manufacturerrsquos instructions
252 SEQUENCING REACTION
The following sequencing reaction conditions were used
Autoclaved deionized water 4microl
10X sequencing buffer 1microl
Big Dye Terminator ready reaction mix
labeled dye terminators buffer and dNTPrsquos
2microl
Forward or reverse sequence specific primer 1microl
Template DNA 2microl
Total reaction volume 10microl
54
PCR was performed using a Gene Amp PCR System 9700 thermal cycler
(Applied Biosystem) for 25 cycles as follows 95oC for 10 seconds 50
oC for 5
seconds and 60oC for 4 minutes
After amplification the products were precipitated with 40 microl of 75
isopropanol washed with 125 microl of 75 isopropanol and air or vacuum dried The
pellets were resuspended in 10 microl of Hi-Di Formamide (ABI) denatured at 95oC
for 5 minutes and then loaded into the 96-well plate for sequencing using the ABI
3100 Genetic Analyzer
26 POLYACRYLAMIDE GEL ELECTROPHORESIS (PAGE)
A 10 polyacrylamide gel solution was prepared by adding 62 ml of 40
acrylamide stock solution (391 acrylamide bisacrylamide) to 25 ml of 10 X TBE
buffer (pH-80) and volume was adjusted to 250 ml with deionized water The
casting base seal of electrophoresis cell (Sequi Gen GT nucleic acid electrophoresis
system Bio Rad) was prepared by pouring the 50 ml from 10 acrylamide added
with 300 microl of 25 ammonium persulphate (APS) and 150 microl of N N N N
tetramethylethylenediamine (TEMED) and allowed the gel to polymerize for 10
minutes
The glass plates and spacers were washed and cleaned with 70 ethanol
and treated with siliconizing fluid (Sigma coat Sigma) Spacers (075 mm) were
placed between the front and rear plates that were then tightly clamped and placed
in a tilted position on the table The gel solution was prepared by adding 200 ml of
10 acrylamide solution with 850 microl of 25 APS solution and 150 microl of TEMED
55
mixed thoroughly and carefully poured into the plates without any bubble
formation The comb was inserted between the plates and the gel was allowed to
polymerize for at least 2 hours at room temperature
After polymerization the gel unit was assembled with upper and lower
reservoirs filled with 2 L of 1 X TBE buffer The gel unit was pre-run for 15
minutes at 100 Watts constant power (Bio Rad HV Power Pac) and the comb was
removed carefully Each sample was prepared by adding 6 microl of gel loading dye
(025 bromophenol blue 025 xylenecyanol and 30 ficoll) to each amplified
product and loaded in the appropriate well The molecular weight marker (100 bp)
was added into the first lane The gel was run at 100 Watts for ~4hours After
complete migration of the samples the gel was removed from the casting plates
with care and cut according to expected product sizes The gel was stained with
ethidium bromide for a few minutes and analyzed using the gel documentation
system (Bio Rad)
27 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)
Restriction fragment length polymorphism (RFLP) PCR is based on the
principle that a base change results in the creation or abolition of a restriction site
PCR primers are designed from sequences flanking the restriction site to produce a
100-500 base pair product The amplified product is subsequently digested with the
appropriate restriction enzyme and fragments are analyzed by PAGE
The master mix for PCR is as follows 1X PCR buffer 25 mM magnesium
chloride 02 mM dNTPs (Promega) 1 U of Taq polymerase 035 microM of each
primer (MEG Operon) and 64 ng of the genomic DNA were prepared in a total
56
reaction volume of 25 microl The amplification reaction was carried out in a Bio Rad
C-1000 thermal cycler using the following PCR cycling parameters initial
denaturation at 92˚C for 2 minutes followed by 35 cycles of denaturation at 92˚C
for 1 minute annealing at 62˚C for 1 minute and extension at 72˚C for 30 seconds
and a final extension at 72˚C for 7 minutes
RFLP analyses of methylenetetrahydrofolate reductase (MTHFR)
polymorphisms ldquoC6777Trdquo and ldquoA1298Crdquo were performed according to Skibola et
al 1999 The fragment digestion of the amplified product was carried out with
HinfI and MboII restriction enzymes 20 microl of the PCR products were digested with
10 U of HinfI enzyme for C6777T and 25 U of MboII enzyme for A1298C
polymorphisms with 20 μl of the recommended buffer at 37degC overnight
After complete digestion the samples were run on an adjustable PAGE
electrophoresis apparatus 10 acrylamide gel was prepared by adding 62 ml of a
40 polyacrylamide stock solution to 25 ml of 10X TBE buffer and the volume
was adjusted to 25 ml with deionized water The solution was mixed thoroughly
and 85 ul of 25 ammonium persulfate (APS) and 27 ul of TEMED were added
The gel plates (165 cmtimes145 cm) were cleaned with 70 ethanol and adjusted
with 1 mm thick spacer and sealing gaskets The gel solution was poured into the
plates and a 1 mm thick comb was inserted between the plates The gel was
allowed to polymerize for 20 minutes
After polymerization the comb and sealing gaskets were removed and the
plates were placed in the electrophoresis apparatus (adjustable height dual gel unit
Sigma-Aldrich) TBE buffer (1X pH-80) was added to the upper and lower
chambers of the apparatus Initially the gels were pre-run at 200 volts for 15
57
minutes The samples for loading were prepared by adding 6 microl loading dye (see
page 54) into the digested products The gel was run at 200 volts for 1hour and 30
minutes depending on the product size The gel was stained with 05 microgml
ethidium bromide solution for 5 minutes and was analyzed on the gel
documentation system
28 STATISTICAL ANALYSIS
Statistical analyses were carried out using Statistical Package for Social
Sciences (SPSSreg) version 17 for Windows
reg Cochran-Armitage trend test was
carried out with χLSTATreg The associations between polymorphism and clinical
outcomes were analyzed by χsup2 test of independence and odds ratios For all the
statistical analyses p-values less than 005 were considered to be significant
Odds Ratio
An odds ratio (OR) is defined as the ratio of the odds of an event occurring
in one group (disease) to the odds of it occurring in another group (controls) The
OR greater than one means significant association and less than one show no
association between groups
Chi-square test
Chi-square is a statistical test commonly used to compare observed data
with data we would expect to obtain according to a specific hypothesis
The formula for calculating chi-square ( χ2) is
χ
2= sum (o-e)
2e
That is chi-square is the sum of the squared difference between observed
(o) and the expected (e) data (or the deviation d) divided by the expected data in
all possible categories
58
29 REFERENCES
Boyam A (1968) Separation of lymphocytes and erythrocytes by centrifugation
Scand J Clin Lab Invest 21 (Supplement 97) 91
Maniatis T Fritsch EF Sambrook J Molecular cloning A laboratory manual
Cold Spring Harbor laboratory Cold Spring Harbor New York 1982
Mullis KB Faloona FA (1987) Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction Methods Enzymol 155 335-350
Sambrook J Russell DW Molecular Cloning A laboratory manual 3rd
Edition
Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 2001
Saiki RK Scharf S Faloona F Mullis KB Horn GT Erlich HA Arnheim N
(1985) Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia Science 230 1350-1354
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
59
3 A SPECTRUM OF NOVEL NPHS1 AND NPHS2 GENE
MUTATIONS IN PEDIATRIC NEPHROTIC SYNDROME
PATIENTS FROM PAKISTAN
60
31 INTRODUCTION
Nephrotic syndrome (NS) in children is characterized by proteinuria
edema hypoalbuminaemia and hyperlipidemia Clinically pediatric NS can be
classified as congenital (CNS) infantile and childhood onset CNS appears in utero
or during the first three months of life Infantile and childhood onset NS are
diagnosed during and after the first year of life respectively The majority of early
onset NS cases have a genetic origin with a widespread age of onset that ranges
from fetal life to several years (Avni et al 2011) Most patients respond to steroid
therapy and show a favorable long term outcome However 10-20 of the patients
show resistance to the therapy and are classified as a steroid resistant nephrotic
syndrome (SRNS) These patients tend to progress to end stage renal disease
(ESRD) due to the progressive damage of the glomerular filtration barrier (GFB
Yu et al 2005)
Glomerular pathology in NS mostly appears as minimal change disease
(MCD) focal segmental glomerulosclerosis (FSGS) or diffuse mesengial sclerosis
(DMS) According to ldquoThe International Study of Kidney Diseases in Childrenrdquo
(1978) the most common histological manifestation of childhood NS is sporadic
MCD affecting 77 of the children followed by FSGS (8) According to the data
available in Pakistan MCD is the leading cause of idiopathic NS in children (43
of cases) followed by FSGS (38 of cases) The FSGS is the predominant
pathology in SRNS and adolescent NS (Mubarak et al 2009)
Mutations in several genes that are highly expressed in the GFB and
podocytes have been reported to cause pediatric NS In a study of a large cohort of
patients with isolated sporadic NS occurring within the first year of life two third
61
of the cases were due to mutations in the NPHS1 NPHS2 WT1 and LAMB2 genes
(Hinkes et al 2007) The NPHS1 and NPHS2 genes together share a large
proportion of mutations that cause NS in children The other two genes WT1 and
LAMB2 have also been associated with syndromic or complex forms (Lowik et al
2009 Zenker et al 2009) The TRPC6 PLCE1 CD2AP ACTN4 genes are also
involved in the etiology of NS (Kaplan et al 2000 Santin et al 2009 Benoit et
al 2010 Boyer et al 2010) Recently mutations in the IFN2 MYOE1 and
PTPRO genes have been reported in NS and in childhood familial FSGS cases
(Brown et al 2010 Mele et al 2011 Ozaltin et al 2011)
Mutations in the NPHS1 gene were initially described as the cause of the
lsquoFinnish typersquo of nephrotic syndrome (CNF) In Finland two mutations Finmajor
(c121delCT pLeu41fs) and Finminor (c3325CgtT pArg1109Ter) were found in
78 and 16 of the cases respectively (Kestila et al 1998) These two mutations
have rarely been observed outside Finland However in studies on European North
American and Turkish NS patients mutations in the NPHS1 gene account for 39-
55 cases of childhood NS and 40 of all cases of CNS (Lenkkeri et al 1999
Kestila et al 2007 Heeringa et al 2008) Other reports have observed NPHS1
gene mutations in NS patients that are more than three months of age (Philippe et
al 2008) It has also been suggested that NS caused by NPHS1 gene mutations
consistently show resistance to steroid therapy (Hinkes et al 2007 Heeringa et al
2008 Jalanko 2009) However recently it has been reported that gt20 of CNS
patients including patients with NPHS1 gene mutations may respond to
antiproteinuric treatment (Schoeb et al 2010)
62
Mutations in the NPHS2 gene cause an autosomal recessive form of SRNS
with an early onset of the disease and renal histology of FSGS (Boute et al 2000)
The NPHS2 gene mutations have also been identified in 51 of CNS cases of
European origin and also in adult onset form of FSGS (Tsukaguchi et al 2002
Hinkes et al 2007) The incidence of NPHS2 gene mutations in familial SRNS
was found to be 40 in European and American children 29 in Turkish and 0
in Japanese and Korean children (Lowik et al 2009)
Idiopathic NS is one of the major glomerular diseases in Pakistani children
and approximately 30 of the NS cases show resistance to steroid therapy
(Mubarak et al 2009) This is in contrast to the other parts of the world where 10-
20 of the NS cases show steroid resistance (Ruf et al 2004 Weber et al 2004)
This study was therefore carried out to find the frequency of disease causing
mutations in the NPHS1 and NPHS2 genes in Pakistani children suffering from
congenital early and childhood onset NS To our knowledge this is the first
comprehensive screening of NPHS1 and NPHS2 gene mutations in pediatric NS
cases from South Asia
32 MATERIALS AND METHODS
321 PATIENTS RECRUITMENT AND DATA COLLECTION
A total of 145 NS patients were recruited from the pediatric nephrology
department of the Sindh Institute of Urology and Transplantation Karachi and
pediatric nephrology department of the Children Hospital Lahore The research
protocol was approved by the Institutional Review Board and conformed to the
63
tenets of the Declaration of Helsinki Written informed consent was obtained from
the parents of all the subjects
Patients with CNS infantile and childhood onset NS including familial and
sporadic cases that are younger than 16 years of age were recruited in this study
All the children were resistant to standard steroid therapy NS patients with
extrarenal abnormalities were excluded from this study
NS was diagnosed by the presence of edema urinary protein excretion
equal to or greater than 40 mgm2hr and serum albumin below 25 gl Renal
failure was designated when estimated glomerular filtration rate (eGFR) was less
than 90 mlmin by the Schwartz formula (Schwartz and Work 2009) All the
patients received standard steroid therapy on initial presentation The clinical
response to steroid therapy was classified as described earlier (Mubarak et al
2009) (1) steroid sensitive ie complete remission of proteinuria during the steroid
therapy persisting for at least 12 weeks after therapy (2) steroid dependent ie
remission of proteinuria during therapy but recurrence when the dosage was
reduced below a critical level or relapse of proteinuria within the first three months
after the end of therapy and (3) resistant ie no remission of proteinuria during 4
consecutive weeks of daily steroid therapy
322 MUTATION ANALYSIS
Blood samples were collected in acid citrate dextrose (ACD) vacutainer
tubes Genomic DNA was extracted using the standard phenol-chloroform
extraction procedure as described earlier Mutation analysis was performed by
direct DNA sequencing of all the 29 exons of the NPHS1 gene and the 8 exons of
64
the NPHS2 gene Genomic sequences of the two genes were obtained from the
Ensembl genome browser (Ensembl ID ENSG00000161270 and
ENSG00000116218 respectively) and exon-specific intronic primers were designed
in the forward and reverse directions and were obtained commercially (Eurofins
MWG Operon Germany) The primer sequence and PCR conditions for screening
NPHS1 and NPHS2 gene are described in the Table- 31 and 32 Each exon was
individually amplified by PCR in a 25 microl reaction volume using 1microg of genomic
DNA under standard PCR conditions as described in Materials and Methods
section Amplified PCR products were purified using the PCR clean-up kit
(Promega Wizardreg Promega Corporation Madison WI USA) The sequencing
reaction was performed using the BigDye terminator cycle sequencing kit V31
(Applied Biosystemsreg California USA) Sequencing products were purified using
the Centri-Sep spin columns (Princeton Separationreg) and were analyzed on an
automated DNA analyzer (ABI 3100) Each mutation was confirmed by repeat
sequencing in both the forward and reverse orientations To differentiate between
mutations and polymorphisms 100 healthy controls were also analyzed using direct
DNA sequencing To assess the damaging effects of missense mutations in silico
the online database PolyPhen-2 (Polymorphism Phenotyping v2
httpgeneticsbwhharvardedupph2indexshtml) was used (Adzhubei et al
2010)
65
Table- 31 Primer pairs and PCR conditions for mutation screening of the
NPHS1 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F AGAGGGGAAGAGGAAAACGA 400 bp 52ordmC X 15mMMg+2
1R CACCACCGTCAGGTTTTCAG 400 bp 52ordmC X 15mMMg+2
2F TGCTGACTGAAGGTGAGTGG 463bp 62ordmC X 3mMMg+2
2R CTCATACTCCGCGTCATCG 463bp 62ordmC X 3mMMg+2
3F CCCAGGATCCCAGGCTTC 401bp 65ordmC X 15mMMg+2
3R GGGTAAGCTTCCAGCACTGA 401bp 65ordmC X 15mMMg+2
4F ACCCATGAGTCTGGGCTTC 394bp 63ordmC X 15mMMg+2
4R CCCAGGGATGACATCTTTTC 394bp 63ordmC X 15mMMg+2
5F GGCCCTTTTCCTCTAGAACG 377bp 54ordmC X 15mMMg+2
5R ATGAGCCACCACCTCTGTTC 377bp 54ordmC X 15mMMg+2
6F CTGGATCCCAGAGGAGATCA 354bp 58ordmC X 15mMMg+2
6R GAACCCCCATGTTTCTCTGA 354bp 58ordmC X 15mMMg+2
7F GGGATCACAGGGATTATGGA 388bp 61ordmC X 1mMMg+2
7R GCCTGGGTGTGCTCTGTG 388bp 61ordmC X 1mMMg+2
8F GGGGTAATCCCTTAGCCACA 424bp 59ordmC X 15mMMg+2
8R CCAGACAGAACAGGACTGGAG 424bp 59ordmC X 15mMMg+2
9F GTGTGCCCCCAAATTATGC 398bp 55ordmC X 15mMMg+2
9R CCATGGTCCTCAAGGAGAAA 398bp 55ordmC X 15mMMg+2
10F ATGTCTCCTGTGTCCCTGCT 382bp 63ordmC X 2mMMg+2
10R GAGCTTCTGGCCCTCTGG 382bp 63ordmC X 2mMMg+2
11F TGTCCAACCTGACATTCCTG 480bp 62ordmC X 1mMMg+2
11R CTGATTCCCTGCCAAACCT 480bp 62ordmC X 1mMMg+2
12F TGGTGCTGATGAGAGTGCTT 527bp 60ordmC X 15mMMg+2
12R GTTGGAGGAGCGAGACTCAG 527bp 60ordmC X 15mMMg+2
13F GAGGGACAGAGCCAGGTG 341bp 60ordmC X 15mMMg+2
13R AGCCTTTGAATGGGGCTCT 341bp 60ordmC X 15mMMg+2
14F GACAAGGAAGGGGAGAGGTG 495bp 63ordmC X 15mMMg+2
14R GCTCAGGAGTTGGAGACTGC 495bp 63ordmC X 15mMMg+2
15amp16F ACAACCTTAAACCCCGTCGT 595bp 63ordmC X 3mMMg+2
15amp16R GTTCCAGGATGGGTGGCTAT 595bp 63ordmC X 3mMMg+2
17F GAGGGTGGAGACAACCTCAC 472bp 62ordmC X 3mMMg+2
17R CATTCATTTTGCCACCAACA 472bp 62ordmC X 3mMMg+2
18F AGATGGATGACAGGAGAATTTTT 470bp 60ordmC X 15mMMg+2
18R CAGCTGCAGCCACCTTAGTT 470bp 60ordmC X 15mMMg+2
19F GATTCACCATGCCAAACTGG 469bp 62ordmC X 1mMMg+2
19R CACTCATTCCTCCACCCATT 469bp 62ordmC X 1mMMg+2
20F GGATGAATGGATAGATAGGCAGA 399bp 55ordmC X 1mMMg+2
20R AGGCAAAAACTCCATCCTCA 399bp 55ordmC X 1mMMg+2
21F GTTTGCCAGAGCAGTGTTCA 390bp 50ordmC X 3mMMg+2
66
21R CCACATAGTGGAACCCTGGA 390bp 50ordmC X 3mMMg+2
22F TGACCCTCCATCAGGATTAAA 499bp 56ordmC X 15mMMg+2
22R TGTGACCTTGGACAATTTGC 499bp 56ordmC X 15mMMg+2
23F TCAGCAATTTCTAGCTCTCTTTGA 323bp 56ordmC X 15mMMg+2
23R GCTTGGCCAGAACTAAGTCG 323bp 56ordmC X 15mMMg+2
24amp25F GTCTTGCTGAGGGTGAGGAG 489bp 65ordmC X 3mMMg+2
24amp25R AACAAAGCCCTTTCCATCCT 489bp 65ordmC X 3mMMg+2
26amp27F CAGGTTGATCATTGCCCTTC 495bp 56ordmC X 15mMMg+2
26amp27R CATGGTCAGGCCTCTTTGT 495bp 56ordmC X 15mMMg+2
28F CATGGGGTTCATCATAAGCA 440bp 60ordmC X 3mMMg+2
28R CCTCTCCTGACACCAAGTCC 440bp 60ordmC X 3mMMg+2
Table- 32 Primer pairs and PCR conditions for mutation screening of the
NPHS2 gene
EXON PRIMER SEQUENCE (5rsquo gt 3rsquo) PCR product
size (bp)
PCR conditions
1F ACCCGACGGTCTTTAGGG 514bp 55ordmC X 15mMg+2
1R AGCATCCAGCAATCTGCTCT 514bp 55ordmC X 15mMg+2
2F CAGGCCCTGTGAACTCTGAC 400bp 63ordmC X 3mMg+2
2R GAAGGTGAGTCTGGGGTGAG 400bp 63ordmC X 3mMg+2
3F TTTTTCCTGGTTCTCAAAACAAA 396bp 61ordmC X 2mMg+2
3R CCAATTCTCTCTCTTGGCTACC 396bp 61ordmC X 2mMg+2
4F GATGGGCCAATGGTCTGTAA 391bp 62ordmC X 3mMg+2
4R TCCCTAGATTGCCTTTGCAC 391bp 62ordmC X 3mMg+2
5F GGGTAGGCCAACTCCATTTT 455bp 55ordmC X 15mMg+2
5R TATGAGCTCCCAAAGGGATG 455bp 55ordmC X 15mMg+2
6F CTCTTTGCAAGGCACTGTGA 372bp 55ordmC X 15mMg+2
6R TGGCTGTAAGATATTAGGTGATTTG 372bp 55ordmC X 15mMg+2
7F AGGAATGGCACACTCTGGTC 343bp 58ordmC X 2mMg+2
7R GTTGTAAGGGCCCAAGACAG 343bp 58ordmC X 2mMg+2
8F CTGTCTCCCCAGCTCAAGAC 596bp 61ordmC X 08mMg+2
8R TGGATGGTGCATTGTGACTT 596bp 61ordmC X 08mMg+2
67
33 RESULTS
331 CLINICAL CHARACTERISTICS OF PATIENTS
In this study a total of 145 patients including 36 early-onset and 109
childhood-onset NS were screened for disease-causing mutations in the NPHS1 and
NPHS2 genes Early-onset cases include children with congenital and infantile
onset of NS Among these 106 patients were sporadic cases whereas 39 patients
belonged to 30 different families The clinical characteristics of the patients are
given in Table- 33 Clinical data were obtained for all the cases (Table- 34) Renal
failure was established in 22 patients One patient had undergone kidney
transplantation with no recurrence over a period of 2 years of follow up Renal
biopsy results were available for 99 cases mostly representing FSGS (48 cases) and
MCD (27 cases)
332 MUTATIONS IN THE NPHS1 GENE
A total of 7 homozygous mutations were identified in 8 patients in the
NPHS1 gene (Figure- 31 Table- 35) Among these 6 mutations were novel while
only one known mutation was found in three patients All these mutations were
identified in either CNS or infantile cases only These mutations were not present
in the 100 normal controls
Three patients (NS145 NS300 and NS310) who had severe proteinuria at
birth or in early infancy were identified to have a homozygous pR1160X mutation
that resulted in the premature termination of the nephrin protein This mutation has
been reported to be associated with both severe and mild CNF cases (Koziell et al
2002) All the children had a normal renal outcome at the ages of 6 months 15
years and 25 years respectively
68
Table- 33 Clinical characteristics of children with idiopathic nephrotic
syndrome
Total number of children n 145
Age of onset since birth ndash 14 years
Males () 88 (607)
Females () 57 (393)
Male to female ratio 151
Classification of NS
Congenital infantile NS () 36 (25)
Childhood NS () 109 (75)
Renal biopsy findings n=99
FSGSa 48
MCDb 27
IgMNc 9
MesPGNd 9
MGNe 3
MCGNf 2
C1q nephropathy 1
Family history
Positive () 39 (27)
Negative () 106 (73)
Outcome
ESRDg CRF
h 14 (96)
Lost to follow-up 9 (62)
Expired 8 (55)
a focal segmental glomerular sclerosis
bminimal change disease
cIgM nephropathy
dmesengial proliferative glomerulonephritis
emembranous glomerulonephritis
fmesengio capillary glomerulonephritis
gend stage renal disease
hchronic renal
failure
69
Table- 34 Clinical characteristics of all 145 patients examined
S
No Patient
ID Family
history Age of
onset Sex Renal
Biopsy Steroid
response Response to therapy Patient outcome
1 NS001 No 14 M bIgMN a
SRNS q- d
ESRD ndash eTx
2 NS003 No 1 F fMCD SRNS No response Lost to follow up
3 NS008 No 5 M - SRNS Complete remission to
CyA -
4 NS015A Yes 10 M MCD SRNS Partial remission to CyA -
5 NS015B Yes 11 M gFSGS SRNS Partial remission to CyA -
6 NS021 Yes 25 F FSGS SRNS - ESRD Expired
7 NS030 Yes 7 M - SRNS - Lost to follow up
8 NS032 Yes 10 F FSGS SRNS Partial remission to CyA -
9 NS033 Yes 8 F FSGS SRNS - ESRD Expired
10 NS034 No 04 F iMesPGN SRNS Partial remission to CyA -
11 NS037 No 12 F jMGN SRNS Maintained on
kACEI +
lARB
-
12 NS039A Yes 5 M MCD SRNS Maintained on ACEI
+ARB -
13 NS039B Yes 85 F - SRNS Maintained on ACEI
+ARB -
70
14 NS044 No 8 M FSGS SRNS No remission -
15 NS049A Yes 09 M MCD SRNS Partial remission to CyA -
16 NS049B Yes 25 F - SRNS No response -
17 NS050 No 12 M FSGS SRNS Partial remission to CyA -
18 NS052 No 07 M MCD SRNS Complete remission to
CyA
19 NS060 No 11 F MCD SRNS - Lost to follow up
20 NS061 No 11 F MCD SRNS - Expired
21 NS064 Yes 4 F - - In remission -
22 NS065 Yes 1 F IgMN - Partial remission to CyA mCRF
23 NS084 No 5 M C1q
Nephropathy SRNS Partial remission to CyA -
24 NS088 No 8 F FSGS SRNS Complete remission to
CyA -
25 NS098 No 25 M FSGS SRNS Partial remission to CyA -
26 NS104 No 105 M MesPGN SRNS Partial remission to CyA CRF
27 NS110 No 9 F FSGS SRNS - Expired
28 NS113 No 07 F - SRNS No remission -
29 NS118 No 22 M FSGS SRNS Complete remission to
CyA -
30 NS122 Yes 13 F FSGS SRNS Maintained on ACEI
+ARB -
31 NS123 No 09 M FSGS SRNS No remission -
71
32 NS124 No 125 M IgMN SRNS Complete remission to
CyA -
33 NS125 No 3 F FSGS SRNS Partial remission to CyA ESRD
34 NS128 No 7 F MCD SRNS Partial remission to CyA -
35 NS129 No 1 M MCD SRNS Partial remission to CyA ESRD
36 NS130 No 5 M FSGS SRNS Maintained on ACEI
+ARB -
37 NS131 No 12 M IgMN SRNS Complete remission to
nCyP
-
38 NS134 No 6 F FSGS SRNS Complete remission to
CyA -
39 NS135 No 7 F - - No remission -
40 NS136 No 85 M - - No remission -
41 NS137 No 5 F - - No remission -
42 NS138 Yes 8 M FSGS SRNS Partial remission to CyA -
43 NS139 No 4 F MCD oSDNS On ACEI +ARB -
44 NS140 No 35 M - SDNS - -
45 NS141 No 7 M - SNS Partial remission to ACEI -
46 NS144 No 1 F - SRNS No remission -
47 NS145 No 01 F FSGS SRNS Maintained on ACEI
+ARB -
48 NS146A Yes 11 M FSGS SRNS Partial remission to CyA -
49 NS146C Yes 10 M FSGS SRNS Complete remission to
CyA -
72
50 NS146D Yes 115 F FSGS SRNS - -
51 NS147 No 35 M MCD SRNS No response to CyA Tac CRF
52 NS148 No 4 M - - No response -
53 NS152 No 1 M - SRNS - Lost to follow up
54 NS153 No 5 F - - No response -
55 NS154 No 11 F IgMN SRNS Complete remission to
CyA -
56 NS155 No 3 M - SRNS In remission -
57 NS156 No 4 F - - No response -
58 NS159 No 1 M IgMN SRNS Complete remission to
CyA -
59 NS161 Yes 3 M FSGS SRNS Partial remission to CyA -
60 NS162 No 9 M pMCGN SRNS Maintained on ACEI +
ARB CRF
61 NS165 No 7 M MCD SRNS Maintained on ACEI
+ARB -
62 NS167 Yes 9 M - - - -
63 NS169 Yes 3 M FSGS SRNS Complete remission to
CyA -
64 NS173 No 5 M FSGS SRNS Partial remission to CyA -
65 NS175 No 11 M FSGS SRNS Partial remission to CyA ESRD
66 NS176 No 55 M IgMN SRNS Partial remission to CyA -
67 NS180 No 4 F - SRNS - Lost to follow up
73
68 NS181A Yes 7 M - SSNS Being treated for first
relapse -
69 NS181B Yes 9 M - SSNS - -
70 NS183 No 9 F FSGS SRNS Complete remission to
CyA -
71 NS184 No 8 F - - No response -
72 NS187 No 4 F MCD SRNS Complete remission to
CyA -
73 NS188 No 5 F FSGS SRNS Complete remission to
Tac -
74 NS192 No 13 F MCD SRNS Partial remission to CyA -
75 NS193 Yes 65 F FSGS SRNS Complete remission to
CyP -
76 NS194 Yes 7 M FSGS SRNS Complete remission to
CyP -
77 NS196 No 3 F FSGS SRNS - ESRD
78 NS197 No 4 F MCD SRNS Partial remission CyA -
79 NS200 No 4 M FSGS SRNS Partial remission CyA -
80 NS201 No 6 F MCD SRNS Partial remission CyA -
81 NS202A Yes 3 M FSGS SRNS Partial remission CyA -
82 NS202C Yes 5 F FSGS SRNS Partial remission CyA -
83 NS203 No 11 M - - - -
84 NS205 No 4 M - - No response -
85 NS206 No 95 F FSGS SRNS Partial remission to Tac -
74
86 NS207 No 3 M MesPGN SRNS - -
87 NS209 No 25 M MesPGN SRNS Maintained on ACEI
+ARB -
88 NS211 No 2 M MCD SRNS Partial response to Tac -
89 NS213 Yes 5 M FSGS - No response -
90 NS214 Yes 6 M FSGS - - -
91 NS215 No 35 M MCD SRNS Complete remission to
CyP -
92 NS216 No 18 M - SRNS - Lost to follow up
93 NS217 No 6 M - - - Expired
94 NS218 No 25 F FSGS SRNS Partial remission to CyA -
95 NS220 No 5 M FSGS SRNS - ESRD
96 NS221 Yes 1 M - - - -
97 NS222 No 3 F FSGS SRNS Partial remission to Taq -
98 NS223 No 85 M MCD SRNS - -
99 NS228 No 1 M MesPGN SRNS No response to CyA -
100 NS230 No 9 M MGN SRNS Maintained on ACEI
+ARB -
101 NS231 No 4 M MesPGN SRNS Complete remission to
CyP -
102 NS232 No 4 M MCD SRNS Complete remission to
CyA -
103 NS233 No 6 F FSGS SRNS Partial remission to CyA -
75
104 NS234 No 03 F - SRNS Maintained on ACEI
+ARB -
105 NS235 No 115 M pMCGN SRNS Maintained on ACEI
+ARB -
106 NS236 No 14 M FSGS SRNS Partial response to CyA -
107 NS239 Yes 11 F - SRNS - ESRD
108 NS240 No 09 F FSGS SRNS Complete remission to
CyP -
109 NS245 No 18 F FSGS SRNS -
110 NS248 No 2 F MGN SRNS Maintained on ACEI
+ARB -
111 NS249 No 9 M MCD SRNS Partial response to Tac -
112 NS250 No 4 M FSGS SRNS Complete remission to
Tac -
113 NS251 No 5 M MesPGN SRNS Complete remission -
114 NS252 No 5 M FSGS SRNS Partial remission to CyA -
115 NS254 No 02 F FSGS SRNS - Expired
116 NS255 No 95 M FSGS SRNS - Lost to follow up
117 NS256 No 04 F MCD SRNS Complete remission to
CyP -
118 NS257 Yes 3 F - SNS - Lost to follow up
119 NS267 Yes 01 M - SRNS No remission -
120 NS268 No 24 M MesPGN SRNS Partal response to CyA ESRD
121 NS269 No 8 F SRNS - Expired
76
122 NS270 No 04 M SRNS - ESRD
123 NS275 No 3 F - SRNS - ESRD
124 NS276 No 5 M MCD SRNS In complete remission to
CyA -
125 NS278 No 1 M - CNS Maintained on ACEI
+ARB -
126 NS279 Yes 25 M MCD SDNS Partial response to CyP -
127 NS281 No 10 M SRNS - -
128 NS286 No 1 M - SRNS - Lost to follow up
129 NS288 No 1 M IgMN SRNS Partial response to CyA
Tac -
130 NS289 No 3 M MCD SRNS Complete remission to
CyA -
131 NS290 No 15 F MCD SRNS Complete remission to
CyA -
132 NS291 No 1 M FSGS SRNS Partial response to CyA -
133 NS292 No 45 M MCD SRNS Response to CyA -
134 NS293 No 1 F IgMN SRNS Complete remission to
CyA -
135 NS295 Yes 03 F - CNS Maintained on ACEI
+ARB -
136 NS300 No 09 M - SRNS Maintained on ACEI
+ARB
137 NS301 Yes 01 M - CNS Maintained on ACEI
+ARB -
138 NS302 Yes 12 M - - - Expired
77
139 NS303 Yes 3 M - SRNS - -
140 NS304 No 03 M MesPGN SRNS - -
141 NS305 No 02 M - Maintained on ACEI
+ARB -
142 NS306 No 25 M SRNS - -
143 NS308 Yes 2 M FSGS SRNS No response -
144 NS309 Yes 02 M - CNS Maintained on ACEI
+ARB -
145 NS310 No 01 F - CNS Maintained on ACEI
+ARB -
aSteroid resistant nephrotic syndrome
bIgM nephropathy
ccyclosporine
dend stage renal disease
etransplantation
fminimal change
disease gfocal segmental glomerular sclerosis
htacrolimus
imesengial proliferative glomerulonephritis
jmembranous
glomerulonephritis kangiotensin converting enzyme inhibitor
langiotensin receptor blocker
mchronic renal failure
ncyclophosphamide
oSteroid dependant nephrotic syndrome
pmesengio capillary glomerulonephritis
q (-)
78
A novel pG1020V mutation was present in patient NS228 who had
infantile NS This change was predicted to be damaging since it had a PolyPhen-2
score of 10 The biopsy report showed that this patient had a unique presentation
of mesengial proliferative glomerular nephropathy (MesPGN) Another novel
homozygous pT1182A mutation was identified in patient NS254 who had biopsy
proven FSGS with a typical clinical presentation This child died at the age of 15
years because of ESRD Another child (NS309) who had congenital NS at the age
of two months had a novel homozygous pG867P mutation which is probably
damaging according to the Polyphen-2 analysis His parents were first cousins and
were segregating the mutation in a heterozygous state One infantile NS case was
found to have compound heterozygous mutations (pL237P and pA912T) and had
inherited one mutation from each parent A novel homozygous 2 bp duplication
(c267dupCA) was found in a child who had severe NS since birth His elder sister
died of NS at the age of two months His parents were first cousin and analysis
revealed that both were carriers of the mutation
Besides these homozygous mutations identified in the NPHS1 gene 12
patients carried heterozygous mutations (Table- 36) Among these the pR408Q
mutation was identified in 3 patients This mutation has previously been reported in
a compound heterozygous condition in patients with CNS (Lenkkeri et al 1999)
while in the present study patients carrying the heterozygous pR408Q mutation
had a late onset of the disease with NS symptoms appearing at the ages of 4-10
years Along with the pR408Q mutation in the NPHS1 gene one patient (NS130)
also had a heterozygous missense mutation (pP341S) in the NPHS2 gene (Tablendash
36 and 37) Kidney biopsy results of the two patients that only had the pR408Q
79
mutation showed MCD while patient NS130 who had both gene mutations showed
FSGS
A GgtA substitution (pE117K rs3814995) was found in a homozygous
condition in six patients and in a heterozygous condition in 21 patients However
this was considered to be a common variant since it was found in both homozygous
and heterozygous states in normal individuals (Lenkkeri et al 1999)
80
Figure- 31 Illustration of identified mutations in the NPHS1 gene and their respective locations in the gene and protein
domains
81
Table- 35 List of homozygouscompound heterozygous mutations identified in the NPHS1 gene
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow up
Polyphen 2
scores
NS145
NS300
NS310
F
M
F
no
no
no
CNS
Infantile
CNS
FSGS
c3478C-T
c3478C-T
c3478C-T
pR1160X
pR1160X
pR1160X
Maintained on bACEI
Normal
Normal
Normal
25yrs
15yrs
6mo
NS228
M no Infantile cMesPGN c3059G-T pG1020V Partial remission
to dCyA
Normal 15yrs 100
NS254
F no CNS FSGS c3426A-G pT1182A Expired 15yrs 000
NS291
M no Infantile c710T-C
c2734G-A
pL237P
pA912T
Normal 1yr 100
035
NS301
NS309
M
yes
no
CNS
CNS
c2673dupCA
c2600G-A
pG867P
Normal
Normal
6mo
9mo
099
afocal segmental glomerular sclerosis
b angiotensin converting enzyme inhibitor
c mesengial proliferative glomerular nephropathy
dcyclosporine
82
Table- 36 List of heterozygous mutationsvariants identified in the NPHS1 gene
aMinimal change disease
b cyclosporine
cfocal segmental glomerular sclerosis
dangiotensin converting enzyme inhibitor
eangiotensin receptor blocker
fmesengial proliferative glomerular nephropathy
gend stage renal disease
Mutation in the NPHS2 gene also
Patient
Sex Family
history
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to Therapy Renal
Outcome
Polyphen
2 scores
NS015
M
yes
11
aMCD
c563A-T
pN188I
Partial remission to bCyA
Normal
015
NS039
NS130
NS187
M
M
F
yes
no
no
5-10
5
4
MCD cFSGS
MCD
c1223G-A
c1223G-A
c1223G-A
pR408Q
pR408Q
pR408Q
Maintained on dACEI+
eARB
Maintained on ACEI+ ARB
Complete remission to CyA
Normal
Normal
Normal
098
NS141
M No 7
_ c766C-T pR256W
Partial remission to ACEI Normal 100
NS161
NS104
M
M
yes
no
4
11
FSGS fMesPGN
c1822G-A
c1822G-A
pV608I
pV608I
Partial remission to CyA
Partial remission to CyA
Normal gESRD
030
NS165
NS223
M
M
no
no
7
9
MCD
MCD
c565G-A
c565G-A
pE189K
pE189K
Maintained on ACEI+ ARB
Normal
Normal
011
NS206
F No 11 FSGS c881C-T pT294I Partial remission to
Tacrolimus
Normal 000
NS049 M yes Infantile MCD c791C-G pP264R
Partial remission to CyA Normal 002
NS267 M yes CNS _ c3047G-A pS1016N 7mo
follow up
019
83
333 MUTATIONS IN THE NPHS2 GENE
The NPHS2 gene was sequenced in 145 NS patients and 4 mutations were
identified (Figure- 32 Table- 37) The pP341S mutation was identified in patient
NS130 in a heterozygous state who also carried the pR408Q mutation in the
NPHS1 gene in a heterozygous condition (Table- 36 and 37) This patient was
diagnosed with FSGS at the age of 5 years As observed by others patients
carrying mutations in the NPHS2 gene initially showed complete remission of
proteinuria but developed secondary resistance to steroid therapy (Caridi et al
2001) Two previously known homozygous pK126N and pV260E mutations were
identified in two infantile NS cases while no NPHS2 gene mutation was found in
the CNS cases in our Pakistani cohort Similarly no mutation was identified in any
of the familial SRNS cases
A homozygous pR229Q mutation was found in two patients aged 25 and 3
years This change causes a decrease in the binding of the podocin protein to the
nephrin protein and in association with a second NPHS2 mutation enhances
susceptibility to develop FSGS (Tsukaguchi et al 2002) One of these children
(NS125) developed end stage renal disease at the age of 14 years
84
Figure- 32 Illustration of the identified mutations in the NPHS2 gene and their locations
85
Table- 37 List of Mutations identified in the NPHS2 gene
Patient
Sex Family
History
Age at
Onset
(yrs)
Biopsy Nucleotide
Change
Amino
Acid
Change
Response to
Therapy
Renal
Outcome
Time to
follow
up
Polyphen 2
scores
NS125
NS211
F
M
no
no
3
25
aFSGS
cMCD
c755G-A
c755G-A
pR229Q
pR229Q
Partial remission to
Tacrolimus
bESRD
Normal
11yrs
15yr
0673
NS130
M no 5 FSGS c1090C-T pP341S Maintained on dACEI and
eARB
Normal 10yrs 0998
NS278
M no Infantile
c378G-C pK126N Maintained on dACEI and
eARB
Normal 3yrs 100
NS288
M no Infantile
c779T-A pV260E Partial remission to
Tacrolimus
Normal 3yrs 0998
a
Focal segmental glomerular sclerosis b end stage renal disease
cminimal change disease
dangiotensin converting
enzyme inhibitor eangiotensin receptor blocker
Mutation in the NPHS1 gene also
86
34 DISCUSSION
This study describes the identification of 6 novel mutations out of 7 in the
NPHS1 and 4 mutations in the NPHS2 gene The primary findings of this study
show that as opposed to Europe mutations in the NPHS1 and NPHS2 genes are not
the frequent causes of paediatric NS in Pakistan Another important finding is the
absence of disease-causing mutation in the NPHS2 gene in the familial SRNS and
CNS cases By contrast homozygous mutations in the NPHS2 gene have been
reported to account for 42 of the autosomal recessive SRNS families and 39-51
of CNS cases of European origin (Weber et al 2004 Hinkes et al 2007)
Reports of the European populations have shown that in children up to three
months of age mutations in the NPHS1 gene account for 39ndash82 of the NS cases
and that most of the mutations are homozygous (Caridi et al 2001 Koziell et al
2002 Philippe et al 2008 Schoeb et al 2010) Consequently these mutations
have been associated with the earliest and most severe type with the onset of NS in
utero or within the first three months of life (Hinkes et al 2007) However we
have observed that in our cohort the mutations are in children who have NS since
birth but up to a longer period of one year of life
Although the exact role of heterozygous NPHS1 mutations in disease
progression is not established in the current screening it was found that
homozygous NPHS1 mutations caused a severe and early disease type while
heterozygous mutations caused milder NS that manifested relatively later in life
(Table- 35 and 36) In patients with the heterozygous NPHS1 gene mutations we
also examined the possible disease-causing involvement of some other genes
87
However no mutation was found in the NPHS2 WT1 and LAMB2 genes that are
known to cause early onset NS
Several previous studies have shown that children with the NPHS1 gene
mutations progressed to ESRD very rapidly within one to three years of age
(Hinkes et al 2007 Machuca et al 2010) However in our study children with
the NPHS1 gene mutations retained some renal function up to 25 years of age
(Table- 35 and 36)
Koziell et al (2002) have reported digenic inheritance of NPHS1 and
NPHS2 gene mutations In one of our patients a heterozygous pR408Q mutation
was observed in the NPHS1 gene and a second heterozygous pP321S mutation in
the NPHS2 gene (Table- 36 and 37) The child was diagnosed with FSGS at the
age of 5 years In silico analysis with the PolyPhen 2 program suggested that both
the mutations are damaging
Weber et al (2004) have shown that 42 of the familial SRNS cases and
10 of the sporadic cases are due to the mutations in the NPHS2 gene (Weber et
al 2004) By contrast in our cohort no mutation was found in the familial SRNS
cases and only 34 of all the NS cases have mutations in the NPHS2 gene
An NPHS2 gene variant pR229Q has been found to occur with at least one
pathogenic mutation and it was therefore suggested that it has no functional effects
(Machuca et al 2010 Santin et al 2011) However in vitro studies of Tsukaguchi
et al (2002) have shown that this variant decreases the binding of the podocin-
nephrin complex and hence its function In our study two children aged 25 and 3
years carried this variant in the homozygous state with no other mutation in both
these genes Our observation supports that of Tsukaguchi that this variant may be
88
the cause of NS in these children In the world population the pR229Q allele is
more frequent in the Europeans and South American (4-7) than in the African
African American and Asian populations (0-15 Santin et al 2011) In our
population only one out of 100 control samples was found to have this variant
allele in a heterozygous state (001 allele frequency)
Mutations in the NPHS1 gene account for ~20 and NPHS2 gene account
for 55 of the patients with early onset NS in our cohort This observation is in
marked contrast to the studies from Europe and US where the prevalence of the
NPHS1 gene mutations ranges from 39-55 and the NPHS2 gene mutations ranges
from 10-28 (Koziell et al 2002 Lahdenkari et al 2004 Philippe et al 2008
Schoeb et al 2010) Studies from Japan and China also report a low prevalence of
the two genes in their NS patients (Sako et al 2005 Mao et al 2007) Although
the NPHS1 and NPHS2 genes together make a significant contribution to the
spectrum of disease causing mutations there are a number of other genes including
WT1 LAMB2 PLCE1 TRPC6 CD2AP ACTN and INF2 that are known to cause
NS in children (Hinkes et al 2007) In view of this observation all the early onset
NS patients with no NPHS1 and NPHS2 gene mutations are being screened for the
WT1 LAMB2 and PLCE1 gene mutations
Population genetic analysis has shown in a study of heart failure the South
Asian populations are strikingly different compared to the Europeans in disease
susceptibility (Dahandapany et al 2009) Our results therefore reaffirm that the
genetic factors causing NS are different in Asian and European populations and
that other genes that may contribute to the etiology of the NS need to be identified
89
Thus low prevalence of disease-causing mutations in our population may reflect the
geographic and ethnic genetic diversity of NS in the world populations
90
35 REFERENCES
Adzhubei IA Schmidt S Peshkin L Ramensky VE Gerasimova A Bork P
Kondrashov AS Sunyaev SR (2010) A method and server for predicting missense
mutations Nat Methods 7 248-249
Avni EF Vandenhoute K Devriendt A Ismaili K Hackx M Janssen F Hall M
(2011) Update on congenital nephrotic syndromes and the contribution of US
Pediatr Radiol 41 76-81
Benoit G Machuca E Heidet L Antignac C (2010) Analysis of recessive CD2AP
and ACTN4 mutations in steroid-resistant nephrotic syndrome Pediatr Nephrol 25
445-451
Boute N Gribouval O Roselli S Benessy F Lee H Fuchshuber A Dahan K
Gubler MC Niaudet P Antignac C (2000) NPHS2 encoding the glomerular
protein podocin is mutated in autosomal recessive steroid-resistant nephrotic
syndrome Nat Genet 24 349-354
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nat Genet 42 72-76
Caridi G Bertelli R Carrea A Di Duca M Catarsi P Artero M Carraro M
Zennaro C Candiano G Musante L Seri M Ginevri F Perfumo F Ghiggeri GM
(2001) Prevalence genetics and clinical features of patients carrying podocin
mutations in steroid resistant nonfamilial focal segmental glomerulosclerosis J Am
Soc Nephrol 12 2742-2746
Dhandapany PS Sadayappan S Xue Y Powell GT Rani DS Nallari P Rai TS
Khullar M Soares P Bahl A Tharkan JM Vaideeswar P Rathinavel A
Narasimhan C Ayapati DR Ayub Q Mehdi SQ Oppenheimer S Richards MB
Price AL Patterson N Reich D Singh L Tyler-Smith C Thangaraj K (2009) A
common MYBPC3 (cardiac myosin binding protein C) variant associated with
Cardiomyopathies in South Asia Nat Genet 41 187-191
Heeringa SF Vlangos CN Chernin G Hinkes B Gbadegesin R Liu J Hoskins
BE Ozaltin F Hildebrandt F Members of the APN Study Group (2008) Thirteen
novel NPHS1 mutations in a large cohort of children with congenital nephrotic
syndrome Nephrol Dial Transplant 23 3527-3533
91
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007) Nephrotic
syndrome in the first year of life Two thirds of cases are caused by mutations in 4
genes (NPHS1 NPHS2 WT1 and LAMB2) Paediatrics 119 e907-e919
International Study of Kidney Diseases in Children (1978) Nephrotic
syndrome in children prediction of histopathology from clinical and laboratory
characteristics at time of diagnosis Kidney Int 13 159-165
Jalanko H (2009) Congenital nephrotic syndrome Pediatr Nephrol 24 2121-
2128
Kaplan JM Kim SH North KN Rennke H Correia LA Tong HQ Mathis BJ
Rodriacuteguez-Peacuterez JC Allen PG Beggs AH Pollak MR (2000) Mutations in
ACTN4 encoding alpha-actinin 4 cause familial focal segmental
glomerulosclerosis Nat Genet 24 251-256
Kestila M Lenkkeri U Mannikko M Lamerdin J McCready P Putaala H
Ruotsalainen V Morita T Nissinen M Herva R Kashtan CE Peltonen L
Holmberg C Olsen A Tryggvason K (1998) Positionally cloned gene for a novel
glomerular protein-nephrin-is mutated in congenital nephrotic syndrome Mol Cell
1 575-582
Koziell A Grech V Hussain S Lee G Lenkkeri U Tryggvason K Scambler P
(2002) Genotypephenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular filtration
Hum Mol Genet 11 379-388
Lahdenkari AT Kestilauml M Holmberg C Koskimies O Jalanko H (2004)
Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome
(MCNS) Kidney Int 65 1856-1863
Lenkkeri U Ma nnikko M McCready P Lamerdin J Gribouval O Niaudet P
Antignac C Kashtan CE Holmberg C Tryggvason K (1999) Structure of the
gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and
characterization of mutations Am J Hum Genet 64 51-61
Lowik MM Groenen PJ Pronk I Lilien MR Goldschmeding R Dijkman HB
Levtchenko EN Monnens LA van den Heuvel LP (2007) Focal segmental
glomerulosclerosis in a patient homozygous for a CD2AP mutation Kidney Int 72
1198-1203
Machuca E Benoit G Nevo F Tecircte MJ Gribouval O Pawtowski A Brandstroumlm
P Loirat C Niaudet P Gubler MC Antignac C (2010) Genotype-phenotype
correlations in non-Finnish congenital nephrotic syndrome J Am Soc Nephrol 21
1209-1217
92
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mele C Iatropoulos P Donadelli R Calabria A Maranta R Cassis P Buelli S
Tomasoni S Piras R Krendel M Bettoni S Morigi M Delledonne M Pecoraro C
Abbate I Capobianchi MR Hildebrandt F Otto E Schaefer F Macciardi F
Ozaltin F Emre S Ibsirlioglu T Benigni A Remuzzi G Noris M PodoNet
Consortium (2011) MYO1E mutations and childhood familial focal segmental
glomerulosclerosis N Engl J Med 365 295-306
Mubarak M Ali L Javed IK Fazal A Atika S Amir F Sajid Bhatti (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Ozaltin F Ibsirlioglu T Taskiran EZ Baydar DE Kaymaz F Buyukcelik M Kilic
BD Balat A Iatropoulos P Asan E Akarsu NA Schaefer F Yilmaz E
Bakkaloglu A the PodoNet Consortium (2011) Disruption of PTPRO causes
childhood-onset nephrotic syndrome Am J Hum Genet 89 139-147
Philippe A Nevo F Esquivel EL Reklaityte D Gribouval O Tecircte MJ Loirat C
Dantal J Fischbach M Pouteil-Noble C Decramer S Hoehne M Benzing T
Charbit M Niaudet P Antignac C (2008) Nephrin mutations can cause childhood-
onset steroid-resistant nephrotic syndrome J Am Soc Nephrol 19 1871-1878
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santın S Ars E Rossetti S Salido E Silva I Garciacutea-Maset R Gimeacutenez I Ruiacutez P
Mendizaacutebal S Luciano Nieto J Pentildea A Camacho JA Fraga G Cobo MA Bernis
C Ortiz A de Pablos AL Saacutenchez-Moreno A Pintos G Mirapeix E Fernaacutendez-
Llama P Ballariacuten J Torra R FSGS Study Group Zamora I Loacutepez-Hellin J
Madrid A Ventura C Vilalta R Espinosa L Garciacutea C Melgosa M Navarro M
Gimeacutenez A Cots JV Alexandra S Caramelo C Egido J San Joseacute MD de la Cerda
F Sala P Raspall F Vila A Daza AM Vaacutezquez M Ecija JL Espinosa M Justa
ML Poveda R Aparicio C Rosell J Muley R Montenegro J Gonzaacutelez D Hidalgo
E de Frutos DB Trillo E Gracia S de los Riacuteos FJ (2009) TRPC6 mutational
analysis in a large cohort of patients with focal segmental glomerulosclerosis
Nephrol Dial Transplant 24 3089-3096
93
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
Schoeb DS Chernin G Heeringa SF Matejas V Held S Vega-Warner V
Bockenhauer D Vlangos CN Moorani KN Neuhaus TJ Kari JA MacDonald J
Saisawat P Ashraf S Ovunc B Zenker M Hildebrandt F Gesselschaft fuumlr
Paediatrische Nephrologie (GPN) Study Group (2010) Nineteen novel NPHS1
mutations in a worldwide cohort of patients with congenital nephrotic syndrome
(CNS) Nephrol Dial Transplant 25 2970-2976
Schwartz GJ Work DF (2009) Measurement and estimation of GFR in children
and adolescents Clin J Am Soc Nephrol 4 1832-1843
Tsukaguchi H Sudhakar A Le TC Nguyen T Yao J Schwimmer JA Schachter
AD Poch E Abreu PF Appel GB Pereira AB Kalluri R Pollak MR (2002)
NPHS2 mutations in late-onset focal segmental glomerulosclerosis R229Q is a
common disease-associated allele J Clin Invest 110 1659-1666
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Yu Z Ding J Huang J Yao Y Xiao H Zhang J Liu J Yang J (2005) Mutations
in NPHS2 in sporadic steroid resistant nephrotic syndrome in Chinese children
Nephrol Dial Transplant 20 902-908
Zenker M Aigner T Wendler O Tralau T Muntefering H Fenski R Pitz S
Schumacher V Royer-Pokora B Wuhl E Cochat P Bouvier R Kraus C Mark K
Madlon H Doumltsch J Rascher W Maruniak-Chudek I Lennert T Neumann LM
Reis A (2004) Human laminin beta-2 deficiency causes congenital nephrosis with
mesangial sclerosis and distinct eye abnormalities Hum Molec Genet 13 2625-
2632
94
4 ASSOCIATION OF THE ACE ndash II GENOTYPE WITH
THE RISK OF NEPHROTIC SYNDROME IN
PAKISTANI CHILDREN
95
41 INTRODUCTION
Nephrotic Syndrome (NS) is the most common glomerular disease in
children (Braden et al 2000) The estimated incidence of pediatric NS in the USA
is 20 to 27 per 100000 populations with a cumulative frequency of 16 per 100000
(Eddy and Symons 2003) It is characterized by heavy proteinuria
hypoalbuminemia hypercholesterolemia and edema The primary variants of NS
are focal segmental glomerulosclerosis (FSGS) minimal change disease (MCD)
and membranous glomerulopathy (MGN Obeidova et al 2006) The majority of
patients with sporadic NS respond well to steroid therapy However approximately
10-20 fail to do so and hence are at a higher risk of developing end stage renal
disease (ESRD Ruf et al 2004) Geographic as well as ethnic differences have
been reported to contribute towards the incidence of NS with a 6-fold higher
incidence in the Asians compared to the European populations (Sharlpes et al
1985)
The gene for angiotensin-converting enzyme (ACE) is located on
chromosome 17q23 It is an important enzyme in the renin-angiotensin-aldosterone
system (RAAS) It is responsible for converting an inactive angiotensin I (Ang-I)
into a vasoactive and aldosterone-stimulating peptide angiotensin II (Ang-II Oktem
et al 2004) The insertion or deletion of a 287 bp Alu repeat sequence in intron 16
of the ACE gene is defined by the ID polymorphism The deletion allele (D) has
been associated with the higher concentration of plasma ACE and AngndashII levels
(Rigat et al 1990) The increased concentration of Ang-II stimulates the expression
of several different growth factors and nuclear transcription factors that cause
96
deleterious effects on renal hemodynamics and may result in the manifestation of
NS (Serdaroglu et al 2005)
This study was carried out to determine the association of the ACE ID
polymorphism with the risk of NS in Pakistani children and to further evaluate the
relation between this polymorphism and the risk of developing steroid resistant and
histological findings for FSGS and MCD in these patients
42 SUBJECTS AND METHODS
421 SAMPLES COLLECTION
Blood samples were collected from 268 NS patients from the pediatric
nephrology department SIUT with their informed consent or that of their parents
A panel of 223 control samples was also included in the study The controls
consisted of unrelated healthy individuals with no history of kidney disease or
hypertension The criteria for the inclusion of patients in the study were the clinical
presentation of NS and an age less than 16 years The diagnosis of NS was based
upon the presence of edema urinary protein excretion ge 40mgm2hr and serum
albumin below 25gml All the patients received standard steroid therapy and were
classified into two categories on the basis of their responses towards steroids the
steroid sensitive nephrotic syndrome (SSNS) and steroid resistant nephrotic
syndrome (SRNS) The renal biopsy results were available for 105 cases
97
422 GENOTYPING
Genomic DNA was prepared using the standard phenol-chloroform
extraction procedure (Sambrook and Russell 2006) The forward and reverse
primer sequences for ACE ID polymorphism were
5rsquoCTGGAGACCACTCCCATCCTTTCT3rsquo and 5rsquoGATGTGGCCATCACATTGG
TCAGAT3rsquo(Eurofins MWG Operon Germany) respectively The polymerase chain
reaction was performed in a total reaction volume of 10 microl as decribed priviousely
in the Materials and Methods section with some modifications such as 1X PCR
buffer (GoTaqreg
Flexi DNA polymerase Promega USA) 15 mM magnesium
chloride 02 mM dNTPs (Gene Ampreg
dNTP Applied Biosystems USA) 01 units
of GoTaq DNA polymerase and 20ng of the genomic DNA The reaction mixture
was amplified for 30 cycles with denaturation at 94˚C for 1min annealing at 58˚C
for 1 min and extension at 72˚C for 2 min using a Gene Ampreg PCR System 9700
(Applied Biosystems USA) The PCR products were electrophoresed on 2
agarose gel A PCR product of 490 bp represents a homozygous insertion genotype
(II) a 190 bp fragment of homozygous deletion genotype (DD) and the presence of
both the fragments revealed heterozygosity (ID) as shown in Figure- 41
98
Figure- 41 ACE gene ID polymorphism genotyping on 2 agarose gel
M
ACE gene ID polymorphism genotyping on 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The I allele was detected as a 490 bp band (upper band) the D allele was detected
as a 190 bp band (lower band) while heterozygotes showed both the bands The lane
on the right shows the 100 bp molecular weight marker
99
423 STATISTICAL ANALYSIS
The statistical analysis was carried out using the Statistical Package for
Social Sciences (SPSS version 17) Chi-Square and OR tests were used to analyze
the distribution of the genotypic and allelic frequencies of the ACE ID
polymorphism in the NS cases and controls as well as steroid therapy response and
histological features A p-value less than 005 was considered to be significant
43 RESULTS
A total of 268 children with NS were selected for this study Of these 164
were males and 104 were females with the ages ranging between 2 months to 15
years Steroid resistance was established in 105 patients whereas 163 patients were
classified as SSNS End stage renal disease (ESRD) was developed in 12 patients
The clinical parameters of NS patients are shown in Table- 41
Table- 41 The clinical parameters of NS patients
Steroid response
SRNS
N=105
SSNS
N=163
Malefemale 6047 10457
Age of onset 02-15 yrs 1-10 yrs
Family history 24 6
ESRD 12 No
Biopsy 105 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-3 No
100
The genotyping of the ACE ID polymorphism in NS and control samples
showed that the incidence of II ID and DD genotypes were 82 (306) 128
(478) and 58 (216) in the NS patients and 9 (40) 171 (767) and 43
(193) in the control samples respectively The frequency distribution of I and D
alleles were 292 (545) and 244 (455) in the NS group and 189 (42) and 257
(58) in the control samples respectively The difference between the two groups
was statistically significant (plt0001 χ2
=142) having an OR of 16 (95 CI =13-
20) as shown in Table- 42 The NS samples were in Hardy-Weinberg equilibrium
(HWE) with p=085 However the control samples deviated from HWE (plt0001)
The frequency distribution of II and DD genotypes were 82 (59) and 58
(41) in the NS group and 9 (17) and 43 (83) in the control samples
respectively This showed a statistically significant association of the II genotype
with NS (plt0001 χ2
=258) having an OR of 67 (95 CI=3-149) The I-carrier
genotypes (II and ID) were evaluated in the NS group and no significant difference
was found with the control samples as shown in Table- 42
The frequency distribution of II ID and DD genotypes were 35 (33) 47
(45) and 23 (22) in the SRNS group and 47 (29) 82 (50) and 34 (42) in
the SSNS group No significant association was found with steroid response in the
NS patients (pgt005) as shown in Table- 43
The biopsies of 105 SRNS patients were available in which 48 patients had
FSGS and 25 had MCD The frequency distribution of II and DD genotypes and ID
alleles were not significantly associated with FSGS or MCD in our NS population
as shown in Table- 43
101
Table- 42 Genotypic and allelic frequencies of the ACE ID polymorphism
and their distribution in terms of II ID and IIDD genotypes with respect to
DD genotype in NS patients and controls
NS patients
N=268
Controls
N=223
Total
N=491
p-value
ACE genotype
II 82 (306) 9 (4) 91
ID 128 (478) 171 (767) 299
DD 58 (216) 43 (193) 101
ACE allele
I 292 (545) 189 (42) 481 lt0001
D 244 (455) 257 (58) 501
χ2=142 df=1 OR=16 (95 CI=12-20)
Cochran-Armitage trend test = 37 plt0001
ACE genotype
II 82 (59) 9 (17) 91 lt0001
DD 58 (41) 43 (83) 101 OR=67 (30-149)
Total 140 52 192
ID 128 (69) 171 (80) 299 0011
DD 58 (31) 43 (20) 101 OR=05 (03-08)
Total 186 214 400
IIID 210 (78) 180 (81) 390
DD 58 (22) 43 (19) 101 gt005
Total 268 223 491
102
Table- 43 Frequency distribution of the ACE ID polymorphism in SRNS
SSNS FSGS non-FSGS and MCD non-MCD patients
II genotype ID genotype DD genotype Total P value
SRNS 35 (33) 47 (45) 23 (22) 105 pgt005
SSNS 47 (29) 82 (50) 34 (21) 163
FSGS 14 (29) 20 (42) 14 (29) 48 pgt005
Non-FSGS 21 (37) 27 (47) 9 (16) 57
MCD 8 (32) 14 (56) 3 (12) 25 pgt005
Non-MCD 27 (34) 33 (41) 20 (25) 80
103
44 DISCUSSION
ACE is an important component of RAAS that plays an important role in the
renal and cardiovascular pathophysiology by regulating blood pressure fluid-
electrolyte and acid-base balance (Seikaly et al 1990) ACE (ID) polymorphism
has been studied in different diseases like hypertension myocardial infarction and
IgA nephropathy (Bantis et al 2004 Ismail et al 2004) Similarly an association
between the ACE ID polymorphism and the etiology of NS has been investigated
in several epidemiologic studies However conflicting results have been reported
from different parts of the world
The present study was carried out to determine the association of ID
polymorphism in the ACE gene with pediatric NS in Pakistan We found a
significant association of II genotype and the I allele with NS as compare to the
normal controls Our results are in agreement with a study from India where the II
genotype was more frequent in SSNS patients as compared to the controls (Patil et
al 2005) However another study from India has reported that the frequency
distribution of the DD genotype was significantly higher in the SRNS group
compared to the control subjects (Prasun et al 2011) Similarly the II genotype
was found at higher frequency among the Malays (Jayapalan et al 2008) By
contrast the association of the DD genotype with NS has been reported from
Taiwan Egypt and Turkey (Serdaroglu et al 2005 Tsai et al 2006 Fahmy et al
2008) On the other hand no association of ACE gene polymorphism was found in
the Swiss children (Sasse et al 2006) In a recently published meta-analysis Zhou
et al (2011) have concluded that the DD genotype or D allele was not associated
104
with SRNS susceptibility in Asians and Caucasian children but the D allele was
associated with SRNS onset for African children
The NS samples were in HWE (p=085) whereas control samples deviated
from HWE (plt0001) due to the presence of a larger number of heterozygotes than
expected Deviation from HWE indicates that one or more model assumptions for
HWE have been violated The first source for deviation is genotyping error To
exclude the possibility of genotyping errors the genotypes of randomly selected
samples were confirmed by sequencing The Pakistani population is genetically
heterogeneous and the samples used in this study are of mixed ethnicity Another
source of the observed deviation from HWE in these samples could be due to
population stratification However population stratification always leads to a deficit
of heterozygotes (Ziegler et al 2011) which was not the case in this study It has
been suggested that in the case of observed deviation from HWE with no
attributable phenomena a test for trend such as Cochran-Armitage trend test should
be used in order to reduce the chances of false positive association (Zheng et al
2006) Therefore the Cochran-Armitage trend test was performed and the results
confirm the allelic association (plt0001 Table- 42)
The II and DD genotypes showed no significant differences in the SRNS
and SSNS patients in the Pakistani children (Table- 43) However the sample size
(SSNS=163 and SRNS=105) is rather small to conclude any significant role of ACE
polymorphism with response to standard steroid therapy Similarly the D allele
frequency was not found to be associated with steroid sensitivity in NS patients in
the Egyptian and Indonesian populations (Sasongko et al 2005 Saber-Ayad et al
2010)
105
The MCD and FSGS are common histological variants of NS found in our
population (Mubarak et al 2009) As also reported by others (Serdaroglu et al
2005 Saber-Ayad et al 2010) the ID polymorphism showed no association with
FSGS and MCD in our NS population (Table- 43) By contrast the DD genotype
was associated with FSGS in the Kuwaiti Arab and Korean patients (Lee et al
1997 Al-Eisa et al 2001)
In conclusion NS is associated with a higher incidence of the II genotype in
the ACE gene in Pakistani children No significant association of allele and
genotype frequencies with steroid sensitivity and histological patterns are found in
these children
106
45 REFERENCES
Al-Eisa A Haider MZ Srivastva BS (2001) Angiotensin converting enzyme gene
insertiondeletion polymorphism in idiopathic nephrotic syndrome in Kuwaiti Arab
children Scand J Urol Nephrol 35 239-242
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P
(2004) Influence of genetic polymorphism of the rennin-angiotensin system on IgA
nephrotpathy Am J Nephrol 24 258-267
Braden GL Mulhern JG OrsquoShea MH Nash SV Ucci AA Germain MJ (2000)
Changing incidence of Glomerular diseases in adults Am J Kidney Dis 35 878-
883
Eddy AA Symons JM (2003) Nephrotic syndrome in childhood Lancet 362
629-639
Fahmy ME Fattouh AM Hegazy RA Essawi ML (2008) ACE gene
polymorphism in Egyptian children with idiopathic nephrotic syndrome Bratisl Lek
Listy 109 298-301
Hussain R Bittles AH (2004) Assessment of association between consanguinity
and fertility in Asian populations J Health Popul Nutr 22 1-12
Ismail M Akhtar N Nasir M Firasat S Ayub Q Khaliq S (2004) Association
between the angiotensin-converting enzyme gene insertiondeletion polymorphism
and essential hypertension in young Pakistani patients J Biochem Mol Biol 3 552-
555
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Lee DY Kim W Kang SK Koh GY Park SK (1997) Angiotensin-converting
enzyme gene polymorphism in patients with minimal-change nephrotic syndrome
and focal segmental glomerulosclerosis Nephron 77 471-473
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Obeidova H Merta M Reiterova J Maixnerova D Stekrova J Rysava R Tesar V
(2006) Genetic basis of nephritic syndrome-review Prag Med Rep 107 5-16
Oktem F Sirin A Bilge I Emre S Agachan B Ispir I (2004) ACE ID gene
polymorphism in primary FSGS and steroid-sensitive nephrotic syndrome Pediatr
Nephrol 19 384-389
107
Patil SJ Gulati S Khan F Tripathi m Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol F Soubrier F (1990) An
insertiondeletion polymorphism in the angiotensin I-converting enzyme gene
accounting for half the variance of serum enzyme levels J Clin Invest 86 1343-
1346
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr Padiatrische Nephrologie
Study Group (2004) Patients with mutations in NPHS2 (podocin) do not respond
to standard steroid treatment of nephrotic syndrome J Am Soc Nephrol 15 722-
732
Saber-Ayad M Sabry S Abdel-Latif I Nabil H El-Azm SA Abdel-Shafy S
(2010) Effect of angiotensin-converting enzyme gene insertiondeletion
polymorphism on steroid resistance in Egyptian children with idiopathic nephrotic
syndrome Renin Angiotensin Aldosterone Syst 11 111-118
Sambrook J Russell DW The condensed protocol From molecular cloning a
laboratory manual Coldspring Harbour Laboratory Press Coldspring Harbour
New York 2006 241-243
Sasongko T Sadewa AH Kusuma PA Damanik MP Lee MJ Ayaki H Nozu K
Goto A Matsuo M Nishio H (2005) ACE gene polymorphism in children with
nephrotic syndrome in the Indonesian population Kobe J Med Sci 51 41-47
Sasse B Hailemariam S Wuthrich RP Kemper MJ Neuhaus TJ (2006)
Angiotensin converting enzyme gene polymorphisms do not predict the course of
idiopathic nephrotic syndrome in Swiss children Nephrology 11 538-5341
Seikaly MG Arant BS Seney FD (1990) Endogenous angiotensin concentrations
in specific intrarenal fluid compartments in the rat J Clin Invest 86 1352-1357
Serdaroglu E Mir S Berdeli A Aksu N Bak M (2005) ACE gene insertiondele-
tion polymorphism in childhood idiopathic nephrotic syndrome Pediatr Nephrol
20 1738-1743
Sharples PM Poulton J White RH (1985) Steroid responsive NS is more
common in Asians Arch Dis Child 60 1014-1017
Tsai LJ Yang YH Lin Wu VC Tsau YK Hsieh FJ (2006) Angiotensin-
converting enzyme gene polymorphism in children with idiopathic nephrotic
syndrome Am J Nephrol 26 157-162
108
Zheng G Freidlin B Gastwirth JL (2006) Robust genomic control for association
studies Am J Hum Genet 78 350-356
Zhou TB Qin YH Su LN Lei FY Huang WF Zhao YJ Pang YS (2011)
Insertiondeletion (ID) polymorphism of angiotensin-converting enzyme gene in
steroid-resistant nephrotic syndrome for children A genetic association study and
Meta-analysis Renal Failure 33 741-748
109
5 ASSOCIATION OF MTHFR GENE
POLYMORPHISMS (C677T AND A1298C) WITH
NEPHROTIC SYNDROME IN PAKISTANI
CHILDREN
110
51 INTRODUCTION
The gene for the enzyme methyltetrahydrofolate reductase (MTHFR
OMIM-607093) is localized on chromosome 1p363 (Gaughan et al 2000) This
enzyme catalyzes the NADPH-linked reduction of 5 10 methyltetrahydrofolate to
5-methyltatrahydrofolate which serves as an important cofactor in the methylation
of homocysteine (Hcy) to methionine as shown in Figure-51 (Goyette et al 1994)
Mutations in the MTHFR gene have been suggested to be responsible for increased
homocysteine levels in the blood (Lucock 2000)
The two most common single nucleotide polymorphisms (SNPs) in the
MTHFR gene are C677T (dbSNP I rs1801133) a missense mutation that results in
an alanine to valine substitution at codon 222 and A1298C (dbSNP ID rs1801131)
a point mutation that leads to change from a glutamine to alanine at codon 429 of
the gene (Weisberg et al 1998) The C677T polymorphism is localized in the
catalytic N-terminal domain of the enzyme while A1298C is localized in the
regulatory domain of the enzyme (Friso et al 2002)
The C677T polymorphism is associated with a 30 decrease in the activity
of the enzyme in the CT heterozygous state and a 60 decrease in the TT
homozygous state (Frosst et al 1995) This polymorphism is known to cause mild
hyperhomocysteinemia particularly in homozygotes and also in compound
heterozygotes along with the A1298C polymorphism (Weisberg et al 1998
Andreassi et al 2003) The frequency of TT homozygotes among healthy
individuals ranges from 0 to 1 in African Americans 25 in Hispanic
111
Americans and 10 to 15 in Canadians Americans Europeans Asians and
Australian populations (Rozen 2001)
Hyperhomocysteinemia is a commonly recognized risk factor for several
multifactorial disorders associated with thrombotic complications atherosclerosis
cardiovascular and renal diseases etc (Buumlyuumlkccedilelik et al 2008 Ferechide and
Radulescu 2009 Kniazewska et al 2009 Ciaccio and Bellia 2010) Nephrotic
syndrome has also been associated with a higher risk of infections thrombotic
complications early atherosclerosis and cardiovascular diseases (Louis et al 2003
Kniazewska et al 2009)
In the healthy individuals 75 of the total Hcy is bound to albumin and
only a small amount is available in the free form (Hortin et al 2006) However in
the NS patients heavy proteinuria is supposed to cause a decrease in the plasma
Hcy concentration and an increase in urinary Hcy excretion (Refsum et al 1985
Sengupta et al 2001) The change in the plasma Hcy concentration affects its
metabolism and may suggests a role for MTHFR polymorphisms in NS
This study was carried out to determine the association of MTHFR gene
polymorphisms (C677T and A1298C) with the progression of NS in Pakistani
children and to further evaluate the relationship between these polymorphisms and
the outcome of steroid therapy and histological findings in these patients
112
Figure- 51 Dysregulation of MTHFR leads to the accumulation of
homocysteine (Kremer 2006)
113
52 MATERIALS AND METHODS
Blood samples were collected from 318 NS patients from the pediatric
nephrology department SIUT with their informed consent A panel of 200 normal
control samples was also included in the study The diagnosis of patients and their
inclusion for the study has been discussed earlier The NS patients were classified
into 166 SRNS and 152 SSNS patients (Table-51)
Table-51 The clinical parameters of NS patients
SRNS
N=166
SSNS
N=152
Malefemale 9274 8963
Age of onset 02mo-15 yrs 1-10 yrs
Family history 42 7
ESRD 12 No
Biopsy 114 No
Proteinuria (gdl) 0-4 0-4
Serum albumin (gl) 0-36 0-35
Serum creatinine (mgdl) 0-92 0-162
Hematuria 0-36 No
521 GENOTYPING
Genotyping for the MTHFR gene polymorphisms was performed using
polymerase chain reaction (PCR) and restriction fragment length polymorphism
(RFLP) techniques as described earlier The presence of C677T and A1298C
polymorphisms in the MTHFR gene were analyzed by HinfI and MobII restriction
enzymes digestion respectively according to Skibola et al 1999 (Figure- 52 and
53)
114
Figure- 52 MTHFR gene C677T polymorphism genotyping
MTHFR gene polymorphism genotyping on a 2 agarose gel stained with
ethidium bromide and photographed with automated gel documentation system
The C allele of C677T polymorphism was detected as a single 198 bp band (upper
band) the T allele was detected as a 175 and 23 bp bands (lower band) while
heterozygotes showed both the bands The lane on the left (M) shows the 100 bp
molecular weight marker
Figure- 53 MTHFR gene A1298C polymorphism genotyping
115
The C and A alleles of the MTHFR A1298C polymorphism were detected as a
major visible band of 84 bp (upper band) and 56 bp (lower band) respectively while
heterozygotes showed both the bands
53 RESULTS
A total of 318 children with NS were selected for this study Of these 181
were males and 137 were females with ages ranging between 2 months to 15 years
The genotyping of the MTHFR C667T polymorphism in the NS and control
samples showed that the incidence of CC CT and TT genotypes were 236 (74)
70 (22) and 12 (4) in the NS patients and 140 (70) 52 (26) and 8 (4) in
the control samples respectively The frequency distribution of C and T alleles were
542 (85) and 94 (15) in the NS group and 332 (83) and 68 (17) in the
control samples respectively The difference between the two groups was not
statistically significant (χ2=0917 pgt005) having an OR of 1181 (95 CI= 0840-
1660) as shown in Table- 52 The controls samples were in Hardy-Weinberg
equilibrium (HWE) with (χ2=124 pgt005) However the NS samples deviated
from HWE (plt005)
The frequency distribution of CC and TT genotypes were 236 (74) and 12
(4) in the NS group and 140 (70) and 8 (4) in the control samples
respectively There was no statistically significant difference in the frequencies of
the CC and TT genotypes in the two groups (χ2=0062 pgt005) having an OR of
1124 (95 CI= 0448-2816) as shown in Table- 52 The T-carrier genotypes (CT
and TT) were evaluated in the NS group but no significant difference (pgt005) was
found in the NS and control samples as shown in Table- 52
116
Table- 52 Genotypic and allelic frequencies of the MTHFR C667T
polymorphism and their distribution in terms of CC CT and CCCT
genotypes with respect to TT genotype in NS patients and controls
Genotypes
and Alleles
C667T
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR C667T genotype
CC 236 (74) 140 (70) 376
CT 70 (22) 52 (26) 122
TT 12 (4) 8 (4) 20
MTHFR C667T allele
C 542 (85) 332 (83) 874 gt005
T 94 (15) 68 (17) 162
χ2=0917 df=1 OR=1181 (95 CI=0840-166)
MTHFR C667T genotype
CC 236 (74) 140 (70) 376 gt005
TT 12 (4) 8 (4) 20 OR=1124
Total 248 148 396
CT 70 (22) 52 (26) 122 gt005
TT 12 (4) 8 (4) 20 OR=0897
Total 82 60 142
CCCT 306 (96) 192 (96) 498 gt005
TT 12 (4) 8 (4) 20 OR=1063
Total 318 200 518
117
The frequency distribution of CC CT and TT genotypes of C677T
polymorphism were 124 (75) 37 (22) and 5 (3) in the SRNS group and 112
(74) 33 (22) and 7 (4) in the SSNS group No significant association was
found with steroid response in the NS patients (pgt005) as shown in Table- 53
The biopsies of 166 SRNS patients were available in which 52 patients had
FSGS and 30 had MCD The frequency distribution of CC and TT genotypes and
CT alleles were not significantly associated with FSGS or MCD in our NS
population as shown in Table- 53
Table- 53 Frequency distribution of the MTHFR C677T polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
CC
genotype
CT
genotype
TT
genoty
pe
Total P value
SRNS 124 (75) 37 (22) 5 (3) 166 pgt005
SSNS 112 (74)
33 (22) 7 (4) 152
FSGS 42 (79) 9 (17) 2 (4) 53 pgt005
Non-
FSGS 82 (73) 27 (24) 3 (3) 112
MCD 19 (63) 11 (37) 0 (0) 30 pgt005
Non-
MCD 105 (77) 27 (20) 5 (3) 137
The genotyping of the MTHFR A1298C polymorphism in the NS and
control samples showed that the incidence of CC CA and AA genotypes were 52
(16) 152 (48) and 114 (36) in the NS patients and 37 (185) 93 (465)
and 70 (35) in the control samples respectively The frequency distribution of C
and A alleles were 256 (40) and 380 (60) in the NS group and 167 (42) and
118
233 (58) in the control samples respectively The difference between the two
groups was not statistically significant (χ2=0191 pgt005) having an OR of 0945
(95 CI=0733-1218) as shown in Table- 54 The NS and control samples were
in Hardy-Weinberg equilibrium with (χ2
=001 and 039 pgt005)
The frequency distribution of CC and AA genotypes were 52 (16) and
114 (36) in the NS group and 37 (185) and 70 (35) in the control samples
respectively There was no statistically significant association of A1298C
polymorphism with NS (χ2=0314 pgt005) having an OR of 0863 (95
CI=0515-1446) as shown in Table- 54
The frequency distribution of CC CA and AA genotypes were 32 (193)
72 (434) and 62 (373) in the SRNS group and 23 (15) 77 (51) and 52
(34) in the SSNS group No significant association was found with steroid
response in the NS patients (pgt005) The frequency distribution of CC and AA
genotypes and CA alleles were not significantly associated with FSGS or MCD in
our NS population as shown in Table- 55
54 DISCUSSION
MTHFR gene polymorphisms have been studied in different diseases like
atherosclerosis vascular and thrombotic diseases neural birth defect and cancers
etc (Buumlyuumlkccedilelik et al 2008 Ferechide and Radulescu 2009 Kniazewska et al
2009 Taioli E et al 2009 Ciaccio and Bellia 2010 Deb et al 2011) However
only a few studies have been reported on the association of the MTHFR gene
polymorphism with NS (Zou et al 2002 Prikhodina et al 2010) The present
study was carried out to determine the association of C667T and A1298C
polymorphisms in the MTHFR gene with pediatric NS patients in Pakistan
119
Table- 54 Genotypic and allelic frequencies of the MTHFR A1298C
polymorphism and their distribution in terms of CC CA and CCCA
genotypes with respect to AA genotype in NS patients and controls
Genotypes and
Alleles A1298C
NS patients
N=318
Controls
N=200
Total
N=518 p-value
MTHFR A1298C genotype
CC 52 (16) 37 (185) 89
CA 152 (48) 93 (465) 245
AA 114 (36) 70 (35) 184
MTHFR A1298C allele
C 256 (40) 167 (42) 423 gt005
A 380 (60) 233 (58) 613
χ2=0191 df=1 OR=0945 (95 CI=0733-1218)
MTHFR A1298Cgenotype
CC 52 (16) 37 (185) 89 gt005
AA 114 (36) 70 (35) 184 OR=0863
Total 166 107 273
CA 152 (48) 93 (465) 245 gt005
AA 114 (36) 70 (35) 184 OR=1004
Total 266 163 429
CCCA 204 (64) 130 (65) 334 gt005
AA 114 (36) 70 (35) 184 OR=0964
Total 318 200 518
120
Table- 55 Frequency distribution of the MTHFR A1298C polymorphism in
SRNS SSNS FSGS non-FSGS and MCD non-MCD patients
The MTHFR enzyme regulates homocysteine metabolism Mutations in the
MTHFR gene are associated with increased plasma homocysteine levels Similar to
that of hyperhomocysteinemia the NS patients have a higher risk of infections
thrombotic complications and arthrosclerosis These observations give insight into
the role of homocysteine metabolism in the NS patients However some studies
have reported decreased plasma Hcy levels in the NS patients (Arnadottir et al
2001 Tkaczyk et al 2009) while other have shown normal (Dogra et al 2001)
and increased levels as compared to healthy controls (Joven et al 2000 Podda et
al 2007) Since contradictory results were observed in the NS patients these
studies have suggested that plasma Hcy concentration is not a predictable marker
In agreement with Prikhodina et al (2010) the association between C677T
and A1298C polymorphisms of the MTHFR gene with NS was not observed in this
study However Zou et al (2002) have reported that the frequency distribution of
CC
genotype
CA
genotype
AA
genotype
Total P
value
SRNS 32(193) 72(434) 62(373) 166 pgt005
SSNS 23(15) 77(51) 52(34)
152
FSGS 7(135) 22(423) 23(442) 52 pgt005
Non-
FSGS
22(19) 50(45) 40(36) 112
MCD 6(19) 17(53) 9(28) 32 pgt005
Non-
MCD
25(18) 57(41) 56(41) 138
121
the TT genotype was significantly higher with the early development and
progression of childhood FSGS
The NS samples for C667T polymorphism were not in HWE whereas the
control samples were The possible explanation of HWE deviation in the Pakistani
population has been discussed previously in Chapter 4 On the other hand the NS
patients and healthy controls for A1298C polymorphism were in HWE To exclude
the possibility of genotyping errors the genotypes of randomly selected samples
were confirmed by sequencing
The C677T and A1298C genotypes showed no significant differences in the
SRNS and SSNS patients in the Pakistani children (Table- 53 and 55) As also
reported by (Prikhodina et al 2006) the MTHFR gene polymorphisms showed no
association with steroid therapy (Table- 53) The common histological variants of
NS found in our patient population are MCD and FSGS (Mubarak et al 2009)
However the MTHFR polymorphisms showed no association with FSGS and MCD
in our NS population (Table- 53 and 55)
In conclusion the genotypic and allelic frequencies of C677T and A1298C
polymorphisms were not associated with the progression of NS in Pakistani
children By contrast the TT genotype was significantly higher with the early
development of childhood FSGS in the Japanese patients No significant
association of allele and genotype frequencies was found with steroid sensitivity
and histological patterns of these children
122
55 REFERENCES
Andreassi MG Botto N Battaglia D Antonioli E Masetti S Manfredi S
Colombo MG Biagini A Clerico A (2003) Methylenetetrahydrofolate reductase
gene C677T polymorphism homocysteine vitamin B12 and DNA damage in
coronary artery disease Hum Genet 112 171-177
Arnadottir M Hultberg B Berg AL (2001) Plasma total homocysteine
concentration in nephrotic patients with idiopathic membranous nephropathy
Nephrol Dial Transplant 16 45-47
Buumlyuumlkccedilelik M Karakoumlk M Başpinar O Balat A (2008) Arterial thrombosis
associated with factor V Leiden and methylenetetrahydrofolate reductase C677T
mutation in childhood membranous glomerulonephritis Pediatr Nephrol 23 491-
494
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
Deb R Arora J Meitei SY Gupta S Verma V Saraswathy KN Saran S Kalla
AK (2011) Folate supplementation MTHFR gene polymorphism and neural tube
defects a community based case control study in North India Metab Brain Dis 26
241-246
Dogra G Irish AB Watts GF (2001) Homocysteine and nephrotic syndrome
Nephrol Dial Transplant 16 1720-1721
Ferechide D Radulescu D (2009) Hyperhomocysteinemia in renal diseases J
Med Life 2 53-59
Friso S Choi SW Girelli D Mason JB Dolnikowski GG Bagley PJ Olivieri O
Jacques PF Rosenberg IH Corrocher R Selhub J (2002) A common mutation in
the 5 10-methylenetetrahydrofolate reductase gene affects genomic DNA
methylation through an interaction with folate status Proc Natl Acad Sci USA 99
5606-5611
Frosst P Blom HJ Milos R Goyette P Sheppard CA Matthews RG Boers GJ
den Heijer M Kluijtmans LA van den Heuvel LP Rozen R (1995) A candidate
genetic risk factor for vascular disease a common mutation in
methylenetetrahydrofolate reductase Nat Genet 10 111-113
Gaughan DJ Barbaux S Kluijtmans LA Whitehead AS (2000) The human and
mouse methylenetetrahydrofolate reductase (MTHFR) genes genomic
organization mRNA structure and linkage to the CLCN6 gene Gene 257 279-
289
123
Goyette P Sumner J S Milos R Duncan A M V Rosenblatt D S Matthews R G
Rozen R (1994) Human methylenetetrahydrofolate reductase isolation of cDNA
mapping and mutation identification Nature Genet 7 195-200
Hortin GL Seam N Hoehn GT (2006) Bound homocysteine cysteine and
cysteinylglycine distribution between albumin and globulins Clin Chem 52 2258-
2264
Joven J Arcelus R Camps J Ordoacutentildeez-Llanos J Vilella E Gonzaacutelez-Sastre F
Blanco-Vaca F (2000) Determinants of plasma homocyst(e)ine in patients with
nephrotic syndrome J Mol Med 78 147-154
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
Kremer JM (2006) Methotrexate pharmacogenomics Ann Rheum Dis 65 1121-
1123
Louis CU Morgenstern BZ Butani L (2003) Thrombotic complications in
childhood-onset idiopathic membranous nephropathy Pediatr Nephrol 18 1298-
1300
Lucock M (2000) Folic acid nutritional biochemistry molecular biology and
role in disease processes Mol Genet Metab 71 121-138
Mubarak M Lanewala A Kazi JI Akhter F Sher A Fayyaz A Bhatti S (2009)
Histopathological spectrum of childhood nephrotic syndrome in Pakistan Clin Exp
Nephrol 13 589-593
Podda GM Lussana F Moroni G Faioni EM Lombardi R Fontana G Ponticelli
C Maioli C Cattaneo M (2007) Abnormalities of homocysteine and B vitamins in
the nephrotic syndrome Thromb Res 120 647-652
Prikhodina L Vinogradova T Poltavets N Polykov A Dlin V (2010)
Hyperhomocysteinaemia and mthfr c677t gene polymorphism in
children with steroid-resistant nephrotic syndrome In The 15th
Congress
of the IPNA (August 29-September 2 2010) New York USA Pediatric
Nephrology 25 1881 pp 432
Prikhodina L Poltavets N Zaklyazminskaya E Galeeva N Tverskay S Polykov
A Dlin V Ignatova M (2006) Methylentetrahydrofolate reductase (mthfr) 677c-t
gene polymorphism and progression of steroid-resistant nephrotic syndrome in
children Pediatr Nephrol 21 ОР 43 c1517
124
Refsum H Helland S Ueland PM (1985) Radioenzymic determination of
homocysteine in plasma and urine Clin Chem 31 624-628
Rozen R Polymorphisms of folate and cobalamin metabolism In Homocysteine
in Health and Disease Edited by Carmel R Jacobsen DW UK Cambridge
University Press 2001 259-270
Sengupta S Wehbe C Majors AK Ketterer ME DiBello PM Jacobsen DW
(2001) Relative roles of albumin and ceruloplasmin in the formation of
homocystine homocysteine-cysteine-mixed disulfide and cystine in circulation J
Biol Chem 276 46896-46904
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Skibola CF Smith MT Kane E Roman E Rollinson S Cartwright RA Morgan
G (1999) Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults Proc Natl Acad Sci USA
96 12810-12815
Taioli E Garza MA Ahn YO Bishop DT Bost J Budai B Chen K Gemignani F
Keku T Lima CS Le Marchand L Matsuo K Moreno V Plaschke J Pufulete M
Thomas SB Toffoli G Wolf CR Moore CG Little J (2009) Meta- and pooled
analyses of the methylenetetrahydrofolate reductase (MTHFR) C677T
polymorphism and colorectal cancer a HuGE-GSEC review Am J Epidemiol 170
1207-1221
Tkaczyk M Czupryniak A Nowicki M Chwatko G Bald E (2009)
Homocysteine and glutathione metabolism in steroid-treated relapse of idiopathic
nephrotic syndrome Pol Merkur Lekarski 26 294-297 Polish
Weisberg I Tran P Christensen B Sibani S Rozen R (1998) A second genetic
polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity Mol Genet Metab 64 169-172
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
125
6 GENERAL DISCUSSION
126
Single gene defects have been shown to cause a number of kidney diseases
eg nephrotic syndrome Nail-Patella syndrome Alport syndrome etc The disease
causing mutation in a single gene is sufficient to cause monogenic diseases
(Hildebrandt 2010) The present work on ldquoGenetics of nephrotic syndrome in
Pakistani childrenrdquo is such an example of monogenic disorders and is carried out to
find the genetic causes of steroid resistant nephrotic syndrome in pediatric
Pakistani population
It is well established that the glomerular filtration barrier consists of a
dynamic network of proteins that are involved in maintaining its function and
structural integrity (Hinkes et al 2007) The identification of disease-causing
mutations in the genes encoding these proteins helps in understanding the diseases
pathophysiology prognosis and treatments
A large number of Pakistani children suffer from NS and a significant
proportion of these become steroid resistant In the first year of life two thirds of
the cases of SRNS are reported to be caused by mutations in one of the four genes
NPHS1 (nephrin) NPHS2 (podocin) WT1 (Wilmrsquos tumor) and LAMB2 (laminin
beta 2 Hinkes et al 2007) Recently the panel of genes that are involved in the
pathogenesis of SRNS has expanded These genes include NPHS1 NPHS2
LAMB2 PLCE1 PTPRO ACTN4 WT1 CD2AP TRPC6 and INF2 (Weins and
Pollak 2008 Sinha and Bagga 2012) However the NPHS1 and NPHS2 genes
constitute a major spectrum of disease causing mutations Therefore it was of
interest to find the frequencies of disease-causing mutations in these two genes in
the Pakistani pediatric NS patients
127
The present study analyzed 145 cases that included 36 samples of
congenital or infantile onset NS and 39 samples of familial cases from 30 different
families The diagnosis was based on the presence of edema urinary protein
excretion equal to or greater than 40mgm2hr and serum albumin below 25 gl
Detailed clinical analysis was obtained for all the patients
Mutation analysis was performed by direct DNA sequencing of all the 29
exons of the NPHS1 gene and 8 exons of the NPHS2 gene A total of seven
homozygous (six novel) mutations in the NPHS1 gene and four homozygous
mutations in the NPHS2 gene were identified exclusively in the early onset cases
Our results showed a low prevalence of disease causing mutations in the NPHS1
(22 early onset 55 overall) and NPHS2 (33 early onset and 34 overall)
genes in the Pakistani NS children as compared to the European populations No
mutation was found in the familial Pakistani cases contrary to the high frequency of
NPHS2 gene mutations reported for familial SRNS in Europe These observations
suggested that patients that do not have disrupted NPHS1 and NPHS2 genes should
be screened for mutations in other genes encoding the WT1 LAMB2 and PLCE1
genes This is the first comprehensive screening of the NPHS1 and NPHS2 gene
mutations in sporadic and familial NS cases from Pakistan (South Asia)
The identified mutations have important implications in disease progression
but underlying genetic association studies are thought to affect several aspects of
the disease etiology These may include susceptibility for acquiring the disease
treatment responses histological findings and disease progression The genetic
association study of ACE gene polymorphism has been largely investigated in the
nephrotic syndrome patients and therefore the present studies were designed to
128
determine the association of the ACE and MTHFR gene polymorphisms with
pediatric NS in Pakistan
The ACE gene insertiondeletion (ID) polymorphism is a putative genetic
risk factor for NS This study analyzed 268 NS and 223 control samples by a PCR-
based method The results showed that the frequency distribution of the II ID and
DD genotypes were 82 (306) 128 (478) and 58 (216) in the NS patients
and 9 (40) 171 (767) and 43 (193) in the control samples respectively The
II genotypic and allelic frequencies were found to be significantly associated with
the disease in the Pakistani pediatric NS population (OR=67 CI=3-149) No
significant association was found between this polymorphism and the response to
standard steroid therapy Thus in contrast to reports from other parts of the world
the II genotype was found to be significantly associated with NS in the Pakistani
population This is similar to reports of the Indian and Malay populations (Patil et
al 2005 Jayapalan et al 2008) To our knowledge this is the first report from
Pakistan describing the association of the ACE ID polymorphism with pediatric
NS On the basis of these results it is suggested that analysis of the ACE (ID)
polymorphism should be performed for early diagnosis in the high risk NS patients
in South Asia
MTHFR gene polymorphisms cause elevated homocysteine levels
Hyperhomocysteinemia is an independent risk factor for thrombosis hypertension
arthrosclerosis and renal diseases etc and these similar complications are also
associated with the nephrotic syndrome (Kniazewska et al 2009 Ciaccio and
Bellia 2010) The MTHFR gene polymorphisms (C677T and A1298C) were also
analyzed in the nephrotic syndrome patients in this study A total of 318 children
129
with NS were ascertained and a panel of 200 healthy control samples was also
included Genotypes of the MTHFR polymorphisms (C677T and A1298C) were
analyzed using the PCR and RFLP techniques The frequencies for all three
possible genotypes of MTHFR C667T polymorphism ie CC CT and TT
genotypes were 74 22 and 4 in the NS patients and 70 26 and 4 in the
control samples respectively
The frequencies of CC CA and AA genotypes of MTHFR A1298C
polymorphism were 16 48 and 36 in the NS patients and 185 465 and
35 in the control samples respectively The genotypic and allelic frequencies of
C677T and A1298C polymorphisms were not associated with NS in Pakistani
children (OR=1181 0945 respectively) By contrast the TT genotype of the
MTHFR C667T polymorphism was associated with the early development and
progression of childhood FSGS in the Japanese patients (Zou et al 2002)
61 GENETIC SCREENING AND COUNSELING
The genetic screening guidelines for SRNS patients were described by
Santin et al (2011) It has been recommended that genetic screening should be
carried out for all SRNS children under the age of 13 years It is a non invasive
technique and is suggested to be performed before renal biopsies of SRNS patients
This precise testing approach depends on the age of the patient In congenital neph-
rotic syndrome the NPHS1 gene should be screened first whereas in cases of
infantile and childhood-onset NS the NPHS2 gene should be screened first (Santin
et al 2011) Other studies have also recommended the screening of the NPHS1
NPHS2 and WT1 genes for childhood onset SRNS (Hinkes et al 2007) If SRNS
130
patients are associated with renal histology of DMS the screening of PLCE1 and
LAMB2 genes should be carried out (Hasselbacher et al 2006 Hinkes et al
2006) In cases of late onset SRNS screening of INF2 TRPC6 and ACTN4 may be
performed in familial cases but no further investigation is recommended for
sporadic cases (Machuca et al 2009 Benoit et al 2010 Brown et al 2010
Boyer et al 2011 Santin et al 2011) This genetic testing guideline is generally
recommended for patients of European Middle Eastern or North African origin
but may not be appropriate for other part of the world as NPHS2 mutations are less
prevalent in Asian and African American children suffering from SRNS (Sako et
al 2005 Mao et al 2007)
There is no guideline available for the South Asian region and therefore the
present study was designed to carry out the screening of the NPHS1 and NPHS2
gene mutations in the pediatric SRNS cases from Pakistan The selection criteria of
patients were according to Santin et al (2011) and the results showed that
mutations in the NPHS1 and NPHS2 genes were not the frequent causes of
pediatric NS in Pakistan These results are in accordance with the studies from
Japan and China that reported a low prevalence of defects of the two genes in their
NS patients (Sako et al 2005 Mao et al 2007) Thus the low prevalence of
disease-causing mutations in the NPHS1 and NPHS2 genes suggests the
contribution of ethnic diversity in world populations Further investigations are
required to identify other novel podocyte genes that may be responsible for disease
in these patients
Genetic counseling is recommended for every patient with hereditary NS
and their families due to a higher risk of disease transmission from parents to
131
progeny The prenatal diagnosis should be accessible to families with a known risk
of CNS NPHS1 gene screening in these cases may help in counseling the families
at early pregnancies and also in future family planning In some patients genotypendash
phenotype correlations may facilitate counseling providing further information for
the NS patients which may modify the clinical course This has been observed in
the NPHS2-associated disease where some mutations have severe early onset of
the disease whereas others have shown to be late onset with a milder phenotype
(Buscher and Weber 2012)
62 THERAPEUTIC OPTIONS
NS patients generally respond to glucocorticoids or immunosuppressant
agents including cyclosporine (CsA) cyclophosphamide azathioprine and
mycophenolate mofetil (Plank et al 2008) Immunosuppressants suppress the
immune response and have beneficial effects directly on podocyte architecture
(Tejani and Ingulli 1995)
Patients with hereditary NS do not respond to standard steroid therapy This
observation suggested that there is no need to give heavy doses of steroids to these
patients However a partial response to and angiotensin converting enzyme (ACE)
inhibitors have been observed in some patients bearing NPHS1 NPHS2 TRPC6 or
WT1 mutations This response may be an effect of the antiproteinuric action of
calcineurin inhibitors or cyclosporine A (Machuca et al 2009 Benoit et al 2010
Buscher et al 2010 Santin et al 2011) Similarly in the current screening the
patients bearing NPHS1 and NPHS2 mutations have shown partial response to
immunosuppressants and ACE inhibitors
132
It has been observed that remission rates after CsA therapy are significantly
lower in patients with a known genetic basis compared with non hereditary SRNS
(17 vs 68 Buscher et al 2010) Intensified immunosuppressive therapy
regimens should not be recommended for hereditary SRNS patients ACE
inhibitors or blockers are also beneficial in reducing protein excretion and have
been found to be a better therapeutic option for SRNS patients (Sredharan and
Bockenhauer 2005 Liebau et al 2006 Copelovitch et al 2007) Further studies
are needed to determine which treatment would be beneficial for hereditary SRNS
patients Genetic screening also spares patients from the side effects associated with
these drugs Thus mutation analysis provides a guideline for long term therapy and
is also helpful in avoiding unnecessary steroid treatment for patients (Ruf et al
2004 Weber et al 2004)
The hereditary SRNS patients generally progress to ESRD and need dialysis
andor renal transplantation (RTx) The SRNS patients with NPHS2 gene mutations
have a lower risk of recurrent FSGS after renal transplantation (Caridi et al 2005
Jungraithmayr et al 2011) However these patients are not completely protected
from post-transplant recurrence of proteinuria Among these patients with a
heterozygous mutation show a higher risk of recurrence as compared to the patients
with homozygous or compound heterozygous mutations Thus a kidney from the
carrier of the mutation (such as parents) is not recommended as a donor for
transplantation due to the higher risk of FSGS recurrence in the recipient (Caridi et
al 2004) Therefore genetic screening of SRNS patients is also valuable in the
selection of the donor Patients with NPHS1 gene mutations have a higher risk of
post-transplant recurrence of NS due to the development of anti-nephrin antibodies
133
Such patients showed partial response to cyclophosphamide (Patrakka et al 2002)
In the dominant form of NS only one parent is the carrier of the causative
mutations In this case genetic testing will help to identify carriers within the family
(Buscher and Weber 2012)
63 FUTURE PERSPECTIVES
Recent genetic studies are providing exciting knowledge related to NS The
exact roles and functions of the newly discovered genes and proteins have been
under investigation using a combination of in vitro and in vivo approaches
(Woroniecki and Kopp 2007) These approaches have resulted in the development
of animal models of disease which will be helpful in understanding the disease
mechanisms as well as providing important tools to analyze novel therapeutic
strategies The better understanding of the pathophysiology of the NS will
influence future therapies and outcomes in this complicated disease
The use of chemical chaperones such as sodium 4-phenylbutyrate (4-PBA)
may be a potential therapeutic approach for the treatment of mild SRNS caused by
mutations in the NPHS1 and NPHS2 genes or in some patients with a non familial
NS or other similar diseases affecting renal filtration 4-PBA can correct the
cellular trafficking of several mislocalized or misfolded mutant proteins It has been
shown to efficiently rescue many mutated proteins that are abnormally retained in
the ER and allow them to be expressed normally on the cell surface and also
function properly (Burrows et al 2000)
Other important targets are the calcineurin inhibitors or CsA that provide
direct stabilization to the actin cytoskeleton in podocyte Recent advances indicate
134
that calcineurin substrates such as synaptopodin have the potential for the
development of antiproteinuric drugs This novel substrate also helps in avoiding
the severe side effects associated with the extensive use of CsA (Faul et al 2008)
The study presented here reports that mutations in the NPHS1 and NPHS2
genes are not the frequent causes of pediatric NS in Pakistan and no mutation was
found in the familial SRNS cases This study indicates that there are additional
genetic causes of SRNS that remain to be identified Novel genomic approaches
including next generation sequencing (Mardis et al 2008) and copy number
analysis based strategies may lead to the identification of novel genes in the near
future
In this current screening the exact role of heterozygous NPHS1 and NPHS2
mutations in disease progression were not established The newer techniques such
as whole exome screening may facilitate to analyze all the NS genes in a single
array and will be helpful in investigating the role of digenic or multigenic
(heterozygous) mutations These techniques will also aid in the diagnosis of
mutation specific prognosis and therapy
135
64 CONCLUSION
The main finding reported here is the low frequency of causative mutations
in the NPHS1 and NPHS2 genes in the Pakistani NS children These results
emphasize the need for discovery of other novel genes that may be involved in the
pathogenesis of SRNS in the South Asian region For this purpose genetic analysis
of large populations and the use of resequencing techniques will be required to find
other novel genesfactors in the pathogenesis of NS
The work presented here has important clinical relevance Genetic
screening should be done for every child upon disease presentation The
identification of a disease causing mutation would help in avoiding unnecessary
steroidimmunosuppressive drugs Mutation analysis may also encourage living
donor kidney for transplantation and offer prenatal diagnosis to families at risk
136
65 REFERENCES
Abid A Khaliq S Shahid S Lanewala A Mubarak M Hashmi S Kazi J Masood
T Hafeez F Naqvi SA Rizvi SA Mehdi SQ (2012) A spectrum of novel NPHS1
and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan
Gene 502 133-137
Benoit G Machuca E Heidet L Antignac C (2010) Hereditary kidney diseases
highlighting the importance of classical Mendelian phenotypes Ann NY Acad Sci
1214 83-98
Boyer O Benoit G Gribouval O Nevo F Pawtowski A Bilge I Bircan Z
Deschecircnes G Guay-Woodford LM Hall M Macher MA Soulami K Stefanidis
CJ Weiss R Loirat C Gubler MC Antignac C (2010) Mutational analysis of the
PLCE1 gene in steroid resistant nephrotic syndrome J Med Genet 47 445-452
Brown EJ Schlondorff JS Becker DJ Tsukaguchi H Uscinski AL Higgs HN
Henderson JM Pollak MR Tonna SJ (2010) Mutations in the formin gene INF2
cause focal segmental glomerulosclerosis Nature Genet 42 72-76 Note Erratum
Nature Genet 42 361
Buumlscher AK Kranz B Buumlscher R Hildebrandt F Dworniczak B Pennekamp P
Kuwertz-Broumlking E Wingen AM John U Kemper M Monnens L Hoyer PF
Weber S Konrad M (2010) Immunosuppression and renal outcome in congenital
and pediatric steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 5
2075-2084
Buumlscher AK Weber S (2012) Educational paper The podocytopathies Eur J
Pediatr Eur J Pediatr 171 1151-1160
Burrows JA Willis LK Perlmutter DH (2000) Chemical chaperones mediate
increased secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z A potential
pharmacological strategy for prevention of liver injury and emphysema in alpha 1-
AT deficiency Proc Natl Acad Sci USA 97 1796-1801
Caridi G Bertelli R Perfumo F Ghiggeri GM (2004) Heterozygous NPHS1 or
NPHS2 mutations in responsive nephrotic syndrome and the multifactorial origin of
proteinuria Kidney Int 66 1715-1716
Caridi G Perfumo F Ghiggeri GM (2005) NPHS2 (Podocin) mutations in
nephrotic syndrome Clinical spectrum and fine mechanisms Pediatr Res 57 54R-
61R
Ciaccio M Bellia C (2010) Hyperhomocysteinemia and cardiovascular risk
effect of vitamin supplementation in risk reduction Curr Clin Pharmacol 5 30-36
137
Copelovitch L Guttenberg M Pollak MR Kaplan BS (2007) Renin-angiotensin
axis blockade reduces proteinuria in presymptomatic patients with familial FSGS
Pediatr Nephrol 22 1779-1784
Faul C Donnelly M Merscher-Gomez S Chang YH Franz S Delfgaauw J
Chang JM Choi HY Campbell KN Kim K Reiser J Mundel P (2008) The actin
cytoskeleton of kidney podocytes is a direct target of the antiproteinuric effect of
cyclosporine A Nat Med 14 931-938
Hasselbacher K Wiggins R C Matejas V Hinkes B G Mucha B Hoskins B E
Ozaltin F Nurnberg G Becker C Hangan D Pohl M Kuwertz-Broking E Griebel
M Schumacher V Royer-Pokora B Bakkaloglu A Nurnberg P Zenker M
Hildebrandt F (2006) Recessive missense mutations in LAMB2 expand the clinical
spectrum of LAMB2-associated disorders Kidney Int 70 1008-1012
Hildebrandt F (2010) Genetic kidney diseases Lancet 375 1287-1295
Hinkes B Wiggins RC Gbadegesin R Vlangos CN Seelow D Nurnberg G Garg
P Verma R Chaib H Hoskins BE Ashraf S Becker C Hennies HC Goyal M
Wharram BL Schachter AD Mudumana S Drummond I Kerjaschki D Waldherr
R Dietrich A Ozaltin F Bakkaloglu A Cleper R Basel-Vanagaite L Pohl M
Griebel M Tsygin AN Soylu A Muller D Sorli CS Bunney TD Katan M Liu J
Attanasio M Orsquotoole JF Hasselbacher K Mucha B Otto EA Airik R Kispert A
Kelley GG Smrcka AV Gudermann T Holzman LB Nurnberg P Hildebrandt F
(2006) Positional cloning uncovers mutations in PLCE1 responsible for a
nephrotic syndrome variant that may be reversible Nat Genet 38 1397-1405
Hinkes BG Mucha B Vlangos CN Gbadegesin R Liu J Hasselbacher K Hangan
D Ozaltin F Zenker M Hildebrandt FArbeitsgemeinschaft fuumlr (2007)
Paediatrische Nephrologie Study Group Nephrotic syndrome in the first year of
life two thirds of cases are caused by mutations in 4 genes (NPHS1 NPHS2 WT1
and LAMB2) Pediatrics 119 e907-919
Jayapalan JJ Muniandy S Chan SP (2008) Angiotensin-1 converting enzyme
ID gene polymorphism Scenario in Malaysia Southeast Asian J Trop Med Public
Health 39 917-921
Jungraithmayr TC Hofer K Cochat P Chernin G Cortina G Fargue S Grimm
P Knueppel T Kowarsch A Neuhaus T Pagel P Pfeiffer KP Schaumlfer F
Schoumlnermarck U Seeman T Toenshoff B Weber S Winn MP Zschocke J
Zimmerhackl LB (2011) Screening for NPHS2 mutations may help predict FSGS
recurrence after transplantation J Am Soc Nephrol 22 579-585
Kniazewska MH Obuchowicz AK Wielkoszyński T Zmudzińska-Kitczak J
Urban K Marek M Witanowska J Sieroń-Stołtny K (2009) Atherosclerosis risk
factors in young patients formerly treated for idiopathic nephrotic syndrome
Pediatr Nephrol 24 549-554
138
Liebau MC Lang D Boumlhm J Endlich N Bek MJ Witherden I Mathieson PW
Saleem MA Pavenstaumldt H Fischer KG (2006) Functional expression of the renin-
angiotensin system in human podocytes Am J Physiol Renal Physiol 290 F710-
719
Machuca E Benoit G Antignac C (2009) Genetics of nephrotic syndrome
connecting molecular genetics to podocyte physiology Hum Mol Genet 18R2
R185-194
Mao J Zhang Y Du L Dai Y Gu W Liu A Shang S Liang L (2007) NPHS1
and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome
Pediatr Res 61 117-122
Mardis ER (2008) Next-generation DNA sequencing methods Annu Rev
Genomics Hum Genet 9 387-402
Patil SJ Gulati S Khan F Tripathi M Ahmed M Agrawal S (2005) Angiotensin
converting enzyme gene polymorphism in Indian children with steroid sensitive
nephrotic syndrome Indian J Med Sci 59 431-435
Patrakka J Ruotsalainen V Reponen P Qvist E Laine J Holmberg C
Tryggvason K Jalanko H (2002) Recurrence of nephrotic syndrome in kidney
grafts of patients with congenital nephrotic syndrome of the Finnish type role of
nephrin Transplantation 73 394-403
Plank C Kalb V Hinkes B Hildebrandt F Gefeller O Rascher W (2008)
Arbeitsgemeinschaft fuumlr Paumldiatrische Nephrologie Cyclosporin A is superior to
cyclophosphamide in children with steroid-resistant nephrotic syndrome-a
randomized controlled multicentre trial by the Arbeitsgemeinschaft fuumlr Paumldiatrische
Nephrologie Pediatr Nephrol 23 1483-1493
Ruf RG Lichtenberger A Karle SM Haas JP Anacleto FE Schultheiss M
Zalewski I Imm A Ruf EM Mucha B Bagga A Neuhaus T Fuchshuber A
Bakkaloglu A Hildebrandt F Arbeitsgemeinschaft Fuumlr (2004) Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of
nephrotic syndrome J Am Soc Nephrol 15 722-732
Sako M Nakanishi K Obana M Yata N Hoshii S Takahashi S Wada N
Takahashi Y Kaku Y Satomura K Ikeda M Honda M Iijima K Yoshikawa N
(2005) Analysis of NPHS1 NPHS2 ACTN4 and WT1 in Japanese patients with
congenital nephrotic syndrome Kidney Int 67 1248-1255
Santiacuten S Bullich G Tazoacuten-Vega B Garciacutea-Maset R Gimeacutenez I Silva I Ruiacutez P
Ballariacuten J Torra R Ars E (2011) Clinical utility of genetic testing in children and
adults with steroid-resistant nephrotic syndrome Clin J Am Soc Nephrol 6 1139-
1148
139
Shahid S Abid A Mehdi SQ Firasat S Lanewala A Naqvi SA Rizvi SA Khaliq
S (2012) Association of the ACE-II genotype with the risk of nephrotic syndrome
in Pakistani children Gene 493 165-168 Erratum in Gene 495 93
Sinha A Bagga A (2012) Nephrotic syndrome Indian J Pediatr 79 1045-1055
Sreedharan R Bockenhauer D (2005) Congenital nephrotic syndrome responsive
to angiotensin-converting enzyme inhibition Pediatr Nephrol 20 1340-1342
Tejani A Ingulli E (1995) Cyclosporin in steroid-resistant idiopathic nephrotic
syndrome Contrib Nephrol 114 73-77
Weber S Gribouval O Esquivel EL Moriniegravere V Tecircte MJ Legendre C Niaudet
P Antignac C (2004) NPHS2 mutation analysis shows genetic heterogeneity of
steroid-resistant nephrotic syndrome and low post-transplant recurrence Kidney
Int 66 571-579
Weins A Pollak MR Inherited Nephrosis In Molecular and genetic basis of renal
disease 1st Edition Mount DM Pollak MR Sundher Elsevier Philadelphia PA
2008 142-145
Woroniecki RP Kopp JB (2007) Genetics of focal segmental glomerulosclerosis
Pediatr Nephrol 22 638-644
Zou C Tsukahara H Hiraoka M Mizu J Todoroki Y Ohshima Y Kimura H
Tsuzuki K Mayumi M (2002) Methylenetetrahydrofolate reductase
polymorphism in childhood primary focal segmental glomerulosclerosis Nephron
92 449-451
![Page 10: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/10.jpg)
![Page 11: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/11.jpg)
![Page 12: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/12.jpg)
![Page 13: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/13.jpg)
![Page 14: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/14.jpg)
![Page 15: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/15.jpg)
![Page 16: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/16.jpg)
![Page 17: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/17.jpg)
![Page 18: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/18.jpg)
![Page 19: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/19.jpg)
![Page 20: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/20.jpg)
![Page 21: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/21.jpg)
![Page 22: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/22.jpg)
![Page 23: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/23.jpg)
![Page 24: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/24.jpg)
![Page 25: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/25.jpg)
![Page 26: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/26.jpg)
![Page 27: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/27.jpg)
![Page 28: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/28.jpg)
![Page 29: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/29.jpg)
![Page 30: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/30.jpg)
![Page 31: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/31.jpg)
![Page 32: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/32.jpg)
![Page 33: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/33.jpg)
![Page 34: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/34.jpg)
![Page 35: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/35.jpg)
![Page 36: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/36.jpg)
![Page 37: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/37.jpg)
![Page 38: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/38.jpg)
![Page 39: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/39.jpg)
![Page 40: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/40.jpg)
![Page 41: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/41.jpg)
![Page 42: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/42.jpg)
![Page 43: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/43.jpg)
![Page 44: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/44.jpg)
![Page 45: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/45.jpg)
![Page 46: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/46.jpg)
![Page 47: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/47.jpg)
![Page 48: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/48.jpg)
![Page 49: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/49.jpg)
![Page 50: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/50.jpg)
![Page 51: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/51.jpg)
![Page 52: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/52.jpg)
![Page 53: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/53.jpg)
![Page 54: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/54.jpg)
![Page 55: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/55.jpg)
![Page 56: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/56.jpg)
![Page 57: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/57.jpg)
![Page 58: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/58.jpg)
![Page 59: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/59.jpg)
![Page 60: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/60.jpg)
![Page 61: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/61.jpg)
![Page 62: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/62.jpg)
![Page 63: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/63.jpg)
![Page 64: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/64.jpg)
![Page 65: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/65.jpg)
![Page 66: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/66.jpg)
![Page 67: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/67.jpg)
![Page 68: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/68.jpg)
![Page 69: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/69.jpg)
![Page 70: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/70.jpg)
![Page 71: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/71.jpg)
![Page 72: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/72.jpg)
![Page 73: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/73.jpg)
![Page 74: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/74.jpg)
![Page 75: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/75.jpg)
![Page 76: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/76.jpg)
![Page 77: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/77.jpg)
![Page 78: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/78.jpg)
![Page 79: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/79.jpg)
![Page 80: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/80.jpg)
![Page 81: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/81.jpg)
![Page 82: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/82.jpg)
![Page 83: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/83.jpg)
![Page 84: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/84.jpg)
![Page 85: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/85.jpg)
![Page 86: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/86.jpg)
![Page 87: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/87.jpg)
![Page 88: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/88.jpg)
![Page 89: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/89.jpg)
![Page 90: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/90.jpg)
![Page 91: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/91.jpg)
![Page 92: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/92.jpg)
![Page 93: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/93.jpg)
![Page 94: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/94.jpg)
![Page 95: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/95.jpg)
![Page 96: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/96.jpg)
![Page 97: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/97.jpg)
![Page 98: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/98.jpg)
![Page 99: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/99.jpg)
![Page 100: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/100.jpg)
![Page 101: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/101.jpg)
![Page 102: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/102.jpg)
![Page 103: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/103.jpg)
![Page 104: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/104.jpg)
![Page 105: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/105.jpg)
![Page 106: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/106.jpg)
![Page 107: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/107.jpg)
![Page 108: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/108.jpg)
![Page 109: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/109.jpg)
![Page 110: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/110.jpg)
![Page 111: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/111.jpg)
![Page 112: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/112.jpg)
![Page 113: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/113.jpg)
![Page 114: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/114.jpg)
![Page 115: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/115.jpg)
![Page 116: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/116.jpg)
![Page 117: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/117.jpg)
![Page 118: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/118.jpg)
![Page 119: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/119.jpg)
![Page 120: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/120.jpg)
![Page 121: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/121.jpg)
![Page 122: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/122.jpg)
![Page 123: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/123.jpg)
![Page 124: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/124.jpg)
![Page 125: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/125.jpg)
![Page 126: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/126.jpg)
![Page 127: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/127.jpg)
![Page 128: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/128.jpg)
![Page 129: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/129.jpg)
![Page 130: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/130.jpg)
![Page 131: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/131.jpg)
![Page 132: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/132.jpg)
![Page 133: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/133.jpg)
![Page 134: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/134.jpg)
![Page 135: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/135.jpg)
![Page 136: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/136.jpg)
![Page 137: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/137.jpg)
![Page 138: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/138.jpg)
![Page 139: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/139.jpg)
![Page 140: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/140.jpg)
![Page 141: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/141.jpg)
![Page 142: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/142.jpg)
![Page 143: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/143.jpg)
![Page 144: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/144.jpg)
![Page 145: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/145.jpg)
![Page 146: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/146.jpg)
![Page 147: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/147.jpg)
![Page 148: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/148.jpg)
![Page 149: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/149.jpg)
![Page 150: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/150.jpg)
![Page 151: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/151.jpg)
![Page 152: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/152.jpg)
![Page 153: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/153.jpg)
![Page 154: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/154.jpg)
![Page 155: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/155.jpg)
![Page 156: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/156.jpg)
![Page 157: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/157.jpg)
![Page 158: THE GENETICS OF NEPHROTIC SYNDROME IN PAKISTANI …prr.hec.gov.pk/jspui/bitstream/123456789/2321/1/2536S.pdf · Nephrotic syndrome caused by other genetic factors 31 1.5.1. Angiotensin](https://reader033.fdocuments.us/reader033/viewer/2022060720/6080dde36bc92749a60b2d56/html5/thumbnails/158.jpg)