The Effects of EPA and DHA on the UterineInflammatory Response in Mares during

In Vitro Culture of Endometrial Tissue

Item Type Electronic Dissertation; text

Authors Penrod, Leah Vee

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this materialis made possible by the University Libraries, University of Arizona.Further transmission, reproduction or presentation (such aspublic display or performance) of protected items is prohibitedexcept with permission of the author.

Download date 17/05/2018 14:16:38

Link to Item http://hdl.handle.net/10150/145149

1

THE EFFECTS OF EPA AND DHA ON THE UTERINE INFLAMMATORY

RESPONSE IN MARES DURING IN VITRO CULTURE OF ENDOMETRIAL TISSUE

by

Leah Vee Penrod

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF ANIMAL SCIENCES

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2011

2

THE UNIVERSITY OF ARIZONA

GRADUATE COLLEGE

As member of the Final Committee, we certify that we have read the dissertation

prepared by Leah Vee Penrod____________________________________________

entitled The effects of EPA and DHA on the uterine inflammatory response in mares

during in vitro culture of endometrial tissue__________________________________

and recommend that it be accepted as fulfilling the dissertation requirement for

Degree of Doctor of Philosophy___________________________________________

_____Dr. Mark J Arns_____________________Date: 4/15/2011

Mark J. Arns

_____Dr. Sean W Limesand________________Date: 4/15/2011

Sean W. Limesand

_____Dr. Ron E Allen_____________________Date: 4/15/2011

Ron E. Allen

_____Dr. Michelle L Rhoads___ _________ Date: 4/15/2011

Michelle L. Rhoads

_____Dr. Peder S Cuneo___________________Date: 4/15/2011

Peder S. Cuneo

Final approval and acceptance of this dissertation is contingent upon the candidate’s

submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and

recommend that it be accepted as fulfilling the dissertation requirement.

____Dr. Mark J Arns_______________________Date: 4/29/2011

Dissertation Director: Mark J Arns

3

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an

advanced degree at The University of Arizona and is deposited in the University Library

to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided

that accurate acknowledgement of source is made. Requests for permission for extended

quotation from or reproduction of this manuscript in whole or in part may be granted by

the head of the major department or the Dean of the Graduate College when in his or her

judgment the proposed use of the material is in the interests of scholarships. In all other

instances, however, permission must be obtained from the author.

SIGNED: Leah Vee Penrod

4

ACKNOWLEDGEMENTS

First, I would like to thank my mentor and advisor, Dr, Mark Arns for his support

and guidance through both my Master’s and Doctorate. You have contributed to the

person I am today through your guidance and exceptional example. You set the bar high

for me and expected more from me than I have of myself. I appreciate your confidence in

me to complete this endeavor, without you it would not have been possible. Thank you

for sharing your wealth of knowledge with me. I am grateful for everything you have

done for me.

Secondly, I would like to thank Dr. Sean Limesand for his help and guidance with

making my research ideas and goals possible. Thank you for sharing your expertise and

knowledge as well as the major contribution you have made to my graduate career. You

also set the standards high for me and guided me to success. I am grateful for you

guidance, support, and encouragement throughout my Doctorate.

Thirdly, I would like to extend a thank you to my committee Dr. Ron Allen, Dr.

Michelle Rhoads, and Dr. Peder Cuneo. Each of you contributed a great depth of

knowledge and expertise to my research and graduate experience. Thank you for your

guidance and contribution to my studies and graduate career.

Fourth, to my friends, fellow graduate students, and undergraduate students. I am

grateful for your help and support through this project. I could not have survived graduate

school without you.

Fifth, I would like to thank my mother, Lori, father, Greg, and sister, Ashley, as

well as my boyfriend, Zane. I would like to express my sincere gratitude for your support,

guidance, and encouragement. You always believed in me and provided me with the

opportunities to achieve my goals and dreams. Without your love and support, none of

this would have been possible. I am grateful to have such a wonderful family.

Lastly, I would like to thank Cooper and Bandit for always listening and

providing my with my stress-relieving walk every night.

5

TABLE OF CONTENTS

LIST OF FIGURES………………………………………………………………….........8

LIST OF TABLES……………………………………………………………………….10

ABSTRACT……………………………………………………………………………...11

CHAPTER 1: LITERATURE REVIEW………………………………………………...13

Introduction……...……………………………………………………………………13

The Inflammatory Response………….………………………………………………15

Endometritis and early embryonic loss…………………………………………..15

Spermatozoa and seminal plasma effects………………………………………..18

Mares susceptible and resistant to endometritis………………………………….18

Summary…………………………………………………………………………19

Prostaglandins………………………………………………………………………...21

Prostaglandin production by cell type……………………………………………26

Steroid hormones and prostaglandins……………………………….……………27

Prostaglandin and enzyme expression…………………………………………...28

Interleukin effects on enzyme expression………………………………………..31

Oxytocin effects on enzyme expression…………………………………………31

Oxytocin…..…………………………………………………………………………..33

Oxytocin stimulated prostaglandin release………………………………………34

Oxytocin receptor antagonist…………………………………………………….38

Lipopolysaccharide……….…………………………………………………………..40

Toll-like receptors………………………………………………………………..40

LPS and prostaglandin secretion…………………………………………………41

Dietary Influences on the Inflammatory Response…………………...………………43

Polyunsaturated fatty acids………………………………………………………43

Fatty acid uptake…………………………………………………………………44

Omega-3 fatty acids and equine………………………………………………….45

Omega-3 fatty acids and female reproduction…………………………………...47

Omega-3 fatty acids and prostaglandins…………………………………………49

Omega-3 fatty acids and prostaglandin synthesis………………………………..51

Modulation of prostaglandin synthesis…………………………………………..53

Summary….…………………………………………………………………………...54

CHAPTER 2: ESTABLISHMENT AND CHARACTERIZATION OF EQUINE

ENDOMETRIAL CELL CULTURES AND OXYTOCIN STIMULATED

PRODUCTION OF PGF2α………………………………………………………………55

Abstract…...…………………………………………………………………………..55

Introduction……...……………………………………………………………………57

Materials and Methods………….…………………………………………………….59

Materials…………………………………………………………………………59

Animals…………………………………………………………………………..59

6

TABLE OF CONTENTS- continued

Experiment I……………………………………………………………………...59

Endometrial cell proliferation……………………………………………………61

Immunofluorescent staining……………………………………………………...62

Experiment II…………………………………………………………………….63

Statistical analysis………………………………………………………………..64

Results…..…………………………………………………………………………….65

Endometrial cell proliferation and characterization……………………………...65

Experiment I……………………………………………………………………...65

Experiment II…………………………………………………………………….65

Discussion…..………………………………………………………………………...66

CHAPTER 3: OXYTOCIN STIMULATED RELEASE OF PGF2α AND INHIBITION

OF PGF2α RELEASE BY A CYCLOOXYGENASE INHIBITOR, INDOMETHACIN,

AND AN OXYTOCIN RECEPTOR ANTAGONIST, ATOSIBAN, FROM EQUINE

ENDOMETRIAL CULTURES………………………………………………………….79

Abstract…...…………………………………………………………………………..79

Introduction……...……………………………………………………………………81

Materials and Methods………………………………………………………………..84

Materials…………………………………………………………………………84

Animals…………………………………………………………………………..84

Oxytocin dose response………………………………………………………….84

Uterine endometrial explant culture response to oxytocin………………………85

Uterine endometrial explant cultures in the presence of inhibitors……………...86

Enzyme immunoassay…………………………………………………………...87

Statistical analysis………………………………………………………………..87

Results…..…………………………………………………………………………….88

Oxytocin dose response………………………………………………………….88

Oxytocin stimulated PGF2α production over time……………………………….88

Inhibition of PGF2α release in endometrial explants…………………………….88

Discussion…..………………………………………………………………………...89

CHAPTER 4: EFFECTS OF OXYTOCIN, LPS, AND POLYUNSATURATED FATTY

ACIDS ON PROSTAGLANDIN SECRETION AND GENE EXPRESSION IN EQUINE

ENDOMETRIAL EXPLANT CULTURES……………………………………………..94

Abstract……...………………………………………………………………………..94

Introduction……...……………………………………………………………………96

Materials and Methods………………………………………………………………..97

Materials…………………………………………………………………………97

Animals…………………………………………………………………………..97

Fatty acid preparation……………………………………………………………97

Experiment I: fatty acid uptake…………………………………………………..98

Experiment II: effect of PUFAs on PG release and gene expression……………99

7

TABLE OF CONTENTS- continued

RNA extraction and quantitative real-time PCR (qPCR)………………………..99

Statistical analysis………………………………………………………………100

Results…..………………………………...…………………………………………101

Experiment I…………………………………………………………………….101

Experiment II…………………………………………………………………...101

qPCR…………………………………………………………………………....101

Discussion…...………………………………………………………………………103

REFERENCES…………………………………………………………………………112

8

LIST OF FIGURES

FIGURE 1.1 Prostaglandin Biosynthesis………………………………………………...23

FIGURE 1.2 Synthesis of 1-, 2-, and 3-series prostaglandins from dietary polyunsaturated

fatty acids through desaturation and chain elongation. (Wathes et al., 2007)…………...44

FIGURE 1.3 Three step method for absorption and transportation of long-chain fatty

acids across the cell membrane (Hamilton et al., 2002)…………………………………45

FIGURE 2.1 Equine endometrial tissue sections stained with a) DAPI (blue stained cells)

at 10x b) tissue section with both DAPI and Cytokeratin (green stained cells) at 10x

magnification and c) tissue section stained with both DAPI and Cytokeratin at 20x

magnification…………………………………………………………………………….71

FIGURE 2.2 Equine endometrial cell cultures following 6 days incubation that have been

stained with a) DAPI (blue stained cells) b) epithelial cell staining with primary

antiserum Cytokeratin (green stained cells) and c) cells that are both stained with DAPI

and Cytokeratin…………………………………………………………………………..72

FIGURE 2.3 Equine endometrial cell cultures following 24 h incubation with BrdU

(brown stained cells) and epithelial cell staining with primary antiserum Cytokeratin

(pink stained cells) at a) 4 days, b) 5 days, and c) 7 days in culture. Cells that are both

stained with BrdU and Cytokeratin are replicated epithelial cells.....................................73

FIGURE 2.4 Prostaglandin F2α (PGF2α) concentrations (mean + s.e.m) at 6 and 24 hours

in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for equine

endometrial cell cultures……………………………..…………………………………..74

FIGURE 2.5 Prostaglandin F2α metabolite (PGFM) concentrations (mean + s.e.m) at 6

and 24 hours in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin

for equine endometrial cell cultures……………………………………………………...75

FIGURE 2.6 Prostaglandin F2α (PGF2α) concentrations at 6 hours for equine endometrial

cell cultures grown with or without a basement membrane matrix and without (“0%”) or

with (“10%”) additional horse serum added to the culture media. Endometrial cell

cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin…...76

FIGURE 2.7 Prostaglandin F2α (PGF2α) concentrations at 24 hours for equine

endometrial cell cultures grown with or without a basement membrane matrix and

without (“0%”) or with (“10%”) additional horse serum added to the culture media.

Endometrial cell cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”)

of oxytocin……………………………………………………………………………….77

9

LIST OF FIGURES- continued

FIGURE 3.1 Prostaglandin F2α concentrations (PGF2α) (+ s.e.m) in equine endometrial

explant cultures after 24 h in the absence or presence of increasing concentrations of

oxytocin……………………………………………………………………………….….91

FIGURE 3.2 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant

cultures during 24 h of culture in the absence (-Oxy) or presence (+Oxy) of oxytocin…92

FIGURE 3.3 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant

cultures in response to oxytocin after 6 h of culture with increasing concentrations of

Indomethacin or Atosiban………………………………………………………………..93

FIGURE 4.1 Proportion of a) AA, b) EPA, and c) DHA content within equine

endometrial explants when cultured with 100 µM AA, 100 µM EPA, 100 µM DHA, or

50 µM EPA + 50 µM DHA for 24 h. Endometrial explants incorporated EPA and DHA

and tended to incorporate AA. …………………………………………………………109

FIGURE 4.2 Effects of a) stimulant and b) fatty acid treatment on PGF2α secretion in

equine endometrial explants cultured for 6 h in the presence of no stimulus (control),

LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed

using logarithmic 10 for statistical analysis; data presented is non-transformed means ±

s.e.m.…………………………………………………………………………………....110

FIGURE 4.2 Effects of a) stimulant and b) fatty acid treatment on PGE2 secretion in

equine endometrial explants cultured for 6 h in the presence of no stimulus (control),

LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed

using logarithmic 10 for statistical analysis; data presented is non-transformed means ±

s.e.m…………………………………………………………………………………….111

10

LIST OF TABLES

TABLE 2.1 Epithelial and total cell number within each culture condition system…….78

TABLE 4.1 Equine oligonucleotide primers used in this study………………………..107

TABLE 4.2 Gene expression in equine endometrial explants cultured with PUFAs for 24

h and stimulated with oxytocin or LPS for 6 h. Quantitative PCR was performed (n =7

except Cox-1, where n=4)…………………………..…………………………………..108

11

ABSTRACT

Uterine inflammation is one of the causes of a poor uterine environment. This can

result in early embryonic loss in the mare due to an inhibition of or an increased secretion

of prostaglandin F2α (PGF2α). Oxytocin binds to endometrial cell receptors to activate

prostaglandin synthesis. Increased secretion or accumulation of PGF2α within the uterus

due to uterine inflammation can cause luteolysis and result in early embryonic loss.

Supplementation with polyunsaturated fatty acids (PUFAs) has been shown to influence

prostaglandin production in many species, although the effects on the mare remain

unknown. Equine endometrial biopsies were collected and used to establish endometrial

epithelial cell and explant cultures to determine the release of PGF2α and PGFM in

response to oxytocin stimulation. Endometrial explant cultures were used to determine

the inhibitory effects of Atosiban, an oxytocin receptor antagonist, and Indomethacin, a

cyclooxygenase-2 inhibitor, on PGF2α secretion. Endometrial explant cultures were

challenged with oxytocin (250 nM) and PGF2α concentrations were measured over time.

The effects of PUFAs on equine endometrial prostaglandin production were determined

using endometrial biopsies harvested on day two of behavioral estrus. Equine endometrial

cells were established and shown to replicate in culture and on a basement membrane

matrix. Equine endometrial explants stimulated with oxytocin had increased secretion of

PGF2α and PGE2 and the secretion of PGF2α was inhibited through an oxytocin receptor

antagonist and Cox inhibition. Endometrial explants stimulated with lipopolysaccharide

had increased secretion of PGF2α and PGE2, however oxytocin stimulated to a greater

extent than LPS. Supplementation with PUFAs, specifically DHA, decreased the

12

secretion of PGF2α and PGE2, however AA and EPA failed to influence this response.

Expression of mRNA was not influenced by fatty acid supplementation, however was

altered by stimulus. Therefore DHA influences the inflammatory response in vitro

through mechanisms other than enzyme expression. Decreased PGF2α production

associated with PUFA supplementation in vitro, creates a likely approach for decreasing

early embryonic loss associated with post breeding inflammation commonly seen in the

equine industry.

13

CHAPTER 1

LITERATURE REVIEW

Introduction

Uterine infection, inflammation, and early embryonic loss are major

factors contributing to low pregnancy rates in the equine industry. Early embryonic loss

is also a major problem in the cattle industry. Every year 4.71 million calves are lost to

poor reproductive efficiency in the United States (Roesler, 2007). In aged mares, early

embryonic loss occurring before day 14 post ovulation can be as high as 70% (Ball et al.,

1986). Dietary supplementation with omega-3 fatty acids has been found to lower the

incidence of early embryonic loss in cattle. The effects of omega-3 fatty acid

supplementation on uterine function in the mare have not yet been determined. Potential

benefits of omega-3 fatty acid supplementation, especially for older mares or mares with

poor reproductive tract physiology, include increased pregnancy rates, decreased early

embryonic losses, and increased pre-ovulatory follicular size. If benefits are found from

omega-3 fatty acid supplementation, the equine breeding industry would profit from

increased reproductive efficiency and decreased economic losses associated with early

embryonic demise. Proven fertility benefits with dietary supplementation of

polyunsaturated fatty acids (PUFAs) have been found in the cow, ewe, rat, and human.

Dietary supplementation with omega-3 fatty acids in the mare and influences on

reproductive function and inflammation has not been described in the literature.

However, a potential role for omega-3 fatty acids in female reproductive function has

been documented in a number of mammalian species. This review will describe the

14

uterine inflammatory response and the potential to utilize dietary supplementation of

omega-3 fatty acids to enhance reproductive function in the mare.

15

The Inflammatory Response

Endometritis and early embryonic loss

Persistent endometritis causes decreased conception rates in the brood mare and is

considered one of the top three clinical problems facing the equine industry (Troedsson,

1999). Endometritis that persists following mating affects 15% of mares and reduces

fertility (Rigby et al., 2001). In the normal mare, physical barriers protect the

reproductive tract from external contamination. If these barriers become compromised,

the mare is susceptible to uterine infection. Breeding, regardless of whether it is natural

service or by artificial insemination, also causes an inflammatory response, which can

lead to uterine infections in some mares.

In the mare, early embryonic loss is the failure to retain pregnancy between

fertilization and day 40 of gestation (Vanderwall, 2008). In a review by Vanderwall

(2008), early embryonic loss incidence in the equine industry ranged from 2.6% to

30.0%, with the highest early embryonic loss of 20.0% to 30.0% occurring in mares

eighteen years of age or older. Early embryonic loss between fertilization and day 14 is

much higher for aged mares (60% to 70%) as compared to young mares (<10%) (Ball et

al., 1986 and 1989). Costs associated with additional breeding of the mare and decreases

in foaling rates due to early embryonic loss create an economic loss for the equine

industry; therefore if dietary supplementation with PUFAs proves beneficial in the mare,

the equine industry could profit greatly from these affects.

Inflammation associated with persistent endometritis typically causes an increase

in PGF2α secretion and frequently results in premature luteolysis and early embryonic

16

loss (Neely et al., 1979). Early embryonic loss can result from an increase in

prostaglandin F2α secretion during early pregnancy (Mattos et al., 2003). When

inflammation persists after fertilization, bacteria, fluid, and inflammatory products can

create a hostile environment, which is unsuitable for survival of the conceptus (Smith et

al., 1971). Foreign material, bacteria, spermatozoa, and seminal components trigger an

inflammatory response in the uterus of the mare. Lehrer and colleagues (1988)

discovered that inflamed areas are first invaded by the inflammatory cells,

polymorphonuclear neutrophils (PMNs). An influx of PMNs into the uterine lumen is the

first indication of an inflammatory response and occurs within 30 minutes following

breeding or insemination (Troedsson et al., 2001; Katila, 1995). Rapid migration of

PMNs into the uterine lumen is thought to be mediated by chemoattractive properties of

uterine fluid, in which PMN-chemotactic mediators are quickly released from the uterus

in response to foreign material (Pycock and Allen, 1988). Phagocytosis and opsonization

of foreign material also occurs through complement proteins. Complement protein 3 (C3)

is the most abundant of all complement proteins found in the body (Sompayrac, 2008)

and the presence of C3 and complement cleavage factors have been shown in the equine

reproductive tract (Watson et al., 1987; Troedsson et al., 1993). The complement cascade

serves as part of the innate immune response to defend against foreign material and

bacteria by increasing vascular permeability, chemotaxis, lysing of bacteria through the

membrane attack complex, and opsonization of bacteria (Troedsson, 1999; Sompayrac,

2008). Activation of the complement cascade by equine spermatozoa is thought to induce

PMN chemotaxis (Troedsson, 1995). The protein C3 is cleaved in the body into reactive

17

protein fragments, one of which is C3b (Sompayrac, 2008), where along with

immunoglobulins (IgG and IgA), serve as opsonins for PMNs (Troedsson et al., 1993).

Arachidonic acid metabolites, leukotriene B4 (LTB4), prostaglandin E2 (PGE2), and

PGF2α, are important inflammatory mediators in the mare and are believed to serve as

chemoattractants for PMNs (Troedsson, 1999; Watson et al., 1988; Pycock and Allen,

1988). Leukotriene B4 is produced from leukocytes and stimulates the activation and

adhesion of leukocytes to the endothelium, which along with PGE2 enhances plasma

leakage (Watson et al., 1988). Cytokines released from lymphocytes and macrophages

during inflammation trigger various cascades of inflammatory mediators. Interleukin 1

(IL-1) stimulates the production of prostaglandins by increasing synthesis of

cyclooxygenase 2 (Cox-2) and inducing expression of terminal enzymes, such as

prostaglandin synthases E and F (PGES, PGFS). Interleukin 1 decreases 15-hydroxy-

prostaglandin dehydrogenase (PGDH), which is responsible for the conversion of PGF2α

into its metabolite. Phagocytosis of the foreign material in the uterus will also cause the

release of PGF2α. This release causes myometrium contractions, which aid in the

expulsion of dead spermatozoa and contaminating material from the uterus.

In the healthy mare, post-breeding inflammation is cleared within twenty-four

hours (Katila, 1995). Prostaglandin levels and inflammatory products decrease once the

inflammation is cleared. Although in older and susceptible mares the inflammation

persists due to fluid accumulation that cannot effectively be dispelled, which can

decrease conception in these mares. Early embryonic loss in the equine can be

contributed to a number of factors, including poor uterine environment. Uterine infection

18

and inflammation are likely the primary causes of creating a poor uterine environment

(Adams et al., 1987; Dimock and Edwards, 1928; Saltiel et al., 1986).

Spermatozoa and seminal plasma effects

Seminal plasma has been shown to suppress chemotaxis and migration of PMNs

in vitro, as well as have an immunosuppressive effect on various parts of the immune

system in different species (Troedsson, 1995; Fahmi et al., 1985). Seminal plasma is

therefore believed to modulate uterine inflammation, allowing spermatozoa to travel

through the uterus to the oviducts. Troedsson and colleagues (2002) demonstrated the

inflammatory reaction was of shorter duration when seminal plasma was included in the

inseminate, likely due to an altered inflammatory response, however the mechanism is

not clear. Typically there is an enhanced uterine inflammatory response in mares bred

with frozen/thawed semen, possibly due to removal of seminal plasma (Troedsson, 1995).

Seminal plasma also may provide protection to the spermatozoa against phagocytosis and

inflammatory factors. When spermatozoa are introduced into an inflammatory

environment, they bind to PMNs and form large clusters, decreasing motion and

mobility. Troedsson and researchers (2002) have shown support for the protective role of

seminal plasma in vitro and in vivo, by decreasing the binding between spermatozoa and

inflammatory cells.

Mares susceptible and resistant to endometritis

Mares with delayed uterine clearance following breeding can incur persistent

endometritis that can result in reduced fertility. During pregnancy, repeated and

prolonged stretching of the uterus occurs and can result in reproductive structural changes

19

that could increase the intensity and duration of an inflammatory response within the

uterine lumen. It has also been suggested that mares susceptible to uterine infections have

depressed immune responses, impaired or deficient PMNs, and/or opsonin (complement

cleavage factor and immunoglobulins) dysfunction (Watson et al., 1987; Troedsson et al.,

1993). Watson and colleagues (1987) demonstrated inhibited migration of blood

neutrophils and decreased phagocytic capabilities of uterine neutrophils from susceptible

mares as compared to resistant mares. Uterine secretions from susceptible mares also

showed a decrease in the ability of neutrophils to promote bactericidal activity, not

related to a deficiency in complement activity. Troedsson and colleagues (1993) found

susceptible mares showed a constant decline in IgG and C3 concentrations at 36 hours

compared to resistant mares, which demonstrated an increase in opsonin concentrations.

Concentrations were similar during the first 24 hours following infection, therefore an

immunoglobulin deficiency is not likely the cause of persistent uterine infections in

susceptible mares. Rigby et al. (2001) found an intrinsic contractile defect of the

myometrium in mares with delayed uterine clearance, suggesting it might contribute to

reduced uterine contractility and lead to a uterine infection in susceptible mares.

Summary

The inflammatory response in healthy mares consists of an influx of PMNs,

opsonization and phagocytosis of foreign material, and the clearance of fluid and

contaminating material within an appropriate time period. This inflammatory response

can be influenced by the removal or addition of seminal plasma to the inseminate. Mares

prone to infection or persistent endometritis are at increased risk of early embryonic loss,

20

possibly due to compromised external genitalia, impaired or deficient PMNs and

immunoglobulins, opsonin dysfunction, and/or a myometrial defect. Regardless of cause,

prolonged uterine inflammation can increase secretion of PGF2α and create an unsuitable

environment for the embryo, decreasing fertility in the susceptible mare.

21

Prostaglandins

Prostaglandin secretion and synthesis involves an intracellular cascade of actions.

The arachidonate cascade has three major pathways, including cyclooxygenase,

lipoxygenase (iron containing enzyme that catalyses the dioxygenation of PUFAs in

lipids), and epoxygenase (an enzyme that produces signaling enzymes involved in cell

proliferation) (Smith et al., 1991). The cyclooxygenase pathway includes the formation of

prostaglandins, leukotrienes, and thromboxanes from arachidonic acid in three phases.

The first phase is the mobilization of arachidonic acid: Arachidonic acid is cleaved from

the sn-2 position of the membrane phospholipids through the activation of phospholipase

C (PLC) or A2 (PLA2) (Smith et al., 1991). Arachidonic acid is converted into

prostaglandin G2 (PGG2) via prostaglandin endoperoxide H synthase-1 or -2 (also known

as Cyclooxygenase and PTGS). Prostaglandin G2 is further converted into prostaglandin

H2 (PGH2) by cyclooxygenase-1 or-2 (Cox-1 and Cox-2). The rate limiting step in the

production of prostaglandins occurs during the conversion of arachidonic acid into PGH2.

Cyclooxygenases-1 and -2 are considered to be the rate limiting enzymes in production of

endometrial prostaglandins (Arosh et al., 2002), as they convert arachidonic acid into

PGH2. Cyclooxygenase-1 is expressed in various cell types and it appears that acute

stimuli do not regulate the expression or release of Cox-1 (Burns et al., 1997); whereas

Cox-2 is inducible, expressed in fewer tissue types, and is acutely regulated.

Cyclooxygenase-2 can be regulated by acute stimuli, including hormones and growth

factors, during the synthesis of prostaglandins (Burns et al., 1997) and is likely

responsible for the main production of prostaglandins during an inflammatory response

22

because of its inducible capabilities (Crofford, 1997). It also appears Cox-2 is the

predominant form expressed in ovine and bovine endometrium throughout the estrous

cycle (Burns et al., 1997; Arosh et al., 2002). The conversion of PGH2 into PGF2α occurs

through a reduction via PGFS, and PGE2, PGI2, and PGD2 through isomerization via

PGES, PGIS, and PGDS, respectively (Smith, 1992). There are three isozymes of PGES,

two microsomal (PGES-1 and PGES-2) and one cytosolic (PGES-3). Prostaglandins F2α

and E2 are both produced in the endometrium and myometrium of uteri of various

animals. Prostaglandin F2α plays a vital role in luteolysis and is secreted from the

endometrium in pulses in response to endogenous oxytocin. Luteolysis or pregnancy

recognition occurs on days 15-17 of the bovine estrous cycle (Arosh et al., 2002) and on

day 14 of the equine estrous cycle. In the bovine, PGF2α secretion is inhibited by

interferon τ and prevents luteolysis during early pregnancy. PGE2 is believed to also be

involved in maternal recognition in ruminants by acting as a temporary luteotrophic

signal or having antiluteolytic actions (Pratt et al., 1977; Asselin et al., 1997).

23

Figure 1.1 Prostaglandin Biosynthesis.

The hormone-like chemicals, prostaglandins, are produced on demand and there is

no storage of them within the body; therefore the half life of prostaglandins is very short.

Prostaglandin F2α is quickly degraded in vivo to a more stable, biologically inactive

metabolite 13, 14-dihydro-15-keto PGF2α (PGFM) by 15-hydroxy-prostaglandin

dehydrogenase (PGDH). This enzyme is found in high levels in lung, liver, and placenta

tissues (Farina et al., 2004). Due to the short half-life of prostaglandins, they send signals

Cell membrane phospholipids

Phospholipase A2

Arachidonic Acid

Cyclooxygenase-1 (Cox-1)

Cyclooxygenase-2 (Cox-2)

PGG2

Cyclooxygenase-1 (Cox-1)

Cyclooxygenase-2 (Cox-2)

PGH2

PG synthases

PGF2α PGE2 PGD2 PGI2 PGE2 9-ketoreductase

PGD2 11-ketoreductase

24

in a paracrine (locally within the reproductive tract) or an autocrine (acting within the

same cell in the endometrium) fashion.

Prostaglandins control and influence many processes throughout the body,

including regulation of blood pressure and clotting, sleep, labor, and inflammatory

processes (Mitchell et al., 1992). In reproduction, prostaglandins have three main

functions, including causing ovulation, luteal maintenance and regression. When PGF2α

is given by subcutaneous, intramuscular, or intrauterine routes, it has been shown to

cause luteolysis in the mare (Allen and Rowson, 1973). Endogenous prostaglandin

release can be stimulated by the hormone oxytocin. Oxytocin is released from the

posterior pituitary gland and travels to the uterus where it binds to a G coupled protein

receptor to stimulate PGF2α release (Gimpl and Fahrenholz, 2001). Oxytocin is released

in pulses, causing the uterus to respond with pulsatile PGF2α release. Prostaglandin F2α,

in return, stimulates the release of oxytocin from luteal cells on the corpus luteum in

ruminants (McCracken et al., 1999). Prostaglandin receptors have been found on the

plasma membrane of granulosa derived luteal cells in many species (McCracken et al.,

1999). In contrast in non-ruminants, PGF2α secretion from the uterine endometrium is

stimulated by oxytocin, but it is believed there is no additional PGF2α release from luteal

cells’ release of oxytocin. Oxytocin and PGF2α create a positive feedback loop that is

believed to be necessary for luteolysis (Silvia et al., 1991). This feedback mechanism

stimulates greater secretion of PGF2α from the uterus that may be required for regression

of the corpus luteum. High concentrations and prolonged exposure to oxytocin and

PGF2α can create desensitization of uterine and luteal tissues to further stimulation for

25

approximately 6-8 hours (Silvia et al., 1991). Therefore, this refractoriness of the tissue to

oxytocin and PGF2α is believed to help establish the pulsatile release of PGF2α needed

for luteolysis.

Endocrine regulation of uterine PGF2α production and secretion has not been

determined in the mare, although it has been shown PGF2α release from the endometrium

results in luteolysis (Irvine, 1995). In 1985, Betteridge and colleagues demonstrated the

administration of oxytocin to mares in late diestrus caused an increase in peripheral 13,

14-dihydro-15-keto PGF2α (PGFM) plasma concentrations, suggesting oxytocin’s role in

luteolysis. Exogenous administration of oxytocin has been shown to stimulate PGF2α

release from the endometrium and cause luteolysis (Goff et al., 1987). Moreover, the

secretion of uterine endometrial PGF2α in response to oxytocin administration has been

shown to be dependent on stage of estrous (Sharp et al., 1997). Similarly, oxytocin

stimulated equine endometrial explants demonstrated variable response during culture

with maximal release on day 14 post ovulation (King and Evans, 1987). Furthermore,

porcine endometrial cell cultures showed variable prostaglandin release with lowest

production on days 6-8 (Blitek and Ziecik, 2004). In contrast, PGF2α production from

equine endometrial epithelial and stromal cell cultures was not affected by day of cycle

(Watson et al., 1992). However, most research demonstrates low secretion of PGF2α

during estrus, with increasing concentrations during diestrus and maximal secretion

around luteolysis (Vernon et al., 1981; King and Evans, 1987). Therefore, oxytocin

stimulated PGF2α production should be possible from equine endometrial cultures

throughout the estrous cycle.

26

Prostaglandin production by cell type

Prostaglandin production in response to oxytocin stimulation has been previously

evaluated in equine endometrial explant and cell cultures (King and Evans, 1987; Nash et

al., 2008; Watson et al., 1992). Concentrations of PGF2α were higher in oxytocin

stimulated endometrial glandular epithelial cell cultures as compared to non-stimulated

epithelial cells (Watson et al., 1992). Equine endometrial glandular epithelial cells

secreted higher concentrations of PGF2α during culture as compared to endometrial

stromal cells following 24 hours (Watson et al., 1992), demonstrating PGF2α secretion is

mainly from endometrial epithelial cells. Similarly, porcine endometrial epithelial cell

cultures produced higher levels of PGF2α as compared to endometrial stromal cells

(Blitek and Ziecik, 2004).

Overall prostaglandin production varies by cell type and species, but differences

are also observed in PGF2α versus PGE2 secretion. Porcine myometrial explants secrete

higher concentrations of PGE2 as compared to PGF2α when stimulated with oxytocin

(Franczak et al., 2006). Prostaglandin release from endometrial epithelial cells appears to

be predominantly PGF2α, whereas stromal cells produce mainly PGE2. Furthermore,

porcine stromal cell cultures produced higher levels of PGE2 as compared to PGF2α

(Blitek and Ziecik, 2004). Bovine endometrial epithelial cells released higher

concentrations of PGF2α as compared to PGE2 following 6 hours of culture (Tithof et al.,

2007). These studies conclude prostaglandin production is dependent on cell type and day

of the estrous cycle, with highest concentrations of PGF2α release occurring around the

time of luteolysis.

27

Steroid hormones and prostaglandins

Estrogen and progesterone both appear to regulate the synthesis of prostaglandins

from the endometrium. Porcine endometrial glandular epithelial and stromal cells

experienced enhanced basal release of PGF2α when cultured with progesterone

(Carnahan et al., 2002). Estrogen has been shown to modestly stimulate production of

prostaglandins from uterine tissue in several species (McCracken, 2004). Progesterone

failed to influence prostaglandin production in equine endometrial explants; however in

vitro exposure to estrogen following prolonged progesterone exposure had a stimulatory

effect on PGF2α secretion (Vernon et al., 1981). In the ovine, McCracken (1980)

discovered estrogen and progesterone indirectly control PGF2α secretion by regulating

oxytocin receptors in the endometrium. Following the decline or removal of

progesterone, there is an increase in estrogen and oxytocin receptors. Similar regulatory

mechanisms have been found in the cow, sow, and mare (McCracken et al., 1999). The

lipophilic steroid hormone, progesterone, is believed to modify the fluidity of cell

membranes and influence receptor and ligand binding (Dunlap and Stormshak, 2004). In

ovine endometrial plasma membrane, progesterone was shown to have a suppressive

effect on the binding of oxytocin following in vivo and in vitro exposure (Dunlap and

Stormshak, 2004). Furthermore, progesterone decreased the stimulatory effect of

oxytocin on bovine myometrial cells without affecting the mRNA expression of Cox-2,

PGFS, or PGES (Slonina et al., 2009).

28

Prostaglandin and enzyme expression

Enzymes involved in the synthesis of prostaglandins include PLA2, Cox-1, Cox-2,

and PG synthases. Phospholipase C and protein kinase C are also involved in the

biosynthesis pathway if production is being stimulated by oxytocin. The mRNA and

protein expression of key enzymes involved in prostaglandin biosynthesis have been

evaluated throughout the estrous cycle in many species. Immunohistochemical analysis

of protein expression distribution in equine endometrium demonstrated co-localization of

Cox-2, PGES, and PGFS in the epithelial cells (Boerboom et al., 2004), indicating

epithelial cells are responsible for the majority of prostaglandin synthesis. Throughout the

estrous cycle, expression of Cox-1 mRNA was low in equine endometrial biopsies (Atli

et al., 2010). Likewise, bovine endometrial tissue lacked expression of Cox-1 mRNA and

protein during the estrous cycle (Arosh et al., 2002). In contrast, Cox-2 mRNA

expression was high on days 13-21 and low on days 1-12, similar to the expression

pattern of PGES (Arosh et al., 2002). Similarly, in sheep, Cox-2 mRNA expression was

found to be highest on days 12-14 and lower during early diestrus in endometrial cells

(Charpigny et al., 1999). Furthermore, Cox-2 mRNA expression in equine endometrium

increased around the time of luteolysis (Boerboom et al., 2004; Atli et al., 2010). This

data suggests that Cox-2 is the primary enzyme involved in the synthesis of

prostaglandins from the endometrium. Alternatively, monkey ovarian epithelium

produced mainly PGE2, and Cox-1 is likely responsible for this production versus Cox-2

(Cabrera et al., 2006), demonstrating differences in expression dependent upon species

and tissue type.

29

In bovine endometrial tissue, there was a correlation between mRNA expression

of Cox-2 and PGES (Arosh et al., 2002). Therefore, production of PGE2 from the bovine

endometrium is produced via the Cox-2 and PGES pathway during the estrous cycle.

Similarly, ovine endometrial cells released the greatest concentrations of PGE2 when

Cox-2 was highly expressed (Charpigny et al., 1999). In contrast, ovine endometrial cells

production of PGF2α is not correlated with changes in expression of Cox-2 around the

time of luteolysis (Charpigny et al., 1999). In the equine, PGFS and PGES mRNA

expression remained the same throughout diestrus, with no increase around the time of

luteolysis, and was unaffected by pregnancy status (Boerboom et al., 2004). In contrast,

Atli and colleagues (2010) observed increased PGFS and PGES mRNA expression in

both cyclic and pregnant mares during diestrus as compared to estrus. Expression of the

synthases was highest around the time of expected luteolysis, and decreased following

luteolysis in cycling mares (Atli et al., 2010).

Pregnancy status has been shown to affect release of PGF2α by decreasing

expression of Cox-2 in the endometrium of mares, affecting the overall release or

pulsatility of PGF2α. The increase in expression of Cox-2 mRNA observed in the cycling

mare does not occur in the pregnant mare (Boerboom et al., 2004). Similarly, Cox-2

mRNA expression was increased during early luteolysis and suppressed by pregnancy in

equine endometrial biopsies (Atli et al., 2010; Ealy et al., 2010). In contrast, increases in

Cox-2 mRNA expression occurred in both pregnant and cycling ewe endometrium

(Charpigny et al., 1999). In porcine myometrial explants, Cox-2 protein levels were

similar in cyclic and pregnant animals on days 14-16 (Franczak et al., 2006).

30

Furthermore, PGES was higher during pregnancy in the porcine as compared to time of

luteolysis, whereas PGFS had the highest expression around luteolysis (Franczak et al.,

2006). This data suggests a species difference in the expression of Cox-2 as it relates to

pregnancy status.

Cyclooxygenase-1 mRNA expression was unaffected by day of cycle or early

days in pregnancy in equine endometrium (Atli et al., 2010). Although on days 18 and 22

of pregnancy, mRNA expression of Cox-1 was up-regulated (Atli et al., 2010).

Furthermore a strong correlation was found between the expression of Cox-2 mRNA and

PGF2α release in the mare (Boerboom et al., 2004). This suggests that PGF2α release

must be blocked by some means during pregnancy, suggesting the conceptus prevents the

increase in mRNA expression of Cox-2. Atli et al. (2010) demonstrated equine

endometrial explants exposed to conceptus secretions decreased mRNA expression of

Cox-2. Similarly, the presence of a conceptus inhibited induction of Cox-2 on day 15 in

pregnant mares as compared to cyclic mares (Boerboom et al., 2004).

Hormonal regulation of enzymes involved in prostaglandin biosynthesis has been

evaluated in many species to determine the role of these enzymes in maternal recognition

of pregnancy. In porcine endometrial explants treated with estrogen, there was increased

expression of PGES mRNA and Cox-2 and PGES protein, which led to increased

secretion of PGE2 (Waclawik et al., 2009). Estrogen also decreased PGFS protein

expression, but did not affect expression of PGFS or PGF2α release from porcine

endometrial explants (Waclawik et al., 2009). In contrast, progesterone did not influence

the protein levels or mRNA expression of Cox-2, PGES, or PGFS in bovine myometrial

31

cells, even when stimulated with oxytocin (Slonina et al. 2009). Therefore, progesterone

inhibits the stimulatory effects of oxytocin on prostaglandin production and enzyme

expression.

Interleukin effects on enzyme expression

Interleukin-1 (IL-1) has been shown to stimulate the production of prostaglandins

from the endometrium and change expression of key enzymes involved in the

biosynthesis of prostaglandins. In bovine endometrial cells incubated with IL-1A,

expression of Cox-2 and PGES-1 mRNA and protein increased, whereas Cox-1, PGES2,

and PGFS mRNA and protein expression was not affected (Tanikawa et al., 2008).

Therefore, increased prostaglandin production due to IL-1 stimulation is likely due to

increased expression of Cox-2 and PGES-1 protein and mRNAs.

Oxytocin effects on enzyme expression

Intracellular mechanisms of oxytocin stimulation of PGF2α have been evaluated

in numerous species. Stimulation of equine endometrial explants with oxytocin increased

mRNA expression of Cox-2 following 6 and 24 hours of culture as compared to un-

stimulated explants (Ealy et al., 2010). In porcine myometrium, oxytocin increased

expression of Cox-2 protein, but did not alter the protein expression of PGES or PGFS

(Franczak et al., 2006). Burns and colleagues (1997) demonstrated oxytocin induces an

increase in the expression of Cox-2 mRNA in association with an increase in PGF2α

secretion in ovine endometrial tissue in vivo. Similarly, bovine endometrial epithelial

cells stimulated with oxytocin had increased mRNA expression of Cox-2 as compared to

un-stimulated cells; however expression of Cox-1 and PLA2 mRNA was not affected by

32

oxytocin stimulation (Asselin et al., 2008). Therefore, it is believed that oxytocin does

not regulate the gene expression of Cox-1 or PLA2, but does have regulatory affects on

Cox-2 mRNA expression. Oxytocin could also control or stimulate these enzymes at the

protein level. Moreover, oxytocin has been shown to increase the PLA2 protein

expression and activity in bovine endometrial epithelial cell cultures (Tithof et al., 2007).

33

Oxytocin

Oxytocin is a mammalian hormone produced by the hypothalamus and in luteal

cells in the ruminant. It has also been shown to be synthesized in other peripheral tissues,

such as the uterus, placenta, heart, testis, and amnion. Oxytocin has been shown to

remain at similar concentrations throughout the estrous cycle and the ovaries are not a

source of oxytocin in the mare (Stevenson et al., 1991). Oxytocin mRNA expression has

been reported in the endometrium of the mare, with maximal expression during late

diestrus and early estrus (Behrendt et al., 1997). Oxytocin gene expression has been

found to be high in the paraventricular and supraoptic nuclei of the hypothalamus (Gimpl

and Fahrenholz, 2001). It is then stored and released from the posterior pituitary gland.

Oxytocin is released in response to parturition, suckling, and certain stressors. In order

for oxytocin to stimulate prostaglandin synthesis, it must bind to its receptor. The

oxytocin receptor is a seven transmembrane class I G protein coupled receptor that is

coupled with a Gq protein to phospholipase C (PLC) (Gimpl and Fahrenholz, 2001). Once

oxytocin binds to its receptor, the G α and β proteins activate PLC. Phospholipase C

generates diacylglycerol (DAG) and inositol triphosphate from phosphatidylinositol,

which in turn stimulates Ca2+

release and protein kinase C (PKC) (Gimpl and Fahrenholz,

2001). The intracellular release of calcium leads to smooth muscle contractions through

activation of the myosin light-chain kinase (Gimpl and Fahrenholz, 2001) and the

activation of PKC triggers the release of AA and therefore begins prostaglandin

synthesis.

34

Oxytocin stimulated prostaglandin release

Phospholipase A2 is responsible for the cleavage of arachidonic acid from the cell

membrane lipid bilayer (Smith et al., 1991). The exact mechanism by which oxytocin

creates a stimulatory effect on the endometrium remains unclear. Phospholipase C and

DAG are believed to be mediators in the stimulatory effects of oxytocin. In ovine

endometrial tissue exposed to oxytocin, a small rise in PLC activity occurs before an

increase in PGF2α secretion (Silvia et al., 1994). Vasopressin, which is known to bind to

the oxytocin receptor, stimulates PGF2α and to a lesser extent PLC; suggesting that

maximal PGF2α can be secreted without maximal PLC activity and PLC activity does not

appear to control oxytocin stimulated PGF2α secretion (Silvia et al., 1994). This indicates

that another mechanism must be involved in the oxytocin stimulated release of

prostaglandins. Phospholipase C hydrolyses DAG from phosphatidylinositol 4, 5-

bisphosphate. Diacylglycerol then can activate PKC and act as a second messenger in the

stimulation of prostaglandin synthesis. Protein kinase C phosphorylates enzymes that are

involved in the cleavage of AA from the cell membrane (Silvia et al., 1994). Analogues

of DAG stimulated PGF2α in ovine endometrial tissue and may mediate oxytocin

stimulation (Silvia et al., 1994). Phospholipase A2 has been shown to simulate the release

of PGF2α in ovine endometrial explants and therefore is likely to mediate oxytocin

stimulated prostaglandin production (Lee and Silvia, 1994). There are two mechanisms

by which oxytocin is thought to stimulate prostaglandin synthesis through PLA2: 1) when

oxytocin binds to its GPCR, it activates PLA2 directly through a GTP-binding regulatory

protein or 2) increased activity of PLC and PKC lead to the activation of PLA2 (Fain et

35

al., 1988). The exact mechanism used by oxytocin to activate PLA2 and prostaglandin

synthesis in the endometrium has yet to be determined.

Oxytocin receptors were shown to have greater binding capacity in the

endometrium as compared to the myometrium in ovine uterine tissue and PGF2α was

enhanced by oxytocin stimulation only in the endometrium (Roberts et al., 1976);

suggesting oxytocin targets the endometrium for PGF2α production. In contrast, the

number of oxytocin binding sites in the mare was found to be greater in the myometrium

than the endometrium, although the affinity of the oxytocin receptors was higher in the

endometrium versus the myometrium (Stull and Evans, 1986). Oxytocin receptors within

the endometrium are up-regulated by an increase in estrogen and decrease in

progesterone during late diestrus (Spencer et al., 1995). Estrogens are believed to

influence the release of PGF2α from the uterus by possibly conditioning the prostaglandin

secretory mechanisms and stimulating the development of oxytocin receptors (Roberts et

al., 1976), indicating a role for steroids in oxytocin stimulated prostaglandin secretion.

Sharma and Fitzpatrick (1974) found that anestrous ewes failed to release PGF in

response to oxytocin stimulation, unless they were first primed with estradiol. Ewes

treated with estradiol on a long term basis had an inhibitory effect on oxytocin receptors

in the endometrium and long term treatment with progesterone enhanced this inhibition

(Vallet et al., 1990). Progesterone receptor expression is down-regulated through

endometrial exposure to circulating progesterone, causing an increase in expression of the

estrogen receptor and up-regulation of oxytocin receptors. In bovine endometrial

explants, treatment with estrogen did not affect concentrations of oxytocin receptors over

36

time, whereas treatment with progesterone decreased the oxytocin receptor

concentrations to less than 35% of the initial levels (Mann, 2001). Furthermore, secretion

of PGF2α from oxytocin stimulated bovine endometrial explants treated with

progesterone was similar to controls and explants treated with estrogen (Mann, 2001).

Therefore, it is possible production of PGF2α is not necessarily dependent on the

concentration of oxytocin receptors, but more on responsiveness of the tissue to oxytocin.

In contrast, porcine endometrial luminal epithelial cells treated with progesterone and

stimulated with oxytocin had an enhanced secretion of PGF2α (Carnahan et al., 2002),

despite a lack of change in the activity of PLC.

The release of oxytocin creates a positive feedback loop, in which PGF2α

synthesis and release causes additional secretion of oxytocin from the CL (Flint and

Sheldrick, 1982) and hypothalamus (Silvia et al., 1991). A positive feedback loop exists

in the mare and involves endometrial PGF2α and endometrial and pituitary oxytocin

(Stout and Allen, 1999). In the ewe, Silvia and colleagues (1991) found oxytocin release

from the hypothalamic-pituitary axis contributed to the positive feedback loop during

luteolysis. Another more likely source of oxytocin production is the uterus, in which both

mRNA and protein expression for oxytocin has been shown in the endometrium of a

number of species (Lefebvre et al., 1992, Chibbar et al., 1993, Boulton et al., 1996).

Maximal staining for oxytocin (Watson et al., 1997) and maximal expression of oxytocin

mRNA (Behrendt et al., 1997) occurred in equine endometrium during late diestrus and

early estrus. Sharp and colleagues (1997) have shown oxytocin receptors to be present in

the equine endometrium during estrus and are approximately 25% of the maximal

37

concentrations found on day 14 post ovulation. Concentrations of oxytocin receptors

were similar in pregnant and nonpregnant mares up until day 14 post ovulation, but the

affinity of the receptor was reduced in pregnant mares (Sharp et al., 1997). Similarly,

Starbuck et al. (1998) showed an increase in oxytocin receptor concentrations in

nonpregnant mares from day 10 to day 14 post ovulation, and there was no change in

receptor concentrations in pregnant mares. Oxytocin binding sites in the mare were

shown to be greatest on days 14-17 post ovulation for both endometrial and myometrial

tissue, although the affinity for each tissue did not change throughout the estrous cycle

(Stull and Evans, 1986).

Plasma concentrations of PGFM in mares administered oxytocin differed

throughout the estrous cycle, with maximal release on day 14 post ovulation and

decreasing concentrations following luteolysis (Sharp et al., 1997; Starbuck et al., 1998).

Similarly, equine endometrial explants have shown variable secretion of PGF2α based on

day of estrous cycle, with maximal production around day 14 post ovulation (King and

Evans, 1987; Vernon et al., 1981). In contrast, release of PGF2α from equine endometrial

epithelial cells stimulated with oxytocin did not differ throughout day of cycle or

pregnancy status (Watson et al., 1992). It has been documented by others that PGF2α

secretion is generally lower during estrus as compared to late diestrus (King and Evans,

1987; Vernon et al., 1981), however, oxytocin stimulated PGF2α release is possible.

Currently exogenous administration with oxytocin is used in the mare to aid in

uterine clearance (Cadario et al., 1999). Oxytocin stimulates uterine contractions by

binding to its receptors within the myometrium; this stimulates the activation of PLC

38

which in turn hydrolyses DAG and inositol 1,4,5-triphosphate (IP3) (Mitchell et al.,

1992). Inositol 1,4,5-triphosphate stimulates the release of intracellcular calcium release

and activates the myosin light chain kinase, which cause muscle contractions (Mitchell et

al., 1992). Oxytocin also stimulates the release of PGF2α by binding its receptors on the

endometrium. Prostaglandin F2α causes further myometrial contractions and therefore

aids in stimulating the clearance of foreign material and fluid from the uterus in mares

with delayed uterine clearance or persistent endometritis (Cadario et al., 1999). Gutjahr et

al. (2000) has demonstrated mares treated with oxytocin have a greater uterine response

two days prior to ovulation as compared to 2 days post ovulation. If oxytocin is given

prior to ovulation a lower dose is just as effective as the higher dose typically given post

ovulation (Gutjahr et al., 2000). The greater effect seen prior to ovulation could be due to

oxytocin receptor concentrations and an influence on the receptor population by estradiol

prior to ovulation and progesterone suppressing the oxytocin receptor post ovulation.

Oxytocin receptor antagonist

Antagonists for oxytocin and vasopressin were first described by Melin and

colleagues in 1981 using rat and human myometrial tissue. Atosiban, an oxytocin

receptor antagonist, prevents the binding of oxytocin to its receptor through competitive

inhibition and therefore blocks second messenger formation (Phaneuf et al., 1994).

Atosiban is an oligopeptide containing nine amino acids with a ring structure (Buscher et

al., 2001). It has great affinity for both the oxytocin and vasopressin receptors without

initiating any downstream activity from the receptor. Atosiban and similar oxytocin

antagonists have been primarily used to aid in the prevention of preterm labor and

39

myometrium contractions. Atosiban inhibited oxytocin stimulated myometrial cell

activation in cultured human myometrium by preventing the increase in intracellular

calcium (Phaneuf et al., 1994). Atosiban had no effect on oxytocin sensitivity during long

term exposure and prevented oxytocin desensitization during long term culture with

oxytocin (Phaneuf et al., 1994). Similarly, oxytocin induced contractions were inhibited

in a dose dependent manner when pregnant human myometrial strips were cultured with

Atosiban (Buscher et al., 2001).

40

Lipopolysaccharide

The bacterial endotoxin, lipopolysaccharide (LPS), is a glycolipid and a major

component of Gram-negative bacteria cell walls. It has a stimulatory effect on

inflammatory mediators, including prostaglandins, tumor necrosis factor (TNF),

interleukin-1 (IL-1), and increases synthesis and release of these cytokines from

macrophages, neutrophils, and lymphocytes (Taylor and Terranova, 1996; Raetz and

Whitfield, 2002). Lipid A, an endotoxin, is a phospholipid, hydrophobic anchor of LPS

that is on the outer membranes of bacteria, such as Escherichia coli (E. coli) (Raetz and

Whitfield, 2002). Pattern-recognition receptors (PRRs) are germline receptors that

recognize pathogens through conserved molecular patterns shared by groups of

microorganisms (Akira et al., 2001). Foreign pathogens, such as E. coli, are first

recognized by Toll-like receptors (TLRs) by binding the ligand LPS, and are expressed

on antigen presenting cells within the body (Akira et al., 2001). Toll-like receptors are

similar to PRRs and function in the same manner in mammals (Akira et al., 2001). These

receptors are a large family of molecules that are involved in the innate immune response

and initial recognition of pathogens (Muzio and Mantovani, 2000). Toll-like receptors are

type I transmembrane protein receptors and are related to interleukin-1 receptors.

Lipopolysaccharide has been found to signal cytokine synthesis through Toll-like

receptor-4 (TLR4) (Chow et al., 1992).

Toll-like receptors

Evaluation of human endometrium revealed the expression of TLR1-6 and 9

mRNAs in whole endometrium and endometrial epithelium (Young et al., 2004).

41

Additionally, TLR-4 mRNA transcripts were also detected in bovine endometrial

epithelial and stromal cells (Herath et al., 2006). Equine endometrial biopsies have also

been shown to express TLR-4 mRNA before and after insemination (Nash et al., 2010).

Furthermore, TLRs-2, -3, -4, and -9 mRNA expression was found in the cervix, uterus,

and placenta of nonpregnant and pregnant mice (Gonzalez et al., 2007). The mRNA

expression of the TLRs was up-regulated in pregnant uterine and cervical mice tissues,

although there was a down-regulation of TLR-4 in placental tissue (Gonzalez et al.,

2007). Therefore, TLR are present in the female reproductive tract and can serve as an

innate pathogen detection mechanism. The placenta is likely to have less exposure to a

pathogen as compared to the cervical and uterine tissue, which would likely serve as a

first response.

LPS and prostaglandin secretion

Bovine endometrial explants and stromal and epithelial cells cultured with LPS

secreted increasing concentrations of PGE2 and PGF2α in a dose dependent manner

(Herath et al., 2006). Additionally, LPS stimulated bovine endometrial epithelial and

stromal cells demonstrated an up-regulation in the expression of Cox-2 mRNA (Herath et

al., 2006). Likewise, stimulation of human non-pigmented ciliary epithelial cells with

LPS increased secretion of PGE2 and expression of Cox-2 proteins (Yadav et al., 2010).

In ovine uterine arteries, stimulation with LPS increases production of PGI2 and

expression of Cox-2 protein, but had no affect on expression of Cox-1 (Vagnoni and

Magness, 1998). Treatment with LPS in bovine endometrial explants stimulated release

of PGF2α, but had no effect on oxytocin receptor mRNA expression (Leung et al., 2001).

42

Lipopolysaccharide stimulated PGE2 release from rat hypothalamic explants following 60

minutes of culture, but had no affect on PGF2α secretion (Pozzoli et al., 1994). Similarly,

PGE2, not PGF2α release was stimulated by LPS from rat cortical astrocyte cultures

following 24 hours of culture (Pozzoli et al., 1994). In contrast, human placental explants

stimulated with LPS for 60 minutes had increased concentrations of PGF2α and PGE2 as

compared to controls (Gu et al., 1994). Increasing concentrations of LPS did not increase

secretion of prostaglandins in a dose response manner; PGF2α and PGE2 concentrations

were similar for human placental explants treated with 0.1-100 µg/mg of LPS (Gu et al.

1994).

Pre-treatment with progesterone or estradiol decreased the secretion of

prostaglandins in response to LPS stimulation in bovine endometrial epithelial and

stromal cells (Herath et al., 2006). Similarly, rat ovarian granulosa cells treated with LPS

had inhibited LH-stimulated estradiol secretion (Taylor and Terranova, 1996). In

contrast, estrogen appeared to play a role in the response of ovine uterine arteries to LPS,

in that only when uterine arteries were treated with estradiol did they respond to LPS

with an increase in PGI2 (Vagnoni and Magness, 1998). Likewise, ovariectomized ewes

showed no expression of Cox-2, suggesting a need for pre-exposure to progesterone

and/or estradiol (Vagnoni and Magness, 1998).

43

Dietary Influence on the Inflammatory Response

Polyunsaturated fatty acids

Polyunsaturated fatty acids (PUFAs) have one or more double bonds within the

molecule and can be classified as omega-3, omega-6 or omega-9 fatty acids, depending

on where the first double bond is located. Animals cannot synthesize omega-3 or omega-

6 fatty acids because they lack the appropriate desaturase enzymes, and thus these fatty

acids are dietary essential fatty acids (Wathes et al., 2007). Omega-6 fatty acids are found

mainly in vegetable oils, such as corn, sunflower, and safflower and are mostly derived

from linolenic acid. Omega-3 fatty acids are mainly found in green vegetables, grasses,

plants, fish, and marine sources and mostly derived from alpha-linolenic acid. Alpha-

linolenic is converted in the body into eicosapentanceoic acid (EPA) and

docosahexaneoic acid (DHA) through fatty acid desaturases 1 and 2 and elongase. EPA

can be converted into 3-series prostaglandins (Wathes et al., 2007), in contrast to AA

which is converted into 2-series prostaglandins. Linoleic acid is converted similarly in the

body into the omega 6 fatty acid dihomo-gamma-linolenic acid (DGLA) and arachidonic

acid, which can then be converted into 1 and 2 series prostaglandins.

44

Figure 1.2 Synthesis of 1-, 2-, and 3-series prostaglandins from dietary

polyunsaturated fatty acids through desaturation and chain elongation. (Wathes et al.,

2007)

Fatty acid uptake

The molecular mechanisms by which long-chain fatty acids are transported

through the cell membrane remains unclear. There are two mechanisms in debate by

which fatty acids are likely to be transported across the membrane: passive diffusion

(Hamilton et al., 2002) or a protein carrier mediated transport (Stremmel et al., 1992;

Campbell et al., 1997). Human placental choriocarcinoma cells cultured with oleic,

linolenic, arachidonic, and docosahexaneoic acids for 30 minutes, demonstrated uptake of

all the fatty acids (Campbell et al., 1997). Furthermore, inhibition of the plasma

membrane fatty acid binding protein (FABP) decreased the uptake of all fatty acids,

demonstrating the potential involvement of FABP with the uptake of long-chain fatty

acids (Campbell et al., 1997). Additionally, cultured hepatocytes showed a decrease in

45

uptake of oleate when a FABP inhibitor was added and further demonstrates the

translocation of fatty acids across the membrane involves binding to a membrane protein

(Stremmel et al., 1992). In contrast, Hamilton et al. (2002) demonstrated rat adipocytes

absorb and transport long-chain fatty acids through a three step method (Figure 1.3) that

does not involve a transport or binding protein, but works via diffusion by a flip-flop

mechanism; however it is possible a membrane protein might be involved at the cell

surface to attract albumin and facilitate absorption. Glatz and colleagues (1997) recognize

the uptake and translocation of long-chain fatty acids is a multiple step process and likely

involves both passive diffusion and the use of a membrane fatty acid binding protein.

Figure 1.3 Three step method for absorption and transportation of long-chain fatty acids

across the cell membrane (Hamilton et al., 2002).

Omega-3 fatty acids and equine

Many animal diets, including the equine, have been supplemented with fats and

oils for several years to provide nutritional and health benefits. Vegetable oils rich in

omega 6 fatty acids are the most common source of supplementation in equine diets. The

average forage diet contains between 1.5-3.5 % crude fat, where as the fat in a diet

46

containing both forage and a concentrate ranges from 4.5-7.0 % (Valentine, 2001). A

high-fat diet can contain 12% or more of fat in the concentrate portion of the diet. Fats

play an important role in equine nutrition and health and are required for a number of

functions, including absorption of fat-soluble vitamins and serve as a source of

concentrated energy and essential fatty acids (linolenic acid, linolenic acid, and

arachidonic acid). Recently, fish oil has been used as a dietary supplement to increase

omega 3 fatty acids in the diet and provide many health benefits for the equine.

Supplementation with fat to lactating mares appeared to influence the fatty acid

composition of their foals and milk (Spearman et al., 2005). Dietary supplementation

with fish oil has been shown to decrease heart rate in exercising horses (O’Connor et al.,

2004), suggesting a role for omega 3 fatty acids in exercise metabolism. Hall and

colleagues (2004) found dietary supplementation with polyunsaturated fatty acids altered

the inflammatory response of normal horses by increasing production of pro-

inflammatory cytokine TNF-α and increasing phagocytic activity of BALF cells.

Similarly, the omega 3 fatty acids EPA and DHA are currently thought to decrease

inflammation in horses with osteoarthritis by decreasing both the concentration of plasma

PGE2, and the number of inflammatory cells in synovial fluid (Manhart et al., 2005). In

contrast, lymphocyte proliferation and PGE2 production was not affected in horses

supplemented with omega-3 fatty acids (Vineyard et al., 2010). Similarly, equine fed an

encapsulated fish oil supplement did not alter antibody production or neutrophil function,

although plasma fatty acid composition of cell membranes was changed, demonstrating

uptake of the fatty acids (Vineyard et al., 2005).Woodward et al. (2005) found an

47

increase in trot stride length and plasma EPA and DHA in horses fed a supplement

containing stabilized long chain polyunsaturated fatty acids. The increased stride length

could be due to the increase in omega-3 fatty acids in plasma, alleviating inflammatory

problems found in horses with osteoarthritis.

Omega-3 fatty acids and female reproduction

Supplementation with polyunsaturated fatty acids has been shown to effect

multiple functions in the body, including inflammation, brain function, arthritis,

reproduction, and cell function. Possible incorporation of fatty acids into various foods to

increase the ratio of omega-3 to omega-6 has been evaluated due to the numerous

benefits. Hens supplemented with fish oil had increased yolk fat omega-3 fatty acid

concentrations; demonstrating dietary supplementation will affect the fatty acid profile

(Alvarez et al., 2004). Similarly, omega-3 fatty acid supplementation using fish meal

altered the plasma and endometrial cell membrane composition in non-lactating beef

cows (Burns et al., 2003). These results indicate that supplementation with omega-3 fatty

acids does alter the fatty acid profile and uptake of fatty acids can occur within the

endometrium.

Dietary supplementation with omega-3 and omega-6 fatty acids decreased plasma

progesterone and increased the number of medium-sized follicles in lactating dairy cows,

but had no affect on oxytocin stimulated plasma PGFM concentrations (Robinson et al.,

2002). This study suggests a role of polyunsaturated fatty acid in steroidogenesis.

Possible mechanisms of PUFAs mediating steroidogenesis include altering prostaglandin

synthesis by decreasing luteotrophic PGE2 secretion or possible delayed ovulation

48

leading to delayed luteal development (Robinson et al., 2002). Beef heifers with low

progesterone levels supplemented with fish meal had decreased concentrations of PGF2α

in response to oxytocin, suggesting a possible method to improve fertility (Wamsley et

al., 2005). In contrast, progesterone and estradiol concentrations were not influenced in

beef heifers supplemented with fish oil, although the heifers did have increased corpora

lutea diameter on day 7 post ovulation (Childs et al., 2008). Antiluteolytic effects of EPA

and DHA has been suggested by Petit et al. (2002), who reported that cows fed a diet

high in omega-3 fatty acids had larger corpora lutea than cows fed linseed oil or no fatty

acid supplement. In addition to the antiluteolytic effect of EPA and DHA, Bilby et al.

(2006) found that cows fed an omega-3 fatty acid enriched diet had larger pre-ovulatory

follicles as compared to non-supplemented cows; suggesting a potential role of EPA

and/or DHA in folliculogenesis. In rats supplemented with AA, EPA or DHA, there were

no affects on ovulation, suggesting the effects of fatty acid supplementation may be pre-

ovulatory (Broughton et al., 2009).

Early embryonic losses in the bovine can partly be attributed to deficient

concentrations of interferon produced by the embryo and subsequent luteolysis (Wathes

et al., 2007). In the mare, early embryonic loss can be caused by a lack of maternal

inhibition of PGF2α or increased secretion of PGF2α due to uterine inflammation.

Decreases in early embryonic loss may be mediated by dietary supplementation with

EPA and DHA (Mattos et al., 2000) as Petit et al. (2002) showed that cows receiving a

diet supplemented with polyunsaturated fatty acids had lower incidence of early

49

embryonic losses compared to cows not receiving the polyunsaturated fatty acid

supplement.

Omega-3 fatty acids and prostaglandins

Dietary supplementation with polyunsaturated fatty acids alters the membrane

phospholipid composition of cells throughout the body. Altered phospholipid bilayers

within the cell may lead to competitive inhibition of the enzymes, Cox-1 and Cox-2, by

changing the availability of substrates. In the presence of increased quantities of EPA and

DHA, AA metabolism can decrease (Wathes et al., 2007). Supplementation with omega-

3 fatty acids could lead to displacement of arachidonic acid (AA) with EPA or DHA

which could decrease production of series-2 prostaglandins and shift to series-3

prostaglandin production. In men, it has been shown dietary supplementation with

omega-3 fatty acids enhances the synthesis of 3-series prostaglandins (Hornstra et al.,

1991). Likewise, in rats supplemented with DHA, PGE3 and PGF3α concentrations

increased, but PGE2 and PGF2α concentrations remained unaffected by the diet

(Broughton et al., 2009).

Beef heifers supplemented with fish oil and stimulated with oxytocin had higher

concentrations of plasma PGFM as compared to controls (Childs et al., 2008). Likewise,

dairy cows fed omega-3 fatty acids in the form of fish oil also had higher concentrations

of plasma PGFM following an oxytocin challenge (Petit et al. 2002). In contrast, Mattos

and co-workers (2002) found that lactating cows fed a fish meal diet and challenged with

estradiol and oxytocin to stimulate PGF2α release had lower PGF2α concentrations as

compared to cows fed a non-fatty acid supplemented diet. Moreover, in vitro cell cultures

50

of bovine endometrial cells incubated with DHA and EPA had inhibited PGF2α release

(Mattos et al., 2003). Similarly, bovine endometrial cells cultured for 24 hours with EPA

decreased concentrations of PGF2α by 75% as compared to controls (Caldari-Torres et

al., 2006). Furthermore, the inhibition of PGF2α secretion was decreased when the ratio

of omega-6 to omega-3 fatty acids increased (Caldari-Torres et al., 2006). Mattos and co-

workers (2004) also found that lactating dairy cows fed a fatty acid supplemented diet

during the periparturient period showed a decrease in the secretion of PGF2α. This is

similar to earlier work reported by Arntzen et al. (1998) who showed PGF2α and PGE2

synthesis was inhibited in decidual cell cultures supplemented with n-3 polyunsaturated

fatty acids. A similar study found rats fed diets rich in DHA had lower levels of placental

PGF2α compared to rats fed a linolenic supplemented diet (Perez et al., 2006). Perez et al.

(2006) also showed significantly lower concentrations of arachidonic acid in the uterus

and placenta of rats fed a DHA rich diet. Concentrations of PGF2α and PGE2 from

peritoneal fluid were decreased in rabbits supplemented with fish oil following surgically

induced endometritis (Covens et al., 1988). Moreover, ovine amnion cells cultured with

DHA showed inhibition of PGE2 secretion, whereas treatment with AA increased release

(Kirkup et al., 2010).

Treatment of ovine uterine epithelial cells with omega-6 fatty acids decreased

oxytocin stimulated release of PGF2α and reduced the cells’ responsiveness to oxytocin

(Cheng et al., 2005). Similarly, dietary supplementation of cows with omega-6 fatty acids

decreased PGF2α and PGE2 secretion from endometrial explant cultures as compared to

the omega-3 fatty acid supplemented group and cows receiving no dietary supplement

51

(Cheng et al., 2001). Also, omega-6 fatty acid supplementation inhibited the ability of

endometrial explants to respond to oxytocin (Cheng et al., 2001). Although, omega-3

fatty acid supplemented cows had increased concentrations of PGF1α (Cheng et al.,

2001), suggesting a change in prostaglandin production from the active 2-series to a less

bioactive 1-series.

Supplementation with polyunsaturated fatty acids influences the secretion of

prostaglandins in vivo and in vitro in many species. The effects of fatty acid

supplementation seem to be dependent on the source of the fatty acid, the ratio of omega-

6 fatty acids to omega-3 fatty acids, duration of supplementation, and the series of

prostaglandin being evaluated.

Omega-3 fatty acids and prostaglandin synthesis

Eicosapentaenoic acid has been shown to inhibit the activity of Cox-1 (Wathes et

al., 2007), although the conversion of EPA into 3-series prostaglandins via Cox-1 is poor.

Mattos and colleagues (2003) found PGF2α to be suppressed in vitro in bovine cell

cultures supplemented with polyunsaturated fatty acids, possibly due to reductions in

PGHS-2 and PLA2 enzyme activity and PGHS-2 mRNA concentrations and protein

expression. The inhibition of fatty acid supplementation on PGF2α is believed to be

through a different mechanism than that of bovine interferon tau (Mattos et al., 2003). In

contrast, EPA did not influence the detectable mRNA of Cox-2 in cultured bovine

endometrial cells (Caldari-Torres et al., 2006). Similarly, lactating dairy cows

supplemented with fish meal had increased uterine omega-3 fatty acid concentrations, but

there was no affect on endometrial Cox-2 protein or PGF2α production in response to an

52

oxytocin challenge (Moussavi et al., 2007). Furthermore, human decidual cells cultured

with DHA and stimulated with interleukin-1 had decreased PGF2α and PGE2 production

and mPGES-1 and -2 mRNA expression, but there was no affect on Cox-1 or Cox-2

mRNA expression following 12 hours of incubation (Roman et al., 2006). Culture with

EPA had no affect on prostaglandin production or enzyme expression in human decidual

cell cultures (Roman et al., 2006). Eicosapentaenoic acid fed to rats increased ovarian

PGF2α and PGE2 release, although had no affect on Cox-1 or Cox-2 protein expression

(Broughton et al., 2009). In contrast, dietary omega-3 fatty acids fed to lactating dairy

cows had no affect on concentrations of prostaglandins from uterine flushing, although

staining intensity of the Cox-2 protein was decreased (Bilby et al., 2006). Dietary

supplementation of beef heifers with high omega-3 fatty acid diets increased PGES and

decreased PLA2 mRNA expression within the uterus, but had no affect on the oxytocin

receptor, PLC, Cox-1, Cox-2 or PGFS mRNA expression (Coyne et al., 2008).

Dissimilar to the bovine, EPA inhibited Cox-1 and Cox-2 activity as well as decreased

PGD2 secretion from cultured human mast cells in response to IgE-anit-IgE challenge

(Obata et al., 1999). Bovine aortic endothelial cells cultured with DHA or EPA for 24

hours showed reduced PGI2 production as well as decreased Cox-1 protein expression

and mRNA levels (Achard et al., 1997). Similarly, Holstein cows fed flaxseed had

reduced Cox-2 mRNA expression in the endometrium (Palin et al., 2005). Furthermore,

Massaro et al. (2006) showed DHA decreased Cox-2 protein expression, but not Cox-1,

in human vascular endothelial cells. The decrease in protein expression could be due to

53

longer incubation with DHA; Massaro et al. (2006) incubated cells for 48 hours whereas

many other cultures where incubated for only 24 hours.

Modulation of prostaglandin synthesis

Enzyme expression related to prostaglandin synthesis varies with tissue type and

concentration, source and duration of fatty acid supplementation. Although DHA and

EPA decreases prostaglandin production, it has been shown altering of enzyme

expression is not the only mechanism inhibiting prostaglandin secretion; therefore other

mechanisms must be involved in the DHA mediated inhibition of PGF2α release. Possible

mechanisms for this inhibition include 1) shifting production from 2-series prostaglandins

to 1 or 3-series prostaglandins, through competition of EPA and DHA with AA for lipid

metabolism and incorporation in the phospholipid membrane (Mattos et al., 2003; Calder,

2009) or 2) DHA is possibly affecting the lipid composition of the membrane influencing

signaling pathways within the cell (Chapkin et al., 2009). Docosahexaneoic acid has been

shown to alter cell membrane properties, including fluidity, protein function, rapid

diffusion and flip/flop translocation of fatty acids and order of fatty acid chains (Stillwell

and Wassall, 2003). The transmembrane domain and activation of the oxytocin receptor

could be influenced by DHA if the cell membrane is being altered. Omega-3 fatty acids

have also been shown to inhibit inflammation through nuclear receptors and lipid rafts

(Chapkin et al., 2009), such as the Toll-like receptor and recognition of LPS.

54

Summary

Uterine inflammation and persistent endometritis are major factors contributing to

early embryonic loss and decreased fertility within the equine industry. Accumulation of

inflammatory fluid or infection, especially in older mares, can increase secretion of

PGF2α and leads to regression of the corpus luteum and loss of the embryo. Oxytocin has

been shown to stimulate the release of PGF2α in vivo and in vitro in many species. This

release is dependent on day of the cycle and species. Oxytocin stimulated release of

PGF2α involves key enzymes in the synthesis pathway. There is a potential for

supplementation with omega-3 fatty acids to influence the expression of these enzymes.

The literature reviewed collectively demonstrates the positive influence dietary

supplementation with omega-3 fatty acids can have on female reproduction and the

inflammatory process. Omega-3 fatty acids have an impact and can regulate uterine

inflammation and early embryonic loss. Supplementation with polyunsaturated fatty

acids, specifically DHA, can influence the inflammatory response in vitro and in vivo

through mechanisms involving enzyme expression, but also other mechanisms must be

involved in the inhibition of prostaglandin secretion. The effects of omega-3 fatty acid

supplementation in the mare is unknown and warrants further investigation because of the

positive impact it could potentially have on equine reproduction and fertility.

55

CHAPTER 2

ESTABLISHMENT AND CHARACTERIZATION OF EQUINE

ENDOMETRIAL CELL CULTURES AND OXYTOCIN STIMULATED

PRODUCTION OF PGF2α

Abstract

Exogenous administration of oxytocin in the mare can be used to promote

uterine clearance and improve fertility. Oxytocin stimulated release of PGF2α and its

metabolite (PGFM) from equine endometrial cell culture has not been determined during

estrus. Equine endometrial biopsies were used to establish endometrial epithelial cell

cultures and determine the release of PGF2α and PGFM in response to oxytocin

stimulation. The effects of a basement membrane matrix and the addition of horse serum

to the media on the growth and response of endometrial epithelial were also evaluated.

Proliferation and characterization of epithelial cells was performed using BrdU and

immunoflorescent staining. Endometrial cell cultures were challenged with 250 nM of

oxytocin and PGF2α and PGFM secretion was measured. Equine endometrial cell

cultures showed replication within 24 hours of culture and cells were epithelial in origin.

Oxytocin did not stimulate the release of PGF2α and PGFM following 6 or 24 hours of

culture of endometrial epithelial cells. The addition of a basement membrane matrix

increased (P < 0.05) PGF2α concentrations at 6 and 24 hours in both challenged and non-

challenged cell cultures. The addition of horse serum did not influence PGF2α secretion

from endometrial epithelial cell cultures. In conclusion, equine endometrial cells were

established and shown to replicate in a non-matrix supported culture and on a basement

56

membrane matrix. Although endometrial epithelial cells were shown to replicate and

were viable in vitro, functional competency was undetectable as measured by a failure to

elicit a PGF2α release upon oxytocin stimulation. More work is necessary to define a

deficient cell culture system that is capable of secreting PGF2α when stimulated with

oxytocin.

57

Introduction

In ruminants, oxytocin is secreted by the corpus luteum and stimulates release of

PGF2α from the endometrium, which causes luteolysis at the end of estrous cycle.

Oxytocin receptors within the endometrium are up-regulated by an increase in estrogen

and a decrease in progesterone during late diestrus (Spencer et al., 1995). Progesterone

receptor expression is down-regulated through endometrial exposure to circulating

progesterone, causing an increase in expression of the estrogen receptor and up-

regulation of oxytocin receptors. The release of oxytocin creates a positive feedback loop,

in which PGF2α synthesis and release cause additional secretion of oxytocin from the CL

(Flint and Sheldrick, 1982) and hypothalamus (Silvia et al., 1991). Unlike the ruminant,

oxytocin is not secreted by the CL in the equine (Stevenson et al., 1991). In the ewe,

Silvia and colleagues (1991) found oxytocin release from the hypothalamic-pituitary axis

contributed to the positive feedback loop during luteolysis. Another, more likely, source

of oxytocin production is the uterus, in which both mRNA and protein for oxytocin have

been isolated from the endometrium of several species (Lefebvre et al., 1992; Chibbar et

al., 1993; Boulton et al., 1996). Maximal binding for oxytocin (Watson et al., 1997) and

maximal expression of oxytocin mRNA (Behrendt et al., 1997) occurred in mare

endometrium during late diestrus and early estrus.

The endocrine regulation of endometrial PGF2α production and release has not

been determined in the mare, although the release of PGF2α from the uterine

endometrium does result in luteolysis (Irvine, 1995). In 1985, Betteridge and colleagues

demonstrated that the exogenous administration of oxytocin to mares in late diestrus

58

caused an increase in peripheral 13, 14-dihydro-15-keto PGF2α (PGFM) plasma

concentrations, suggesting the role of oxytocin for luteolysis. Exogenous administration

of oxytocin has been shown to stimulate PGF2α release from the endometrium and cause

luteolysis (Goff et al., 1987).

Currently, oxytocin administration has been used to promote uterine clearance

and improve fertility in mares prone to infection and persistent endometritis (Cadario et

al., 1999). Prostaglandin F2α release due to oxytocin administration has been shown to be

dependent on stage of the estrous cycle, with maximal secretion on day 14 around the

time of luteolysis (Sharp et al., 1997). Equine endometrial explants showed variable

response to oxytocin during culture with maximum release on day 14 (King and Evans,

1987), which coincides with time of luteolysis. Similarly, concentrations of oxytocin

receptors in equine endometrium have also been shown to be dependent on the day of the

estrous cycle (Sharp et al., 1997). During estrus, oxytocin receptors were present in the

endometrium of mares, although concentrations were approximately 25% of maximal

concentrations found on day 14 post ovulation (Sharp et al., 1997). Oxytocin stimulated

release of PGF2α and its metabolite (PGFM) from equine endometrial cell culture has not

been determined during estrus. The purpose of this study was to establish equine

endometrial cell cultures and determine if oxytocin would stimulate the release of PGF2α

and PGFM.

59

Materials and Methods

Materials

Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum

albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were

purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-

transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine

serum (FBS) was from HyClone (Logan, UT). The Liberase Blendzyme III was from

Roche Diagnostics (Indianapolis, IN). Oxytocin was purchased from MWI Veterinary

Supply (Boise, ID). The BD Matrigel basement membrane matrix was purchased from

BD Biosciences (Bedford, MA).

Animals

A total of five mature (mean 10.6 years ± 5) mares of light horse breeding were

utilized and housed at The University of Arizona Equine Center. Mares were teased with

a stallion daily for detection of behavioral estrus. Follicular development and uterine

edema were monitored by transrectal palpation and ultrasonography every day from the

first detection of behavioral estrus through ovulation. All animal procedures were

reviewed and approved by the Institutional Animal Care and Use Committee at The

University of Arizona.

Experiment I

One endometrial biopsy was taken from each of eight mares on the second day of

behavioral estrus. The biopsies were recovered non-surgically using a cattle biopsy

instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw, Richard

60

Wolf Medical Instruments Corporation, Vernon Hills, IL) immediately right and left of

the uterine bifurcation. Uterine tissue was removed aseptically from the biopsy punch and

placed into 10 ml of HBSS supplemented with 2X concentration of antibiotic-antimycotic

solution. Biopsies were transported to the laboratory on ice within 30 minutes of harvest.

Uterine tissue was rinsed one time with fresh HBSS. The endometrial biopsy was finely

minced using sterile scalpel blades and individual cells dispersed with Liberase

Blendzyme III in HBSS and trypsin-EDTA solution (0.25% trypsin in HBSS). Fibroblast

cell contamination was reduced by dual plating the dispersed cells. The dispersed cells

were plated for 2-4 hours to allow for fibroblast attachment; after washing, endometrial

cells were plated on 35 mm wells of six well plates. Cells were grown in culture media

(40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-

Transferrin-Selenium X supplement, and 20% fetal bovine serum) until confluence (6.6+

1.5 d) at 37ºC in a humidified incubator containing 95% air and 5% CO2. Once cells

reached a confluent monolayer, the endometrial cells were rinsed two times with a 1%

bovine serum albumin (BSA) culture media (1% BSA in Hams F-12 and MEM), and 3

ml of fresh 1% BSA culture media (1% BSA in Hams F-12 and MEM, 10 ml/L of

antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement) was

added to each well. Half of the wells were challenged with 250 nM of oxytocin and the

other half remained unchallenged and served as controls (3 replicates per treatment).

Conditioned media was collected and stored at -80ºC until PGF2α and PGFM

concentrations were measured to determine production at 6 and 24 hours post oxytocin

challenge. Commercial EIA kits (Cayman Chemical Co., Ann Arbor, MI) were used to

61

measure the concentration of PGF2α and PGFM in culture medium according to

manufacturer instructions. After all media was removed, five of the eight plates’ cells

were fixed with 100% methanol at 4ºC for 10 minutes and then rinsed with PBS two

times. Cells were removed from wells and stored at -80ºC for protein analysis. Protein

analysis was performed using the Pierce Microplate BCA Protein Assay Kit (Thermo

Scientific, Rockford, IL). Three of the plates were used for characterization of the cells

following the cell proliferation and staining procedures below.

Endometrial Cell Proliferation

After the media was collected for the oxytocin challenge, culture media

containing 10 µmol/L bromodeoxyuridine (BrdU) was added and cells were cultured for

another 24 h. Cells were then washed four times with PBS for 1 minute each and then

fixed in 100% methanol and hydrogen peroxide with a concentration of 0.5% v/v (1

µL/mL) at 4ºC for 10 minutes. The cells were washed with PBS for 5 minutes and

incubated in 2 M HCl for 60 minutes at room temperature. Cells were then washed with

PBS three times for 3 minutes and non-specific binding sites were blocked with 10%

horse serum in PBS (Vector Laboratories; Vectastain Elite ABC Kit) for 20 minutes.

Primary antiserum, mouse anti-BrdU, was diluted 1:1,000 in blocking buffer, applied to

the cells, and incubated overnight at 4ºC. Cells were washed three times in PBS for 5

minutes and incubated with diluted biotinylated secondary antiserum (Vector

Laboratories; Vectastain Elite ABC Kit) for 30 minutes. Following three 5 minute washes

with PBS, the cells were incubated with Vectastain Elite ABC Reagent (Vector

Laboratories) for 30 minutes at room temperature. Cells were washed two times with

62

PBS for 5 minutes. 3, 3’-diaminobenzidine (DAB) substrate (Vector Laboratories) was

applied and monitored until desirable stain developed. To distinguish epithelial cells, dual

staining was performed with a second round of staining using the mouse anti-human

cytokeratin clone AE1/AE3 (1:1,000; Dako, Carpinteria, CA). Prior to addition of the

primary antibody, cells were incubated in PBS and hydrogen peroxide at a concentration

of 0.5% v/v (1 µL/mL) to abolish all endogenous peroxidase activity and the staining

procedures were performed again. In the second round of staining, VIP substrate (Vector

Laboratories) was used to detect immunocomplexes and monitored until desired stain

developed.

Immunofluorescent Staining

Dual immunofluorescent staining was performed to characterize cell types within

the uterine biopsies and endometrial cell cultures. Epithelial cells were demarcated with

mouse anti-human cytokeratin clone AE1/AE3 (1:200; Dako, Carpinteria, CA) and

fibroblast cells were identified with mouse anti-vimentin (1:10,000; Sigma-Alrich,

St.Louis, MO). Cells were rinsed in PBS with 0.2% Trition X for 15 minutes. Following

washing three times in PBS for 5 minutes, non-specific binding sites were blocked by

incubating cells in 0.5% NEN blocking buffer (0.1 M Tris-HCl, 0.15 M NaCl; Perkin-

Elmer) for 60 minutes. Primary antiserum was diluted in 1% bovine serum albumin

(BSA), applied to the cells, and incubated at room temperature for 2 hours. Cells were

washed three times for 10 minutes in PBS. Secondary antiserum (against the appropriate

species immunoglobulin conjugated with Cy2 or Cy3) was diluted 1:500 in 1% BSA and

63

incubated for 60 minutes. The cells were then washed three times in PBS and visually

photographed on a Lieca 4000B microscope with fluorescent imaging capabilities.

Experiment II

To evaluate different culture conditions, four endometrial biopsies were taken

from each of two mares on the second day of behavioral estrus as described previously.

Different culture conditions evaluated included the use of a basement membrane matrix

coating on the bottom of each well and increasing the amount of serum added to the

culture media. Each of the four biopsies were finely minced and dispersed following the

methods described above and plated equally into four wells on six well plates (35 mm

wells). Wells on two of the four plates were coated with BD Matrigel Basement

Membrane Matrix according to the manufacturer instructions. The other two plates were

left uncoated to serve as a control. Cells were grown in culture media (40% Hams F-12,

40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-Transferrin-Selenium

X supplement, and 20% fetal bovine serum) until confluence (6 ± 1.3 days) at 37ºC in a

humidified incubator containing 95% air and 5% CO2. Once cells reached a confluent

monolayer, the endometrial cells were rinsed two times with a 1% BSA culture media

(1% BSA in Hams F-12 and MEM). One basement membrane matrix coated plate and

one uncoated plate received 3 mL of fresh 1% BSA culture media (1% BSA in Hams F-

12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-

Selenium X supplement). The other two plates received 3 mL of media containing 10%

horse serum (40% Hams F-12, 40% MEM, 10 % horse serum, 10 ml/L of antibiotic

antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement). Two wells on

64

each plate were challenged with 250 nM oxytocin and the other two wells served as

controls and were not challenged. Conditioned media was collected and stored at -80ºC

until PGF2α concentrations were measured. Commercial EIA kits (Cayman Chemical

Co., Ann Arbor, MI) were used according to manufacturer instructions.

Statistical Analysis

Significant differences among data were determined by least squares analysis of

variance using the mixed procedure of the Statistical Analysis System (SAS Institute,

Cary, NC, v9.2, 2008). Oxytocin treatment, time, culture conditions, and their

interactions were considered independent variables. Mare was considered random for all

experiments. Prostaglandin F2α production data was transformed for statistical analysis

using the logarithmic 10 due to the non-homogeneity among the variances. A

significance level of P < 0.05 was used for all statistical tests. Results are presented as

non-transformed means ± s.e.m.

65

Results

Endometrial Cell Proliferation and Characterization

Equine endometrial tissue sections contained epithelial cells (Figure 2.1). Equine

endometrial cell cultures were primarily epithelial in origin with few fibroblast cells

present (Figure 2.2) and showed replication at 4, 5, and 7 days of culture (Figure 2.3)

Experiment I

Mean concentrations of PGF2α and PGFM were similar in challenged and control

endometrial cell cultures at 6 and 24 hours (Figures 2.4 and 2.5). Concentrations of

PGF2α were higher (P < 0.05) in equine endometrial cells following 24 hours of culture

as compared to 6 hours of culture (Figure 2.4).

Experiment II

Prostaglandin F2α concentrations did not differ between challenged and control

endometrial cells cultured for 6 or 24 hours, regardless of basement membrane matrix or

addition of horse serum (Figures 2.6 and 2.7). The addition of a basement membrane

matrix increased (P < 0.05) PGF2α concentrations in endometrial epithelial cell cultures

at 6 and 24 hours as compared to cell cultures without a basement membrane matrix. The

addition of horse serum did not affect PGF2α concentrations, regardless of stimulation or

a basement membrane matrix. The use of a basement membrane matrix increased (P <

0.05) the total cell number within the cell cultures, regardless of stimulus, however the

number of epithelial cells did not change with culture condition (Table 2.1).

66

Discussion

Previously, there has been the isolation and culture of endometrial cells reported

in many species. Watson and colleagues (1992) isolated and cultured confluent

monolayers of glandular epithelial and stromal cells from mare endometrium on plastic.

Similarly, we were able to isolate and culture endometrial epithelial cells on plastic and

plastic coated with an extracellular matrix. To the best of our knowledge, this is the first

report of the establishment of equine endometrial cells on a basement membrane matrix.

Epithelial and stromal cell cultures demonstrated different morphology and when

stimulated with oxytocin, glandular epithelial cells produced higher concentrations of

PGF2α as compared to stromal cells at 24 hours (Watson et al., 1992). Watson et al.

(1992) also demonstrated PGF2α concentrations increased with time of incubation, which

is in agreement with our findings. Concentrations of PGF2α produced by glandular

stromal and epithelial cultured cells were not affected by day of cycle or pregnancy status

(Watson et al., 1992). In contrast, Vernon et al., (1981) showed endometrial cultures

from cycling mares produced increasing amounts of PGF2α when harvested from day 4 to

day 16 and declined in tissue harvested on day 20. Prostaglandin F2α concentrations were

significantly higher following two hours of incubation, demonstrating the capacity of the

endometrium to synthesize PGF2α in vitro (Vernon et al., 1981).

In the current study, equine endometrial epithelial cell cultures challenged with

oxytocin failed to release PGF2α. The lack of response to oxytocin reported herein could

be due to a deficiency of oxytocin receptors, although Sharp et al. (1997) demonstrated

oxytocin receptors were present in the endometrium during all stages of the estrous cycle.

67

However, the receptor concentrations during estrus are approximately 25% of the

maximal concentration found on day 14 post ovulation (Sharp et al., 1997), therefore,

endometrial biopsies taken on day 2 of behavioral estrus should have oxytocin receptors

present, although concentrations of oxytocin receptors was not evaluated during this

study. Another possibility is that during preparation of the endometrial biopsy for culture,

digestion of the endometrial tissue could have caused a disruption of the cell’s surface

and interfered with the oxytocin receptor. However, equine endometrium digested

similarly still was able to respond to oxytocin stimulation in culture, demonstrating the

presence and function of the oxytocin receptor (Watson et al., 1992). There could also be

a disruption of enzymes or signals within the prostaglandin biosynthesis pathway, leading

to gaps in the oxytocin receptor mediated signaling pathway. An evaluation of the

oxytocin receptor, concentrations, and function would be important to ensure the

prostaglandin biosynthesis pathway is intact and functional in these culture systems.

Other possible reasons for a failure to detect a response from the endometrial cell

cultures include lack of sufficient animal numbers and potentially insufficient cell

number within the cultures. There were only five mares used for the oxytocin stimulated

PGF2α release experiment; possibly if animal numbers were increased, a difference in

PGF2α concentrations could be detected. In another study performed by our lab,

endometrial explant cultures from ten mares had greater concentrations of PGF2α when

stimulated with oxytocin as compared to controls (Penrod et al, unpublished, Chapter 3 of

Dissertation). Even though endometrial cell cultures were grown to approximately 90%

confluence, low epithelial cell numbers could be a probable cause for low PGF2α

68

concentrations. Other endometrial cell cultures are plated by cell number and consist of

105 or 10

6 cells (Mattos et al., 2003; Watson et al., 1992), possibly increasing the

detectable concentrations of PGF2α in the culture system. Total cell numbers within our

culture system were around 104 cells, much lower than other endometrial epithelial

cultures.

Endometrial epithelial cells lose their shape and tight lateral junctions when

cultured for several days on glass or plastic surfaces, causing a loss in cell function and

polarity (Classen-Linke et al., 1997). Classen-Linke and colleagues (1997) have shown in

order to keep the cell’s polarity and differentiated functions, the epithelial cells must have

contact with the extracellular matrix and access to substrates. Uterine epithelial cell

characteristics depend largely upon their culture environment (Glasser et al., 1988).

Glasser and colleagues (1988) demonstrated uterine epithelial cells cultured on a matrix-

coated surface resembled characteristics and functions displayed in vivo. The technique

of using an extracellular matrix for endometrial cell culture has been used in various

animal models (Glasser et al., 1988; Jacobs et al., 1990; Mahfoudi et al., 1991) to

improve cell function. Glandular epithelial cells from guinea pig endometrium cultured

on Matrigel-coated dishes exhibited ultrastructural features similar to those of

endometrial epithelial cells in vivo and contained progesterone receptors (Mahfoudi et al.,

1991). Based on these findings, the extracellular matrix was utilized to aid in cell growth

and function. Equine endometrial cells cultured on an extracellular matrix produced

higher concentrations of PGF2α than endometrial cells cultured on plastic, although the

response was similar between non-challenged and oxytocin challenged endometrial cells

69

grown on a matrix. These findings would indicate the extracellular matrix allowed for

additional growth, attachment, and replication of cultured equine endometrial cells, but

did not change the cells responsiveness to oxytocin. The number of endometrial epithelial

cells was similar between cultures with a matrix and cultures without a matrix, however

there was an increase in total cell number. Perhaps the addition of a membrane matrix

leads to better functioning cells, but also increases the attachment and growth of non-

epithelial cells.

The appearance of endometrial epithelial cells in this study grown on a plastic

surface looked flattened and clumped together, lacking the 3D structure seen in vivo. In

contrast, the endometrial epithelial cells plated on a basement membrane matrix coated

surface demonstrated a round, 3D appearance. The cells looked as though they were

growing up off the matrix coated plate, as opposed to flattened on the plate. The cells

appeared to have structure, forming an environment similar to that seen in vivo. Epithelial

cells in both culture conditions were larger and rounder than fibroblast cells seen towards

the end of the culture period.

In conclusion, equine endometrial cells were established and shown to replicate in

culture and on a basement membrane matrix. Although endometrial epithelial cells were

shown to replicate and were viable in vitro, functional competency was not demonstrated

as measured by a failure to elicit a PGF2α release upon oxytocin stimulation. More work

is necessary to define a cell culture system that is capable of secreting PGF2α when

stimulated with oxytocin. Future work is needed to determine the cause of the low PGF2α

response from equine endometrial cell cultures in order to produce a viable and

70

functional system that can be used as a model to further evaluate the uterine

inflammatory process.

71

Figure 2.1 Equine endometrial tissue sections stained with a) DAPI (blue stained cells) at

10x b) tissue section with both DAPI and Cytokeratin (green stained cells) at 10x

magnification and c) tissue section stained with both DAPI and Cytokeratin at 20x

magnification.

a) b)

c)

72

Figure 2.2 Equine endometrial cell cultures following 6 days incubation stained with a)

DAPI (blue stained cells) b) epithelial cell staining with primary antiserum Cytokeratin

(green stained cells) and c) cells that are both stained with DAPI and Cytokeratin.

c)

b) a)

73

Figure 2.3 Equine endometrial cell cultures following 24 h incubation with BrdU (brown

stained cells) and epithelial cell staining with primary antiserum Cytokeratin (pink

stained cells) at a) 4 days, b) 5 days, and c) 7 days in culture. Cells that are both stained

with BrdU and Cytokeratin are replicated epithelial cells.

a)

c)

b)

74

Figure 2.4 Prostaglandin F2α (PGF2α) concentrations (mean + s.e.m) at 6 and 24 hours in

the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for equine

endometrial cell cultures. a,b

Means with different superscripts differ (P < 0.05).

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

5.5

6

Oxy - Oxy + Oxy - Oxy +

6h 24h

PG

F2α

Co

nce

ntr

atio

n (

pg/µ

g o

f p

rote

in)

a a

b

b

75

Figure 2.5 Prostaglandin F2α metabolite (PGFM) concentrations (mean + s.e.m) at 6 and

24 hours in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for

equine endometrial cell cultures.

0

5

10

15

20

25

30

35

40

- Oxy + Oxy - Oxy + Oxy

6 h 24 h

PG

FM

Co

nce

ntr

atio

n

(pg/

10

,00

0 e

pit

hel

ial

cell

s)

76

Figure 2.6 Prostaglandin F2α (PGF2α) concentrations at 6 hours for equine endometrial

cell cultures grown with or without a basement membrane matrix and without (“0%”) or

with (“10%”) additional horse serum added to the culture media. Endometrial cell

cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin. a,b

Means with different superscripts differ (P < 0.05).

0

0.5

1

1.5

2

2.5

3

3.5

4

No Yes

PG

F2α

Co

nce

ntr

atio

n

(µg/n

um

ber

of

epit

hel

ial

cell

s)

Oxytocin

Matrix 0%

Matrix 10%

No Matrix 0%

No matrix 10%

b b

b

b

a

a

a

a

77

Figure 2.7 Prostaglandin F2α (PGF2α) concentrations at 24 hours for equine endometrial

cell cultures grown with or without a basement membrane matrix and without (“0%”) or

with (“10%”) additional horse serum added to the culture media. Endometrial cell

cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin. a,b

Means with different superscripts differ (P < 0.05).

0

2

4

6

8

10

12

14

No Yes

PG

F2α

Co

nce

ntr

atio

n

(µg/n

um

ber

of

epit

hel

ial

cell

s)

Oxytocin

Matrix 0%

Matrix 10%

No Matrix 0%

No matrix 10%

a

a

b b b b

a

a

78

Table 2.1 Epithelial and total cell number within each culture condition system.

a,b Means with different subscripts differ ( P < 0.05).

*0% HS- No additional horse serum added to media and without matrix, 0% + M- No

additional horse serum added to media and with a matrix, 10% HS- Additional horse

serum added to media and without a matrix, 10% HS + M- Additional horse serum added

to media and with a matrix

Culture

Condition*

Oxytocin Epithelial

Cells

Total Cells % Epithelial

Cells

0% HS (-) 8177.5 9684a

84%

0% HS (+) 8324.5 9554.5a 85%

0% HS + M (-) 8063 12177.5b

71%

0% HS + M (+) 8091.5 11101.5b

76%

10% HS (-) 8380 12005a

70%

10% HS (+) 9415.5 11361a

83%

10% HS + M (-) 9355 14475b

68%

10% HS + M (+) 8590 14130b

65%

79

CHAPTER 3

OXYTOCIN STIMULATED RELEASE OF PGF2α AND INHIBITION OF PGF2α

RELEASE BY A CYCLOOXYGENASE INHIBITOR, INDOMETHACIN, AND

AN OXYTOCIN RECEPTOR ANTAGONIST, ATOSIBAN, FROM EQUINE

ENDOMETRIAL CULTURES

Abstract

Uterine inflammation is one of the causes of a poor uterine environment. This can

result in early embryonic loss in the mare due to an inhibition of maternal recognition or

an increased secretion of prostaglandin F2α (PGF2α). Oxytocin binds to endometrial cell

receptors to activate prostaglandin synthesis. Atosiban, an oxytocin receptor antagonist,

and Indomethacin, a cyclcooxygenase inhibitor, both decrease PGF2α production. Equine

endometrial explants were harvested on day two of behavioral estrus to determine effects

of Atosiban and Indomethacin on PGF2α secretion. Endometrial explant cultures were

challenged with oxytocin (250 nM) and PGF2α concentrations over time were measured.

Explants were also cultured with increasing concentrations of Atosiban and Indomethacin

for 6 hours to determine the influence on PGF2α secretion. When endometrial explants

were challenged with oxytocin, PGF2α concentrations were higher (P < 0.0001) at each

time point over the 24 hours culture as compared to controls. Oxytocin failed (P < 0.001)

to elicit PGF2α release in explants cultured with either inhibitor. In conclusion equine

endometrial explants can be stimulated with oxytocin to increase secretion of PGF2α and

this secretion can be inhibited through an oxytocin receptor antagonist and Cox inhibitor,

80

suggesting that this response to oxytocin involves an oxytocin receptor mediated event

that activates the prostaglandin synthesis cascade through cyclooxygenase.

81

Introduction

Uterine infection, inflammation, and early embryonic loss are factors contributing to

low pregnancy rates in the equine industry. Infection and inflammation are likely the

primary causes of creating a poor uterine environment (Adams et al., 1987; Saltiel et al.,

1986; Dimcock and Edwards, 1928) and often result in early embryonic loss. The natural

inflammatory response induced by breeding can decrease conception rates in older mares

or mares susceptible to infection. In the healthy mare, post-breeding inflammation is

usually cleared within twenty-four hours (Katila, 1995). In older mares and mares

susceptible to delayed uterine clearance, the inflammation persists due to fluid

accumulation that cannot effectively be dispelled. Uterine prostaglandin F2α (PGF2α)

secretion is triggered by the influx of polymorphonuclear neutrophils (PMNs) into the

uterus (Troedsson, 1999). Prostaglandin F2α is responsible for myometrium contractions,

and subsequent expulsion of contaminating fluid and debris from the uterus.

Currently, exogenous oxytocin administration is used to improve uterine clearance in

mares prone to infection or persistent endometritis (Cadario et al., 1999). In vivo

oxytocin-stimulated PGF2α release is dependent on day of cycle in the mare (Sharp et al.,

1997). Circulating concentrations of PGFM were increased in cycling mares

administered oxytocin on days 10, 14, and 18 post ovulation, with the highest response

on day 14 (Starbuck et al., 1998). Similarly, cultured equine endometrial explants showed

variable response to oxytocin with maximum release from explants harvested on day 14

post ovulation (King and Evans, 1987). In contrast, equine endometrial glandular

epithelial and stromal cells’ response to oxytocin stimulation during culture was not

82

dependent on stage of cycle or pregnancy (Watson et al., 1992). However, endometrial

glandular epithelial cells produced more PGF2α than stromal cells after 24 hours of

culture (Watson et al., 1992). The differences found in PGF2α secretion from endometrial

tissue harvested throughout the estrous cycle could be due to the type of culture system

used. In the study by Watson and colleagues (1992), the cell cultures were divided into

epithelial and stromal, possibly suggesting a role for cell type in the secretion of PGF2α

based on day of the cycle. The length of culture could also influence the release of PGF2α

in cell versus explant cultures.

Oxytocin binds to endometrial cell membrane receptors coupled with G proteins to

activate prostaglandin synthesis (Gimpl and Fahrenholz, 2001). Atosiban, an oxytocin

receptor antagonist, blocks the binding of oxytocin to its receptor, preventing second

messenger formation (Phaneuf et al., 1994). Atosiban and similar oxytocin antagonists

have been primarily used in human uterine cell cultures to inhibit myometrial

contractions (Buscher et al., 2001) and clinically in women to aid in the prevention of

preterm myometrium contractions and preterm labor (Eogan and McKenna, 2004).

Cyclooxygenase-1 and 2 (Cox-1, 2) are responsible for converting arachidonic acid (AA)

into prostaglandin H2 (PGH2), which is further reduced into PGF2α by prostaglandin F

synthase or isomerized into PGE2 by prostaglandin E synthase (Smith, 1992).

Indomethacin, a non-steroidal anti-inflammatory, blocks Cox from converting AA into

PGH2 and therefore prevents the production of prostaglandins.

The purpose of this study was to 1) establish equine endometrial explant cultures, 2)

determine the effects of oxytocin stimulation over time, and 3) evaluate the effects of an

83

oxytocin receptor antagonist and a Cox inhibitor on prostaglandin production during

culture.

84

Materials and Methods

Materials

Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum

albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were

purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-

transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine

serum (FBS) was from HyClone (Logan, UT). The oxytocin antagonist, Atosiban, was

from BioVender (Candler, NC) and Cox inhibitor, Indomethacin, from Sigma-Aldrich

(St. Louis, MO). Oxytocin was purchased from MWI Veterinary Supply (Boise, ID).

Animals

A total of ten mature cycling mares of light horse breeding and of various age

(12.6 years ± 5) were utilized and housed at The University of Arizona Equine Center.

Mares were teased with a stallion daily for detection of behavioral estrus. Follicular

development and uterine edema were monitored by transrectal palpation and

ultrasonography every day from the first detection of behavioral estrus through ovulation.

All animal procedures were reviewed and approved by the Institutional Animal Care and

Use Committee at The University of Arizona.

Oxytocin Dose Response

An oxytocin dose response was performed using equine endometrial explants.

One endometrial biopsy was taken from each of seven mares of light horse breeding on

day two of behavioral estrus. The biopsy was recovered non-surgically using a cattle

biopsy instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw,

85

Richard Wolf Medical Instruments Corporation, Vernon Hills, IL). Uterine tissue was

removed aseptically from the biopsy punch and placed into HBSS supplemented with 2X

antibiotic-antimycotic solution. The biopsy was transported to the laboratory on ice

within 30 minutes of harvest. Uterine tissue was rinsed with fresh HBSS. Uterine tissue

was minced into equal sections, divided into 6 wells (35 mm) and covered with 3 ml of

fresh media per well (40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic,

200 U/L of Insulin-Transferrin-Selenium X supplement, and 20% fetal bovine serum).

Explants were acclimated for 90 minutes at 37ºC in a humidified incubator in the

presence of 95% air and 5% CO2, as we have previously shown endometrial explants

require an acclimatization period prior to culture (data unpublished, 2009). Following 90

minutes of incubation, explants were rinsed one time with fresh 1% BSA culture media

(1% BSA in Hams F-12 and MEM). Each well received 2 ml of fresh 1% BSA culture

media (1% BSA in Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L

of Insulin-Transferrin-Selenium X supplement) and then challenged with increasing

doses of oxytocin (0, 31.25, 62.5, 125, 250, or 500 nM). Media was collected and stored

at -80ºC until PGF2α analysis.

Uterine Endometrial Explant Culture Response to Oxytocin

One endometrial biopsy was taken from each of ten mares on the second day of

behavioral estrus as previously described. The endometrial biopsy was minced into six

equal sections and divided into six wells (35 mm), then covered with 3 ml of fresh media

per well (40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of

Insulin-Transferrin-Selenium X supplement, and 20% fetal bovine serum). Following 90

86

minutes of acclimation in a humidified incubator in the presence of 95% air and 5% CO2,

explants were then washed one time with fresh 1% BSA culture media (1% BSA in Hams

F-12 and MEM) and each well received 3 ml of fresh 1% BSA culture media (1% BSA in

Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L of Insulin-

Transferrin-Selenium X supplement). Half the explants were challenged with 250 nM

oxytocin and the remaining half served as a control and did not receive oxytocin.

Following the oxytocin challenge, 500µL of media was collected at half an hour, 1, 2, 6,

and 24 hours. Conditioned media was collected and stored at -80ºC until PGF2α analysis.

Uterine Endometrial Explant Cultures in the presence of Inhibitors

Two endometrial biopsies were taken from each of five mares of light horse

breeding on the second day of estrus using methods described above. The biopsies were

minced into ten equal sections and plated into 10 single wells (35 mm) on 2-6 well plates

for incubation. Explants were allowed to acclimate for 90 minutes at 37ºC in a humidified

incubator, then washed one time with fresh 1% BSA culture media (1% BSA in Hams F-

12 and MEM). Two wells served as controls and received 3 ml of fresh 1% BSA culture

media (1% BSA in Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L

of Insulin-Transferrin-Selenium X supplement) without the addition of an inhibitor.

Other pairs were divided and received one of the following treatments: 1% BSA media (3

ml) containing either 4 µg/ml of Indomethacin, 8 µg/ml of Indomethacin, 50 µg/ml of

Atosiban, or 100 µg/ml of Atosiban. Following 30 minutes of acclimation, one well from

each treatment was left un-stimulated (control) and one well was stimulated with 250 nM

of oxytocin. Following the oxytocin challenge, 300 µl of media was collected at half an

87

hour, 1, 2, 6, and 24 hours. Conditioned media was collected and stored at -80ºC until

PGF2α concentrations were determined.

Enzyme Immunoassay

Commercial EIA kits (Cayman Chemical Co., Ann Arbor, MI) were used to

measure the concentration of PGF2α in culture medium according to manufacturer

instructions.

Statistical Analysis

Significant differences among treatments were determined by least square

analysis of variance using the mixed procedure of Statistical Analysis System (SAS

Institute, Cary, NC, v9.2, 2008). Oxytocin, time, inhibitor and their interactions were

considered independent variables. Mare was considered random for all experiments.

Prostaglandin F2α production over time data was transformed for statistical analysis using

logarithmic 10 due to the non-homogeneity among the variances. A significance level of

P < 0.05 was used for all statistical tests. Results are presented as non-transformed means

± s.e.m.

88

Results

Oxytocin Dose Response

Oxytocin stimulated (P < 0.05) PGF2α release from endometrial explants in a dose

dependent fashion (Figure 3.1). Specifically, stimulation with 31.25 nM of oxytocin did

not increase concentrations of PGF2α when compared to the non-stimulated explants. The

PGF2α response plateaued at 125 nM, with oxytocin concentrations of 62.5, 125, 250,

500, 1000, and 1500 nM having the same influence on PGF2α release.

Oxytocin Stimulated PGF2α Production Over time

When endometrial explants were challenged with 250 nM of oxytocin,

concentrations of PGF2α were higher (P < 0.0001) at each time point over the 24 hours of

culture compared to non-stimulated explants (Figure 3.2). In both challenged and

unchallenged explants PGF2α concentrations did not increase through 2 hours of culture,

but increased (P < 0.001) at 6 and 24 hours, respectively.

Inhibition of PGF2α release in Endometrial Explants

Concentrations of PGF2α were higher (P < 0.02) following 6 hours of culture in

endometrial explants challenged with oxytocin as compared to non-stimulated explants

(Figure 3.3). Moreover, oxytocin failed (P < 0.001) to elicit PGF2α release in endometrial

explants cultured with an oxytocin receptor antagonist or a Cox inhibitor.

89

Discussion

The data reported herein demonstrates that equine endometrial explant cultures

release PGF2α in a dose dependent fashion when stimulated with increasing

concentrations of oxytocin and is similar to what has been previously reported in the

literature in the equine (Nash et al., 2008; King and Evans, 1987; Watson et al., 1992),

porcine (Blitek and Ziecik, 2004), and the bovine (Mann, 2001; Hearth et al., 2009).

Although not tested in this study, others have found in equine and porcine endometrial

cell cultures, epithelial cells secreted higher concentrations of PGF2α as compared to

stromal cells (Watson et al., 1992; Blitek and Ziecik, 2004).

This is the first study to show that the oxytocin stimulated PGF2α release in

equine explants is specific to an oxytocin receptor mediated event as demonstrated by the

inhibition of PGF2α release when stimulated with oxytocin in the presence of an oxytocin

antagonist. This inhibition is similar to that seen in an in vitro study using oxytocin

stimulated myometrial strips from pregnant women (Buscher et al., 2001). Similarly,

Phaneuf and colleagues (1994) found Atosiban to inhibit oxytocin induced myometrial

cell activation in cultured human myometrium.

The oxytocin stimulated release of PGF2α from equine endometrial explants reported

here also involves the enzyme Cox. The Cox inhibitor, Indomethacin, equally impeded

the secretion of PGF2α in oxytocin stimulated equine endometrial explants when

compared to the oxytocin receptor antagonist, Atosiban. The inhibition of PGF2α release

by Indomethacin is similar to what others have reported in equine and bovine endometrial

cultures (King and Evans, 1987; Asselin et al., 1997).

90

In conclusion, the data reported herein supports, as others earlier have reported, equine

endometrial explant cultures stimulated with oxytocin have increased secretion of PGF2α.

Moreover, this study establishes that PGF2α secretion can be inhibited through the

oxytocin receptor antagonist, Atosiban; as well as by the cyclooxygenase inhibitor,

Indomethacin. This response involves an oxytocin receptor mediated event that activates

the prostaglandin synthesis cascade. The described culture system offers an experimental

model that can now be used to determine the effects of other factors, such as diet, on the

production of PGF2α from the equine endometrium.

91

Figure 3.1 Prostaglandin F2α concentrations (PGF2α) (+ s.e.m) in equine endometrial

explant cultures after 24 h in the absence or presence of increasing concentrations of

oxytocin. a,b,c

Means with different superscripts differ (P < 0.05).

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

5.5

6

6.5

0 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500

PG

F2α

Co

nce

ntr

atio

ns

(pg/µ

g o

f p

rote

in)

Oxytocin (nM)

a

a,b

b,c

b,c b,c

c

a,b,c

a,b,c

92

Figure 3.2 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant

cultures during 24 h of culture in the absence (- Oxy) or presence (+ Oxy) of oxytocin. x,y

Means within each time point differ (P < 0.0001). a,b,c

Means with different superscripts

differ within each treatment (P < 0.0001).

-1

0

1

2

3

4

5

6

7

8

9

10

11

12

13

0 2 4 6 8 10 12 14 16 18 20 22 24

PG

F C

once

ntr

atio

ns

(pg/µ

g o

f p

rote

in)

Time (hours)

(-) Oxy

(+) Oxy

b,x

c,x

a,xa,xa,

x

a,y a,y a,y

b,y

c,y

93

Figure 3.3 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant

cultures in response to oxytocin after 6 h of culture with increasing concentrations of

Indomethacin or Atosiban. a,b

Means with different superscripts differ (P < 0.02).

0

1

2

3

4

5

6

7

8

9

10

11

(-) Oxy (+) Oxy

PG

F2α

Co

nce

ntr

atio

n (

pg/µ

g o

f p

rote

in)

None

Indomethacin-4µg/ml

Indomethacin-8µg/ml

Atosiban-50µg/ml

Atosiban-100µg/ml

b

aa a

a aa

a

aa

94

CHAPTER 4

EFFECTS OF OXYTOCIN, LPS, AND POLYUNSATURATED FATTY ACIDS

ON PROSTAGLANDIN SECRETION AND GENE EXPRESSION IN EQUINE

ENDOMETRIAL EXPLANT CULTURES

Abstract

Dietary supplementation with polyunsaturated fatty acids (PUFAs) has been

shown to influence uterine prostaglandin production in many species, although the effect

of PUFAs on uterine inflammatory response in the mare remains unknown. To determine

the effects of PUFAs on equine endometrial prostaglandin production, endometrial

biopsies were harvested on day two of behavioral estrus. Fatty acid uptake of arachidonic

acid (AA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) by equine

endometrial explants was evaluated using gas liquid chromatography. Equine endometrial

explants were also treated with 100 µM of AA, EPA, or DHA and then challenged with

oxytocin (250nM) or lipopolysaccharide (LPS, 1 µg/ml). Prostaglandin F2α and E2

production was measured and the relative mRNA expression of key enzymes involved in

prostaglandin synthesis was determined using quantitative real-time PCR. Equine

endometrial explants incorporated EPA (P < 0.05) and DHA (P < 0.01) during culture for

24 hours with the addition of fatty acids. There was a tendency (P < 0.06) for explants to

incorporate AA. Prostaglandin F2α and E2 concentrations were higher (P < 0.0001) in

endometrial explants challenged with oxytocin or LPS as compared to controls despite

which fatty acid was added. Moreover, oxytocin stimulated explants to a greater (P <

0.007) extent than LPS. Only DHA inhibited (P < 0.0001) PGF2α and PGE2 secretion in

95

non-stimulated and stimulated (with oxytocin or LPS) explants. Endometrial explants

stimulated with oxytocin had increased expression of Cox-1 (P < 0.02), Cox-2 (P <

0.001), PGFS (P < 0.01), PGES (P < 0.01), and PLA2 ( P < 0.005) as compared to

controls and regardless of fatty acid treatment. Explants stimulated with LPS had

increased expression of Cox-2 (P < 0.004), PGFS (P < 0.03), PGES (P < 0.01), and PLA2

(P < 0.01) as compared to controls and regardless of fatty acid treatment. In conclusion,

supplementation with PUFAs, specifically DHA, can influence the inflammatory

response in vitro through mechanisms other than enzyme expression. Decreased PGF2α

production associated with PUFA supplementation in vitro, creates a likely approach for

decreasing early embryonic loss in vivo associated with post breeding inflammation

commonly seen in the equine industry.

96

Introduction

Early embryonic loss in the mare can be caused by a lack of maternal inhibition of

prostaglandin F2α (PGF2α) or increased secretion of PGF2α due to uterine inflammation.

Increased secretion or accumulation of PGF2α within the uterus causes luteolysis of the

corpus luteum and results in embryonic loss. Strategies to increase embryonic survival in

older mares or mares susceptible to uterine infection include decreasing or inhibiting

PGF2α secretion. Supplementation with polyunsaturated fatty acids (PUFAs),

eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), have been shown to

decrease PGF2α release in vivo (Mattos et al., 2000; Perez et al., 2006) and in vitro

(Arntzen et al., 1998; Mattos et al., 2003; Caldari-Torres et al., 2006) using human, rat,

and bovine models. Petit et al. (2002) showed that cows receiving a diet supplemented

with polyunsaturated fatty acids had a lower incidence of early embryonic loss.

Supplementation of mares with EPA and/or DHA could decrease PGF2α secretion within

the uterus and help prevent premature luteolysis and early embryonic loss as seen in

cattle (Mattos et al., 2000).

In this study, our objectives were to determine AA, EPA, and DHA uptake in

equine endometrial explants and to evaluate their influence on PGF2α and PGE2 secretion

and expression of enzymes involved in prostaglandin synthesis.

97

Materials and Methods

Materials

Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum

albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were

purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-

transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine

serum (FBS) was from HyClone (Logan, UT). Escherichia coli lipopolysaccharide (LPS,

serotype 026:B6) was from Sigma-Alrich (St. Louis, MO). The fatty acids EPA (C20:5,

n-3), DHA (C22:6, n-3) and AA (C20:4, n-6) and PGE2 and PGF2α EIA kits were

purchased from Cayman Chemical Company (Ann Arbor, MI).

Animals

A total of ten mature cycling mares of light horse breeding and various age (12.6

years ± 5) were utilized and housed at The University of Arizona Equine Center. Mares

were teased with a stallion daily for detection of behavioral estrus. Follicular

development and uterine edema were monitored by transrectal palpation and

ultrasonography every day from the first detection of behavioral estrus through ovulation.

All animal procedures were reviewed and approved by the Institutional Animal Care and

Use Committee at The University of Arizona.

Fatty acid preparation

Stock solutions of polyunsaturated fatty acids were diluted in 1 ml of ethanol (50

mg/ml) and stored at -80ºC until further use. At preparation of culture media with fatty

acids, fatty acids were diluted with 1% bovine serum albumin (BSA) culture media (1%

98

BSA in Hams F-12 and MEM) to a concentration of 100 nM. These solutions were

incubated for 1 h in a water bath at 37ºC to allow for binding of the fatty acids within the

media and then further diluted with 1% BSA culture media to final concentration of 100

µM per well.

Experiment I: fatty acid uptake

Two endometrial biopsies were collected from each of four mares on the second

day of behavioral estrus. The biopsies were recovered non-surgically using a cattle

biopsy instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw,

Richard Wolf Medical Instruments Corporation, Vernon Hills, IL). Uterine tissue was

removed aseptically from the biopsy punch and placed into 10 ml of HBSS supplemented

with 2X concentration of Antibiotic-Antimycotic solution. Biopsies were transported to

the laboratory on ice within 30 minutes of harvest. Uterine tissue was rinsed with fresh

HBSS. Endometrial biopsies were minced into 10-12 mm2 sections and were divided into

five 35 mm wells on a six well plate. Explants were incubated in 3 ml of fresh media

(40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-

Transferrin-Selenium X supplement, and 20% fetal bovine serum) for 90 minutes at 37ºC

in a humidified incubator containing 95% air and 5% CO2. Explants were then rinsed

one time with fresh 1% BSA culture media (1% BSA in Hams F-12 and MEM) and each

well received 3 ml 1% BSA culture media (1% BSA in Hams F-12 and MEM, 10 ml/L of

antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement)

containing one of the following treatments: control (1% BSA culture media in Hams F-12

and MEM with 1.8 µl ethanol), 100 µM AA, 100 µM EPA, 100 µM DHA, or 50 µM

99

EPA + 50 µM DHA. After 24 hours of culture, explants were collected in 1.5 ml tubes

and stored at -80ºC until analysis. Fatty acid content of the endometrial explants was

measured using gas liquid chromatography.

Experiment II: effect of PUFAs on PG release and gene expression

Four endometrial biopsies were taken from each of eight mares on the second day

of behavioral estrus using methods described above. Biopsies were minced and divided

into twenty-four sections and plated into individual wells on 6 well plates (4 wells per

plate). On each plate, each of the wells received one of the following treatments in 2.5 ml

of 1% BSA culture media: control (no treatment), 100 µM AA, 100 µM EPA, or 100 µM

DHA. After the addition of the treatments, explants were incubated for 24 hours to allow

fatty acid uptake. Following incubation, two plates served as control and did not receive

any stimulant, two plates were stimulated with oxytocin (250 nM), and two plates were

stimulated with LPS (1 µg/ml). Conditioned media was collected at 6 and 24 h and stored

at -80ºC until PGF2α and PGE2 analysis. Commercial EIA kits were used according to

manufacturer instructions to measure PGF2α and PGE2. Endometrial explant tissue was

collected and stored in 1.5 ml tubes at -80ºC until gene expression analysis. Three plates

(one plate from each stimulant) served for analysis of prostaglandin production and the

other three plates for gene expression analysis.

RNA extraction and quantitative real-time PCR (qPCR)

Total RNA from equine endometrial explants (n=7) was extracted using the

Qiagen RNeasy Protect Mini Kit (Qiagen, Valencia, CA). Primers were designed to

measure gene expression for five genes involved in the prostaglandin biosynthesis

100

pathway. Details of the primer sets used are listed in Table 4.1. The relative expression of

Cox-1 and 2, PGFS, PGES, and PLA2 mRNA transcripts were measured by quantitative

real-time PCR using QuantiTect SYBR Green RT-PCR Master Mix (Qiagen, Valencia,

CA) in an iQ5 Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA).

After initial denaturation at 95ºC for 15 minutes, the PCR reactions were subjected to 40

cycles of 95ºC for 30 seconds, 60ºC for 30 seconds and 72ºC for 10 seconds. A melt

curve analysis was performed starting at 60ºC with an increase of 0.2ºC every 6 seconds

to 96ºC at the end of the amplification to confirm homogeneity among products.

Duplicate RNA samples were measured and threshold cycles were normalized to

a reference gene (ribosomal protein S15) using the comparative ∆ Ct method (CT gene of

interest – CT reference gene), and fold changes (∆∆ CT) were determined using the Pfaffl

(Pfaffl, 2001) and Livak Method (Livak and Schmittgen, 2001).

Statistical Analysis

Significant differences among treatments were determined by least squares

analysis of variance using the mixed procedure of the Statistical Analysis System (SAS

Institute, Cary, NC, v9.2, 2008). Fatty acid treatment, stimulant, time, and their

interactions were considered the independent variables. Mare was considered random for

all experiments. Data for prostaglandin F2α production in the presence of fatty acids and

stimulants was transformed for statistical analysis using logarithmic 10 due to the non-

homogeneity among the variances. A significance level of P < 0.05 was used for all

statistical tests. Results are presented as non-transformed means ± s.e.m.

101

Results

Experiment I

Endometrial explants incorporated EPA (P < 0.05) and DHA (P < 0.01) when

cultured with fatty acids for 24 hours. There was a tendency (P < 0.06) for explants to

incorporate AA (Figure 4.1).

Experiment II

The affect of stimulant and fatty acid treatment on PGF2α and PGE2 secretion are

presented separately as means due to a lack of stimulant by fatty acid treatment

interaction (Figures 4.2 and 4.3). Prostaglandin F2α and E2 concentrations were higher (P

< 0.0001) in endometrial explants challenged with oxytocin or LPS as compared to

controls despite the addition of fatty acid treatment (Figures 4.2a and 4.3a). Moreover,

oxytocin stimulated explants to a greater (P < 0.007) extent than LPS.

When explants were stimulated with oxytocin or LPS, only DHA inhibited (P <

0.0001) PGF2α and PGE2 secretion (Figures 4.2b and 4.3b). The addition of AA and EPA

failed to influence PGF2α or PGE2 secretion from equine endometrial explants.

qPCR

Endometrial explants stimulated with oxytocin had increased expression of Cox-1

(P < 0.02), Cox-2 (P < 0.001), PGFS (P < 0.01), PGES (P < 0.01), and PLA2 ( P < 0.005)

as compared to controls and regardless of fatty acid treatment (Table 4.2). Explants

stimulated with LPS had increased expression of Cox-2 (P < 0.004), PGFS (P < 0.03),

PGES (P < 0.01), and PLA2 (P < 0.01) as compared to controls and regardless of fatty

102

acid treatment. Fatty acid treatment with AA, EPA, or DHA failed to influence the

expression of any of the genes analyzed.

103

Discussion

Herein we report for the first time the response of equine endometrial explants

cultured with fatty acids and stimulated with LPS or oxytocin. As expected, oxytocin

stimulated PGF2α release from endometrial explants, as has been previously

demonstrated in vitro in equine endometrial tissue (King and Evans, 1987; Watson et al.,

1992). However, this is the first report of oxytocin stimulated release of PGE2 from

equine endometrial explants. Similar to PGE2 concentrations found in porcine epithelial

endometrial cells (Blitek and Ziecik, 2004), concentrations of PGE2 from stimulated

equine endometrial explants were less than half that of PGF2α concentrations. Although

we did not determine PGE2 origin, PGE2 has been shown to be mainly secreted from

endometrial stromal cells (Blitek and Ziecik, 2004). We have also demonstrated PGF2α

and PGE2 secretion increased in equine endometrial explants stimulated with LPS,

although to a lesser extent than with oxytocin stimulation. Similarly, equine (Nash et al.,

2008) and bovine (Herath et al., 2006) endometrial explants had increased concentrations

of PGF2α when stimulated with LPS. The secretion of PGE2 in response to LPS

stimulation has not previously been shown in equine endometrial explants; although rat

hypothalamic explants (Pozzoli et al., 1994), human ciliary epithelial cells (Yadav et al.,

2010), and equine synovial tissue (Briston et al., 2010) treated with LPS had increased

concentrations of PGE2 which is similar to the response we found in equine endometrial

explants.

Supplementation with DHA decreased secretion of PGF2α and PGE2 from equine

endometrial explants which is similar to results seen in bovine (Mattos et al., 2003;

104

Caldari-Torres et al., 2006) and ovine (Kirkup et al., 2010) endometrial epithelial cells,

human decidual cells (Arntzen et al., 1998; Roman et al., 2006), and rat uteri (Perez et al.,

2006). Similar to results we found in equine endometrial explants, EPA did not influence

prostaglandin secretion in decidual cell cultures (Roman et al., 2006) or bovine uterine or

endometrial tissue (Cheng et al., 2001; Meier et al., 2009). Although EPA did not

influence PGF2α or PGE2 release in our study, EPA decreased PGF2α and/or PGE2

secretion in bovine and decidual cell cultures (Arntzen et al., 1998; Mattos et al., 2003;

Caldari-Torres et al., 2006). In contrast, rats supplemented with DHA had higher

concentrations of PGF which the authors attribute to increasing PGF3α. Similar results of

polyunsaturated fatty acids increasing 1 and 3 series prostaglandins, which are less

biologically active, has been demonstrated in ovine uterine epithelial cells (Cheng et al.,

2005). It is likely supplementation with EPA and/or DHA increases production of 1 and 3

series prostaglandins while decreasing the biologically more active 2 series. Arachidonic

acid has been show to increase PGF2α and PGE2 release from equine endometrial

explants (King and Evans, 1987), bovine endometrial cells (Mattos et al., 2003), ovine

uterine epithelial cells (Cheng et al., 2005) , and human decidual cells (Arntzen et al.,

1998); whereas in our endometrial explants AA did not influence the release of PGF2α or

PGE2. The contrasting data between our study and the King and Evans (1987) study is

unexpected; however the lack of influence by AA in our study could be due to the lack of

detection because of high variation seen between mares.

Decreases in prostaglandin production in association with the supplementation of

polyunsaturated fatty acids could likely be caused by regulation of enzyme expression

105

within the prostaglandin synthesis pathway. However, supplementation with PUFAs did

not affect Cox-1, Cox-2, PGFS, or PLA2 mRNA expression in the bovine uterus (Coyne

et al., 2008) or protein levels in the bovine endometrial cells (Mattos et al., 2003).

Incubation with DHA or EPA did not affect mRNA expression of Cox-1, Cox-2, or

PGDH in decidual cell cultures (Roman et al,. 2006). Similarly, we showed no difference

in enzyme expression in explants cultured with EPA or DHA. In contrast, Coyne and

colleagues (2008) demonstrated bovine receiving a high polyunsaturated fatty acid diet

had increased expression of PGES mRNA and tended to have lower expression of PLA2

mRNA within endometrial tissue. Furthermore, Massaro et al. (2006) showed DHA

decreased Cox-2 protein expression in human vascular endothelial cells. The decrease in

protein expression could be due to variations in the length of incubation with DHA; 48

hours (Massaro et al., 2006) versus 24 hours (Mattos et al., 2003). However, we did

detect a difference in enzyme expression when explants were stimulated with oxytocin or

LPS as compared to controls, similar to what others have reported in vitro in the porcine

myometrium (Franczak et al., 2006) and equine endometrium (Ealy et al., 2010). The

increased enzyme expression would be expected, as oxytocin has been shown to

stimulate PGF2α release in various cell and explant cultures.

In our study, enzymes related to prostaglandin synthesis were not affected by 24

hour culture with EPA or DHA. However, two enzymes not evaluated in this study, but

are needed for oxytocin stimulated prostaglandin release are phospholipase C and protein

kinase C. Changes in expression of these two enzymes could influence the synthesis of

prostaglandins. Human vascular endothelial cells cultured with DHA then stimulated

106

with IL-1α, had decreased prostaglandin secretion likely due to inhibition of protein

kinase C activity (Massaro et al., 2006). Although, DHA decreased prostaglandin

production, it appears not to be modulated through enzyme expression within the

endometrium; therefore DHA could be inhibiting PGF2α secretion through other

mechanisms. Possible mechanisms for this inhibition include 1) shifting production from

2-series prostaglandins to 1 or 3-series prostaglandins, 2) through competition of EPA

and DHA with AA for lipid metabolism and incorporation in the phospholipid

membrane, or 3) DHA is possibly affecting the cell membrane and phospholipid bilayer

and influencing signaling pathways. The transmembrane domain and activation of the

oxytocin receptor could be influenced by DHA if the cell membrane is being altered. It

has been shown that DHA alters basic cell membrane properties including fluidity and

protein function (Stillwell and Wassall, 2003). Docosahexaenoic acid has a strong

aversion to cholesterol causing it to incorporate and packs poorly with other lipids

present in the membrane (Stillwell, 2006). This could create movement of lipid rafts and

other membrane domains, possibly altering the location of key signaling enzymes.

In conclusion, supplementation with polyunsaturated fatty acids, specifically

DHA, can influence the inflammatory response in vitro through mechanisms other than

enzyme expression. Decreased PGF2α production associated with omega-3 fatty acid

uptake in vitro, creates a likely approach for decreasing early embryonic loss in vivo

associated with post breeding inflammation commonly seen in the equine industry.

107

Table 4.1 Equine oligonucleotide primers used in this study

Gene Name Sequence Accession

number

Cox-1 F: 5’GCTACGCGAGCACAACCGTGT DQ246452

R: 5’GCATGAGTGGGTGCCAGTGGT

Cox-2 F: 5’GCCACGATTTGGCTGCGGGAA AB041771

R: 5’GGCACAAGGGGATGCCAGTGA

PGFS F: 5’GCCTGTCTGCAACCAGGTGGA NM_001081895

R: 5’AGGACTGGGGAGTTTGGGGCA

PGES F: 5’GAGGACGCCCTGAGACACGGA NM_001081935

R: 5’GGCCACGGTGTAGGCCAGAGA

PLA2 F: 5’TGTTCGTGCCCAGACCTCCGA NM_001081843

R: 5’AACCTCCGCCTGAGCCCAAGA

108

Table 4.2 Gene expression in equine endometrial explants cultured with PUFAs for 24 h

and stimulated with oxytocin or LPS for 24 h. Quantitative PCR was performed (n =7

except Cox-1, where n=4).

Gene of

Interest

Control ∆CT LPS ∆CT LPS

Fold ∆

Oxytocin

∆CT

Oxytocin

Fold ∆

Cox-1 3.9±0.7 4.3±0.7 0.77 1.7±0.9 4.67*

Cox-2 5.0±1.3 3.2±1.3 3.68* 3.1±1.5 3.74*

PGFS 7.8±0.9 7.8±0.4 1.04* 6.4±0.5 2.77*

PGES 4.6±1.7 4.0±0.9 1.51* 4.3±0.8 1.24*

PLA2 2.0±0.9 0.5±0.9 2.77* 0.4±0.5 3.22*

∆CT ± s.e.m. are presented for control and stimulated explants. Fold change (Fold ∆) in

stimulated explants from control explants was calculated by the 2-∆∆C

T method. Statistical

analysis was performed on ∆CT values with ribosomal protein S15 as the reference gene

(*P < 0.05).

109

Figure 4.1 Proportion of a) AA, b) EPA, and c) DHA content within equine endometrial

explants when cultured with 100 µM AA, 100 µM EPA, 100 µM DHA, or 50 µM EPA +

50 µM DHA for 24 h. Endometrial explants incorporated EPA and DHA and tended to

incorporate AA. *P < 0.05, **P < 0.001.

0

2

4

6

8

10

12

14

100µM 100µM 100µM 100µM 100µM

Control AA DHA EPA EPA/DHA

Pro

po

rtio

n o

f T

ota

l F

atty

Aci

d

(%)

AA

0

2

4

6

8

10

12

14

100µM 100µM 100µM 100µM 100µM

Control AA DHA EPA EPA/DHA

Pro

po

rtio

n o

f T

ota

l F

atty

Aci

d

(%) EPA

*

*

0

2

4

6

8

10

12

14

100µM 100µM 100µM 100µM 100µM

Control AA DHA EPA EPA/DHA

Pro

po

rtio

n o

f T

ota

l F

atty

Aci

d

(%)

DHA**

**

a)

b)

c)

110

Figure 4.2 Effects of a) stimulant and b) fatty acid treatment on PGF2α secretion in

equine endometrial explants cultured for 6 h in the presence of no stimulus (control),

LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed

using logarithmic 10 for statistical analysis; data presented is non-transformed means ±

s.e.m. a,b,c

Means with different superscripts differ (P < 0.0001), * P < 0.0001.

0

1

2

3

4

5

6

7

8

9

Control LPS Oxy

PG

F2α

Co

nce

ntr

atio

n

(pg/µ

g o

f p

rote

in)

c

a

b

0

1

2

3

4

5

6

7

8

9

No AA EPA DHA

PG

F2α

Co

nce

ntr

atio

n

(pg/µ

g o

f p

rote

in)

*

a)

b)

111

Figure 4.3 Effects of a) stimulant and b) fatty acid treatment on PGE2 secretion in equine

endometrial explants cultured for 6 h in the presence of no stimulus (control), LPS, or

oxytocin. Due to non-homogeneity among the variances, data was transformed using

logarithmic 10 for statistical analysis; data presented is non-transformed means ± s.e.m. a,b,c

Means with different superscripts differ (P < 0.0001), * P < 0.0001.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

Control LPS Oxy

PG

E2

Co

nce

ntr

atio

n

(pg /

µg o

f p

rote

in)

a

bc

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

No AA EPA DHA

PG

E2

Co

nce

ntr

atio

n

(pg/µ

g o

f p

rote

in)

*

a)

b)

112

REFERENCES

Achard F, Gilbert M, Benistant C, Ben Slama S, DeWit DL, Smith WL, and

Lagarde M 1997 Eicosapentaenoic and docosahexaenoic acids reduce PGH synthase-1

expression in bovine aortic endothelial cells. Biochemical and Biophysical Research

Communications 241 513-518.

Adams GP, Kastelic JP, Bergfelt DR, and Ginther OJ 1987 Effect of uterine

inflammation and ultrasonically-detected uterine pathology on fertility in the mare.

Journal of Reproduction and Fertility (Supplement) 35 445-454.

Akira S, Takeda K, and Kaisho T 2001 Toll-like receptors: critical proteins linking

innate and acquired immunity. Nature Immunology 2 675-680.

Allen WR and Rowson LEA 1973 Control of the mare's oestrous cycle by

prostaglandins. Journal of Reproduction and Fertility 33 539-543.

Alvarez C, Cachaldora P, Mendez J, Garcia-Rebollar P, and De Blas JC 2004

Effects of dietary conjugated linoleic acid and fish oil supplementation on performance

and egg quality in laying hens. British Poultry Science 45 524-529.

Arntzen KJ, Brekke OL, Vatten L, and Austgulen R 1998 Reduced production of

PGE2 and PGF2 alpha from decidual cell cultures supplemented with N-3 polyunsaturated

fatty acids. Prostaglandins & Other Lipid Mediators 56 183-195.

Arosh JA, Parent J, Chapdelaine P, Sirois J, and Fortier MA 2002 Expression of

cyclooxygenases-1 and -2 and prostaglandin E synthase in bovine endometrial tissue

during the estrous cycle. Biology of Reproduction 67 161-169.

Asselin E, Drolet P, and Fortier MA 1997 Cellular mechanisms involved during

oxytocin-induced prostaglandin F2alpha production in endometrial epithelial cells in

vitro: role of cyclooxygenase-2. Endocrinology 138 4798-4805.

Atli MO, Kurar E, Kayis SA, Aslan S, Semacan A, Celik S, and Guzeloglu A 2010

Evaluation of genes involved in prostaglandin action in equine endometrium during

estrous cycle and early pregnancy. Animal Reproduction Science 122 124-132.

Ball BA, Little TV, Weber JA, and Woods GL 1989 Survival of day 4 embryos from

young normal mares and aged subfertile mares after transfer to normal recipient mares.

Journal of Reproduction and Fertility 85 187-194.

Ball BA, Little TV, Hillman RB, and Woods GL 1986 Pregnancy rates at days 2 and

14 and estimated embryonic loss rates prior to day 14 in normal and subfertile mares.

Theriogenology 26 611-619.

113

Behrendt CY, Adams MH, Daniel KS, and McDowell KJ 1997 Oxytocin expression

by equine endometrium. Biology of Reproduction (Supplement) 56 134.

Betteridge KJ, Renard A, and Goff AK 1985 Uterine prostaglandin release relative to

embryo collection, transfer procedures, and maintenance of the corpus luteum. Equine

Veterinary Journal (Supplement) 3 25-33.

Bilby TR, Block J, do Amaral BC, Sa Fiho O, Silvestre FT, Hansen PJ, Staples CR,

and Thatcher WW 2006 Effects of dietary unsaturated fatty acids on oocyte quality and

follicular development in lactating dairy cows in summer. Journal of Dairy Science 89

3891-3903.

Bilby TR, Guzeloglu A, MacLaren LA, Staples CR, and Thatcher WW 2006

Pregnancy, bovine somatotropin, and dietary n-3 fatty acids in lactating dairy cows: II.

endometrial gene expression related to maintenance pregnancy. Journal of Dairy Science

89 3375-3385.

Blitek A and Ziecik AJ 2004 Prostaglandins F2 alpha and E2 secretion by porcine

epithelial and stromal endometrial cells on different days of the oestrous cycle.

Reproduction in Domestic Animals 39 340-346.

Boerboom D, Brown KA, Vaillancourt D, Poitras P, Goff AK, Watanabe K, Dore M,

and Sirois J 2004 Expression of key prostaglandin synthases in equine endometrium

during late diestrus and early pregnancy. Biology of Reproduction 70 391-399.

Boulton MI, McGrath TJ, Goode JA, Broad KD, and Gilbert CL 1996 Changes in

content of mRNA encoding oxytocin in the pig uterus during the oestrous cycle,

pregnancy, at parturition and in lactational anoestrus. Journal of Reproduction and

Fertility 108 219-227.

Briston L, Dudhia J, and Lees P 2010 Age-related differences in prostaglandin E2

synthesis by equine cartilage explants and synoviocytes. Journal of Veterinary

Pharmacology and Therapeutics 33 268-276.

Broughton SK, Hanh B, and Ross E 2009 Docosahexaenoic acid and eicosapentaenoic

acid affect ovarian prostaglandin levels differently in rats. Nutrition Research 29 510-

518.

Broughton SK, Rule DC, Ye Y, Zhnag X, Driscoll M, and Culver B 2009 Dietary

omega-3 fatty acids differentially influence ova release and ovarian cyclooxygenase-1

and cyclooxygenase-2 expression in rats. Nutrition Research 29 197-205.

114

Burns PD, Engle TE, Harris MA, Enns RM, and Whittier JC 2003 Effect of fish

meal supplementation on plasma and endometrial fatty acid composition in nonlactating

beef cows. Journal of Animal Sciences 81 2840-2846.

Burns PD, Tsai SJ, Wiltbank MC, Hayes SH, Graf GA, and Silvia WJ 1997 Effect of

oxytocin on concentrations of prostaglandin H synthase-2 mRNA in ovine endometrial

tissue in vivo. Endocrinology 138 5637-5640.

Buscher U, Chen FC, Riesenkampff E, Dehn DV, David M, and Dudenhausen JW

2001 Effects of oxytocin receptor antagonist Atosiban on pregnant myometrium in vitro.

Obstetrics & Gynecology 8 117-121.

Cabrera RA, Dozier BL, and Duffy DM 2006 Prostaglandin-endoperoxide synthase

(PTGS1 and PTGS2) expression and prostaglandin production by normal monkey

ovarian surface epithelium. Fertility and Sterility 86 1088-1096.

Cadario ME, Merritt AM, Archbald LF, Thatcher WW, and LeBlanc MM 1999

Changes in intrauterine pressure after oxytocin administration in reproductively normal

mares and in those with a delay in uterine clearance. Theriogenology 51 1017-1025.

Caldari-Torres C, Rodriguez-Sallaberry C, Greene ES, and Badinga L 2006

Differential effects of n-3 and n-6 fatty acids on prostaglandin F2 alpha production by

bovine endometrial cells. Journal of Dairy Science 89 971-977.

Calder PC 2009 Polyunsaturated fatty acids and inflammatory processes: new twists in

an old tale. Biochimie 91 791-795.

Campbell FM, Clohessy AM, Gordon MJ, Page KR, and Dutta-Roy AK 1997 Uptake

of long-chain fatty acids by human placental choriocarcinoma (BeWo) cells: role of

plasma membrane fatty acid-binding protein. Journal of Lipid Research 38 2558-2568.

Carnahan KG, Uzumcu M, Hu J, Sample GL, Braileanu GT, and Mirando MA

2002 Oxytocin stimulates secretion of prostaglandin F2 alpha from endometrial cells of

swine in the presence of progesterone. Domestic Animal Endocrinology 23 435-445.

Chapkin RS, Kim W, Lutpon JR, and McMurray DN 2009 Dietary docosahexaenoic

and eicosapentaenoic acid: emerging mediators of inflammation. Prostaglandins,

Leukotrienes, and Essential Fatty Acids 81 187-191.

Charpigny G, Reinaud P, Creminon C, and Tamby JP 1999 Correlation of increased

concentration of ovine endometrial cyclooxygenase-2 with the increase in PGE2 and

PGD2 in the late luteal phase. Journal of Reproduction and Fertility 117 315-324.

115

Cheng Z, Abayasekara DR, and Wathes DC 2005 The effect of supplementation with

n-6 polyunsaturated fatty acids on 1-, 2- and 3-series prostaglandin F production by ovine

uterine epithelial cells. Biochimica et Biophysica Acta 1736 128-135.

Cheng Z, Robinson RS, Pushpakumara PG, Mansbridge RJ, and Wathes DC 2001

Effect of dietary polyunsaturated fatty acids on uterine prostaglandin synthesis in the

cow. The Journal of Endocrinology 171 463-473.

Chibbar R, Miller FD , and Mitchell BF 1993 Synthesis of oxytocin in amnion,

chorion, and decidua may influence the timing of human parturition. The Journal of

Clinical Investigation 91 185-192.

Childs S, Hennessy AA, Sreenan JM, Wathes DC, Cheng Z, Stanton C, Diskin MG,

and Kenny DA 2008 Effect of level of dietary n-3 polyunsaturated fatty acid supplement

on systemic and tissue fatty acid concentrations and on selected reproductive variables in

cattle. Theriogenology 70 595-611.

Chow JC, Young DW, Golenbock DT, Christ WJ, and Gusovsky F 1992 Toll-like

receptor-4 mediates lipopolysaccharide-induced signal transduction. The Journal of

Biological Chemistry 274 10689-10692.

Classen-Linke I, Kusche M, Knauthe R, and Beier HM 1997 Establishment of a

human endometrial cell culture system and characterization of its polarized hormone

responsive epithelial cells. Cell and Tissue Research 287 171-185.

Covens AL, Christopher P, and Casper RF 1988 The effect of dietary supplementation

with fish oil fatty acids on surgically induced endometriosis in the rabbit. Fertility and

Sterility 49 698-703.

Coyne GS, Kenny DA, Childs S, Sreenan JM, and Waters SM 2008 Dietary n-3

polyunsaturated fatty acids alter the expression of genes involved in prostaglandin

biosynthesis in the bovine uterus. Theriogenology 70 772-782.

Crofford LJ 1997 COX-1 and COX-2 tissue expression: implications and predictions.

The Journal of Rheumatology (Supplement) 49 15-19.

Dimock WW and Edwards PR 1928 Pathology and bacteriology of the reproductive

organs of mares in relation to sterility. Kentucky Agricultural Experiment Station Bulletin

(Research Bulletin) 286 157-237.

Dunlap KA and Stormshak F 2004 Nongenomic inhibition of oxytocin binding by

progesterone in the ovine uterus. Biology of Reproduction 70 65-69.

116

Ealy AD, Eroh ML, and Sharp DC,3rd 2010 Prostaglandin H synthase type 2 is

differentially expressed in endometrium based on pregnancy status in pony mares and

responds to oxytocin and conceptus secretions in explant culture. Animal Reproduction

Science 117 99-105.

Eogan M and McKenna P 2004 Delaying preterm delivery at the threshold of viability.

Journal of Obstetrics and Gynaecology 4 459-460.

Fahmi HA, Hunter AG, Markham RJ, and Seguin BE 1985 Immunosuppressive

activity of bovine seminal plasma on bovine lymphocytes in vitro. Journal of Dairy

Science 68 2315-2321.

Fain JN, Wallace MA, and Wojcikiewicz RJH 1988 Evidence for involvement of

guanine nucleotide-binding regulatory proteins in the activation of phospholipases by

hormones. The Journal of the Federation of American Societies for Experimental Biology

2 2569-2574.

Farina M, Ribeiro ML, Weissmann C, Estevez A, Billi S, Vercelli C, and Franchi A

2004 Biosynthesis and catabolism of prostaglandin F2alpha (PGF2alpha) are controlled by

progesterone in the rat uterus during pregnancy. The Journal of Steroid Biochemistry and

Molecular Biology 91 211-218.

Flint APF and Sheldrick EL 1982 Ovarian secretion of oxytocin is stimulated by

prostaglandin. Nature 297 587-588.

Franczak A, Kotwica G, Kurowicka B, Oponowicz A, Woclawek-Potocka I, and

Petroff BK 2006 Expression of enzymes of cyclooxygenase pathway and secretion of

prostaglandin E2 and F2alpha by porcine myometrium during luteolysis and early

pregnancy. Theriogenology 66 1049-1056.

Gimpl G and Fahrenholz F 2001 The oxytocin receptor system: structure, function, and

regulation. Physiological Reviews 81 629-683.

Glasser SR, Julian J, Decker GL, Tang JP, and Carson DD 1988 Development of

morphological and functional polarity in primary cultures of immature rat uterine

epithelial cells. The Journal of Cell Biology 107 2409-2423.

Glatz JF, Luiken JFP, van Nieuwenhoven FA, and Van der Vusse GJ 1997

Molecular mechanism of cellular uptake and intracellular translocation of fatty acids.

Prostaglandins, Leukotrienes, and Essential Fatty Acids 57 3-9.

Goff AK, Pontbriand D, and Sirois J 1987 Oxytocin stimulation of plasma 15-keto-

13,14-dihydro prostaglandin F-2 alpha during the oestrous cycle and early pregnancy in

the mare. Journal of Reproduction and Fertility (Supplement) 35 253-260.

117

Gonzalez JM, Xu H, Ofori E, and Elovitz MA 2007 Toll-like receptors in the uterus,

cervix, and placenta: is pregnancy an immunosuppressed state? American Journal of

Obstetrics and Gynecology 197 296.e1-296.e6.

Gu W, Rice GE, and Brennecke SP 1994 Effects of lipopolysaccharide on human

placental prostaglandin F2 alpha production in vitro. Prostaglandins, Leukotrienes, and

Essential Fatty Acids 50 311-315.

Gutjahr S, Paccamonti DL, Pycock JF, Taverne MA, Dieleman SJ, and van der

Weijden GC 2000 Effect of dose and day of treatment on uterine response to oxytocin in

mares. Theriogenology 54 447-456.

Hall JA, Van Saun RJ, Tornquist SJ, Gradin JL, Pearson EG, and Wander RC

2004 Effect of type of dietary polyunsaturated fatty acid supplement (corn oil or fish

oil)on immune responses in healthy horses. Journal of Veterinary Internal Medicine 18

880-886.

Hamilton JA, Guo W, and Kamp F 2002 Mechanism of cellular uptake on long-chain

fatty acids: Do we need cellular proteins? Molecular and Cellular Biochemistry 239 17-

23.

Hearth S, Lilly ST, Fischer DP, Williams EJ, Dobson H, Bryant CE, and Sheldon

IM 2009 Bacterial lipopolysaccharide induces an endocrine switch from prostaglandin F2

alpha to prostaglandin E2 in bovine endometrium. Endocrinology 150 1912-1920.

Herath S, Fischer DP, Werling D, Williams EJ, Lilly ST, Dobson H, Bryant CE, and

Sheldon IM 2006 Expression and function of toll-like receptor 4 in the endometrial cells

of the uterus. Endocrinology 147 562-570.

Hornstra G, Van Houwelinge AC, Kivits GA, Fischer S, and Uedelhoven W 1991

Dietary fish and prostanoid formation in man. Advances in Prostaglandins,

Thromboxane, and Leukotriene Research 21A 225-228.

Irvine CHG 1995 The nonpregnant mare: A review of some current research and the last

25 years of endocrinology. Equine Reproduction IV, Biology Reproduction Monograph

Series 1 1 343-360.

Jacobs AL, Decker GL, Glasser SR, Julian J, and Carson DD 1990 Vectorial

secretion of prostaglandins by polarized rodent uterine epithelial cells. Endocrinology

126 2125-2136.

Katila T 1995 Onset and duration of uterine inflammatory repsonse of mares after

insemination with fresh semen. Biology of Reproduction Mono 1 515-517.

118

King SS and Evans WE 1987 Effects of arachidonic acid and oxytocin on equine

endometrial PGF2 alpha during normal cycles and pseudopregnancy. Theriogenology 7

303-308.

Kirkup SE, Cheng Z, Elmes M, Wathes DC, and Abayasekara DR 2010

Polyunsaturated fatty acids modulate prostaglandin synthesis by ovine amnion cells in

vitro. Reproduction 140 943-951.

Lee JS and Silvia WJ 1994 Cellular mechanisms mediating the stimulation of ovine

endometrial secretion of prostaglandin F2 alpha in response to oxytocin: role of

phospholipase A2. Journal of Endocrinology 141 491-496.

Lefebvre D, Giaid A, Bennett H, Lariviere R, and Zingg H 1992 Oxytocin gene

expression in rat uterus. Science 256 1553-1555.

Lehrer RI, Ganz T, Selsted ME, Babior BM, and Curnutte JT 1988 Neutrophils and

host defense. Annals of Internal Medicine 109 127-142.

Leung ST, Cheng Z, Sheldrick EL, Derecka K, Flint APF, and Wathes DC 2001 The

effects of lipopolysaccharide and interleukins-1alpha, -2, and -6 on oxytocin receptor

expression and prostaglandin production in bovine endometrium. Journal of

Endocrinology 168 497-508.

Livak KJ and Schmittgen TD 2001 Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 402-408.

Mahfoudi A, Nicollier M, Propper AY, Coumes-Marquet S, and Adessi GL 1991

Establishment of endometrial glandular epithelial cell subculture in a serum-free,

hormonally defined medium, on a basement membrane matrix. Biology of the Cell 71

255-265.

Manhart DR, Scott BD, Eller EM, Honnas CM, Hood DM, Coverdale JA, and

Gibbs PG 2005 Effect of n-3 PUFAs on markers of inflammation in arthritic horses.

Equine Science Society Abstract 133-134.

Mann GE 2001 Hormone control of prostaglandin F2 alpha production and oxytocin

receptor concentrations in bovine endometrium in explant culture. Domestic Animal

Endocrinology 20 217-226.

Massaro M, Habib A, Lubrano L, Del Turco S, Lazzerini G, Bourcier T, Weksler

BB, and De Caterina R 2006 The omega-3 fatty acid docosahexaenoate attenuates

endothelial cyclooxygenase-2 induction through both NADP(H) oxidase and PKC

epsilon inhibition. Proceedings of the National Academy of Sciences of the United States

of America 103 15184-15189.

119

Mattos R, Staples CR, Williams J, Amorocho A, McGuire MA, and Thatcher WW

2002 Uterine, ovarian, and production responses of lactating dairy cows to increasing

dietary concentrations of menhaden fish meal. Journal of Dairy Science 85 755-764.

Mattos R, Guzeloglu A, Badinga L, Staples CR, and Thatcher WW 2003

Polyunsaturated fatty acids and bovine interferon-tau modify phorbol ester-induced

secretion of prostaglandin F2 alpha and expression of prostaglandin endoperoxide

synthase-2 and phospholipase-A2 in bovine endometrial cells. Biology of Reproduction

69 780-787.

Mattos R, Staples CR, Arteche A, Wiltbank MC, Diaz FJ, Jenkins TC, and

Thatcher WW 2004 The effects of feeding fish oil on uterine secretion of PGF2alpha,

milk composition, and metabolic status of periparturient Holstein cows. Journal of Dairy

Science 87 921-932.

Mattos R, Staples CR, and Thatcher WW 2000 Effects of dietary fatty acids on

reproduction in ruminants. Reviews of Reproduction 5 38-45.

McCracken JA 1980 Hormone receptor control of prostaglandin F2alpha secretion by

the ovine uterus. Biology of Reproduction 8 1329-1344.

McCracken JA 2004 Prostaglandin F2alpha: the luteolytic hormone. In The Eicosanoids,

pp 525-545. Anonymous, New York: John Wiley and Sons.

McCracken JA, Custer EE, and Lamsa JC 1999 Luteolysis: a neuroendrocrine-

mediated event. Physiological Review 79 263-323.

Meier S, Ledgard AM, Sato TA, Peterson AJ, and Mitchell MD 2009 Polyunsaturated

fatty acids differentially alter PGF(2alpha) and PGE(2) release from bovine trophoblast

and endometrial tissues during short-term culture. Animal Reproduction Science 111 353-

360.

Melin P, Vilhardt H, Lindeberg G, Larsson LE, and Akerlund M 1981 Inhibitory

effect of O-alkylated analogues of oxytocin and vasopressin on human and rat

myometrial activity. Journal of Endocrinology 88 173-180.

Mitchell JA, Kohlhass KL, Matsumoto T, Pollock JS, Forstermann U, Warner TD,

Schmidt HHHW, and Murad F 1992 Induction of NADPH-dependent diaphorase and

nitric oxide synthase activity in aortic smooth muscle and cultured macrophages.

Molecular Pharmacology 104 189-219.

Moussavi AR, Gilbert RO, Overton TR, Bauman DE, and Butler WR 2007 Effects

of feeding fish meal and n-3 fatty acids on ovarian and uterine responses in early

lactating dairy cows. Journal of Dairy Science 90 145-154.

120

Muzio M and Mantovani A 2000 Toll-like receptors. Microbes and Infection 2 251-255.

Myers MJ, Scott ML, Deaver CM, Farrell DE, and Yancy HF 2010 Biomarkers of

inflammation in cattle determining the effectiveness of anti-inflammatory drugs. Journal

of Veterinary Pharmacology and Therapeutics 33 1-8.

Nash D, Lane E, Herath S, and Sheldon IM 2008 Endometrial explant culture for

characterizing equine endometritis. American Journal of Reproductive Immunology 59

105-117.

Nash DM, Sheldon IM, Herath S, and Lane EA 2010 Markers of the uterine innate

immune response of the mare. Animal Reproduction Science 119 31-39.

Neely PD, Kindahl H, Stabenfeldt GH, Edquist LE, and Hughes JP 1979

Prostaglandin release patterns in the mare: physiological, pathophysiological, and

therapeutic responses. Journal of Reproduction and Fertility (Supplement) 27 181-189.

Obata T, Nagakura T, Masaki T, Maekawa K, and Yamashita K 1999

Eicosapentaenoic acid inhibits prostaglandin D2 generation by inhibiting cyclooxygenase-

2 in cultured human mast cells. Clinical and Experimental Allergy 29 1129-1135.

O'Connor CI, Lawrenece LM, St. Lawrenence AC, Janicki KM, Warren LK , and

Hayes S 2004 The effect of dietary fish oil supplementation on exercising horses.

Journal of Animal Sciences 82 2978-2984.

Palin MF, Brochu-Gaudreau K, Beaudry D, Small J, and Petit H 2005 Effects of

feeding flaxseed on cyclooxygenase-2 (Cox-2 and peroxisome rpoliferator-activated

receptors (PPAR) delta and gamma mRNA levels at time of maternal recognition of

pregnancy in Holstein cows. Society for the Study of Reproduction Annual Meeting

Abstract.

Perez MA, Hansen RA, Harris MA, and Allen KG 2006 Dietary docosahexaenoic acid

alters pregnant rat reproductive tissue prostaglandin and matrix metalloproteinase

production. The Journal of Nutritional Biochemistry 17 446-453.

Petit HV, Dewhurst RJ, Scollan ND, Proulx JG, Khalid M, Haresign W,

Twagiramungu H, and Mann GE 2002 Milk production and composition, ovarian

function, and prostaglandin secretion of dairy cows fed omega-3 fats. Journal of Dairy

Science 85 889-899.

Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-

PCR. Nucleic Acids Research 29 e45.

121

Phaneuf S, Asboth G, MacKenzie IZ, Melin P, and Bernal AL 1994 Effect of

oxytocin antagonists on the activation of human myometrium in vitro: Atosiban prevents

oxytocin-induced desensitization. American Journal of Obstetrics and Gynecology 171

1627-1634.

Pozzoli G, Costa A, Grimaldi M, Schettini G, Preziosi P, Grossman A, and Navarra

P 1994 Lipopolysaccharide modulation of eicosanoid and corticotrophin-releasing

hormone release from rat hypothalamic explants and astrocyte cultures in vitro: evidence

for the involvement of prostaglandin E2 but not prostaglandin F2 alpha and lack of effect

of nerve growth factor. The Journal of Endocrinology 140 103-109.

Pratt BR, Butcher RL, and Inskeep EK 1977 Antiluteolytic effect of the conceptus and

of PGE2 in ewes. Journal of Animal Science 45 784-791.

Pycock JF and Allen WE 1988 Pre-chemotactic and chemotactic properties of uterine

fluid from mares with experimentally induced endometritis. Veterinary Record 123 193-

195.

Raetz CRH and Whitfield C 2002 Lipopolysaccharide endotoxins. Annual Review of

Biochemistry 71 635-700.

Rigby SL, Barhoumi R, Burghardt RC, Colleran P, Thompson JA, Varner DD,

Blanchard TL, Brinsko SP, Taylor T, Wilkerson MK, and Delp MD 2001 Mares with

delayed uterine clearance have an intrinsic defect in myometrial function. Biology of

Reproduction 65 740-747.

Roberts JS, McCracken JA, Gavagan JE, and Soloff MS 1976 Oxytocin-stimulated

release of prostaglandin F2 alpha from ovine endometrium in vitro: Correlation with

estrous cycle and oxytocin-receptor binding. Endocrinology 99 1107-1118.

Robinson RS, Pushpakumara PGA, Chneg Z, Peters AR, Abayasekara DRE, and

Wathes DC 2002 Effects of dietary polyunsaturated fatty acids on ovarian and uterine

function in lactating dairy cows. Reproduction 124 119-131.

Roesler S 2007 Cattle Production News. Farm and Ranch Guide 6.

Roman AS, Schreher J, Mackenzie AP, and Nathanielsz PW 2006 Omega-3 fatty

acids and decidual cell prostaglandin production in response to the inflammatory

cytokine IL-1beta. American Journal of Obstetrics and Gynecology 195 1693-1699.

Saltiel A, Paramo R, Murcia C, and Tolosa J 1986 Pathologic findings in the oviducts

of mares. American Journal of Veterinary Research 47 594-597.

122

Sharma SC and Fitzpatrick RJ 1974 Effect of oestradiol-17β and oxytocin treatment

on prostaglandin F2 alpha release in the anoestrous ewe. Prostaglandins 6 97-105.

Sharp DC, Thatcher MJ, Salute ME, and Fuchs AR 1997 Relationship between

endometrial oxytocin receptors and oxytocin-induced prostaglandin F2 alpha release

during the oestrous cycle and early pregnancy in pony mares. Journal of Reproduction

and Fertility 109 137-144.

Silvia WJ, Lee JS, Trammell DS, Hayes SH, Lowberger LL, and Brockman JA 1994

Cellular mechanisms mediating the stimulation of ovine endometrial secretion of

prostaglandin F2 alpha in response to oxytocin: role of phospholipase C and

diacylglycerol. Journal of Endocrinology 141 481-490.

Silvia WJ, Lewis GS, McCracken JA, Thatcher WW, and Wilson L,Jr 1991

Hormonal regulation of uterine secretion of prostaglandin F2 alpha during luteolysis in

ruminants. Biology of Reproduction 45 655-663.

Slonina D, Kowalik MK, Subocz M, and Kotwica J 2009 The effect of ovarian steroids

on oxytocin-stimulated secretion and synthesis of prostaglandins in bovine myometrial

cells. Prostaglandins & Other Lipid Mediators 90 69-75.

Smith WL, Marnett LJ, and DeWitt DL 1991 Prostaglandin and Thromboxane

Biosynthesis. Pharmacology and Therapeutics 49 153-179.

Smith DM, El Sahwi S, Wilson N, and Moyer DL 1971 Effect of polymorphonuclear

leukocytes on the development of mouse embryos cultured from the two-cell stage

blastocysts. Biology of Reproduction 4 74-83.

Smith WL 1992 Prostanoid biosynthesis and mechanisms of action. The American

Journal of Physiology 263 F181-91.

Sompayrac L 2008 How the Immune System Works. 134.

Spearman KR, Ott EA, Kivipelto J, and Warren LK 2005 Effect of fatty acid

supplementation of the mare on milk and foal plasma composition and foal growth.

Equine Science Society Abstract 3-4.

Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, and Bazer FW 1995

Ovine interferon-tau regulates expression of endometrial receptor estrogen and oxytocin

but no progesterone. Biology of Reproduction 53 732-745.

Starbuck GR, Stout TAE, Lamming GE, Allen WR, and Flint APF 1998 Endometrial

oxytocin receptor and uterine prostaglandin secretion in mares during the oestrous cycle

and early pregnancy. Journal of Reproduction and Fertility 113 173-179.

123

Stevenson KR, Parkinson TJ, and Wathes DC 1991 Measurement of oxytocin

concentrations in plasma and ovarian extracts during the oestrous cycle of mares. Journal

of Reproduction and Fertility 93 437-441.

Stillwell W and Wassall SR 2003 Docosahexaenoic acid: membrane properties of a

unique fatty acid. Chemistry and Physics of Lipids 126 1-27.

Stillwell W 2006 The role of polyunsaturated lipids in membrane raft function. Food &

Nutrition Research 50.

Stout TAE and Allen WR 1999 The Role of Oxytocin in Luteolysis in the Cycling

Mare. Reproduction of the Domestic Animal 34 351-354.

Stremmel W, Kleinert H, Fitscher BA, Gunawan J, Klaasen-Schluter C, Moller K,

and Wegener M 1992 Mechanism of cellular fatty acid uptake. Biochemical Society

Transactions 20 814-817.

Stull CL and Evans JW 1986 Oxytocin binding in the uterus of the cycling mare.

Journal of Equine Veterinary Science 6 114-119.

Tanikawa M, Lee HY, Watanabe K, Majewska M, Skarzynski DJ, Park SB, Lee DS,

Park CK, Acosta TJ, and Okuda K 2008 Regulation of prostaglandin biosynthesis by

interleukin-1 in cultured bovine endometrial cells. The Journal of Endocrinology 199

425-434.

Taylor CC and Terranova PF 1996 Lipopolysaccharide inhibits in vitro luteinizing

hormone-stimulated rat ovarian granulosa cell estradiol but not progesterone secretion.

Biology of Reproduction 54 1390-1396.

Tithof PK, Roberts MP, Guan W, Elgayyar M, and Godkin JD 2007 Distinct

phospholipase A2 enzymes regulate prostaglandin E2 and F2alpha production by bovine

endometrial epithelial cells. Reproductive Biology and Endocrinology 5 16.

Troedsson MHT 1995 Uterine response to semen deposition in the mare. Proceedings

for the Society of Theriogenology 130-135.

Troedsson MHT 1999 Uterine clearance and resistance to persistent endometritis in the

mare. Theriogenology 52 461-471.

Troedsson MHT, Alghamdi AS, and Mattisen J 2002 Equine seminal plasma protects

the fertility of spermatozoa in an inflamed uterine environment. Theriogenology 58 453-

456.

124

Troedsson MHT, Liu IKM , and Thurmond M 1993 Immunoglobulin (IgG and IgA)

and complement (C3) concentrations in uterine secretion following an intrauterine

challenge of Streptococcus zooepidemicus in mares susceptible to versus resistant to

chronic uterine infection. Biology of Reproduction 49 502-506.

Troedsson MHT, Loset K, Alghamdi AM, Dahms B, and Crabo BG 2001 Interaction

between equine semen and the endometrium: the inflammatory response to semen.

Animal Reproduction Science 68 273-278.

Troedsson MH 2006 Breeding-induced endometritis in mares. The Veterinary Clinics of

North American Equine Practice 22 705-712.

Troedsson MH, Liu IK, and Crabo BG 1998 Sperm transport and survival in the mare:

a review. Theriogenology 50 807-818.

Vagnoni KE and Magness RR 1998 Estrogen and lipopolysaccharide stimulation of

prostacyclin production and the levels of cyclooxygenase and nitric oxide synthase in

ovine uterine arteries. Biology of Reproduction 59 1008-1015.

Valentine BA 2001 Muscle Glycogen, myopathy, and diet. World Equine Veterinary

Review 2 27-31.

Vallet JL, Lamming GE, and Batten M 1990 Control of endometrial oxytocin receptor

and uterine response to oxytocin by progesterone and oestradiol in the ewe. Journal of

Reproduction and Fertility 90 625-634.

Vanderwall DK 2008 Early Embryonic Loss in the Mare. Journal of Equine Veterinary

Science 28 691-702.

Vernon MW, Zavy MT, Asquith RL, and Sharp DC 1981 Prostaglandin F2alpha in

the equine endometrium: steroid modulation and production capacities during the estrous

cycle and early pregnancy. Biology of Reproduction 25 581-589.

Vineyard KR, Warren LK, and Kivipelto J 2010 Effect of dietary omega-3 fatty acid

source on plasma and red blood cell membrane composition and immune function in

yearling horses. Journal of Animal Sciences 88 248-257.

Vineyard KR, Warren LK, Webel SK, and Kivipelto J 2005 Effect of fish oil

supplementation on neutrophil function and antibody production in yearling horses.

Equine Science Society Abstract 13-14.

Waclawik A, Jabbour HN, Blitek A, and Ziecik AJ 2009 Estradiol-17 beta,

prostaglandin E2 (PGE2), and the PGE2 receptor are involved in PGE2 positive feedback

loop in the porcine endometrium. Endocrinology 150 3823-3832.

125

Wamsley NE, Burns PD, Engle TE, and Enns RM 2005 Fish meal supplementation

alters uterine prostaglandin F2alpha synthesis in beef heifers with low luteal-

progesterone. Journal of Animal Sciences 83 1832-1838.

Wathes DC, Abayasekara DRE, and Aitken RJ 2007 Polyunsaturated fatty acids in the

male and female reproduction. Biology of Reproduction 77 190-201.

Watson ED, Aubrey ES, Zanecosky HG, and Sertich PL 1992 Isolation and culture of

glandular epithelial and stromal cells from the endometrium of mares. Journals of

Reproduction and Fertility 95 269-275.

Watson ED, Bjorksten TS, Buckingham J, and Nikolakopoulos E 1997

Immunolocalisation of oxytocin in the uterus of the mare. Journal of Reproduction and

Fertility Abstract Series 20 31.

Watson ED, Strokes CR, and Bourne FJ 1988 Concentrations of immunoreactive

leukotriene B4 in uterine lavage fluid from mares with experimentally induced and

naturally occurring endometritis. Journal of Veterinary Pharmacology and Therapeutics

11 130-134.

Watson ED 2000 Post-breeding endometritis in the mare. Animal Reproduction Science

60-61 221-232.

Watson ED, Stokes CR, and Bourne FJ 1987 Cellular and humoral defence

mechanisms in mares susceptible and resistant to persistent endometritis. Veterinary

Immunology and Immunopathology 16 107-121.

Woodward AD, Nielsen BD, O'Connor CI, Webel SK, and Orth MW 2005 Dietary

long chain polyunsaturated fatty acids increase plasma eicosapentaenoic acid and

docosahexaenoic acid concentrations and trot stride length in horses. Equine Science

Society Abstract 101-105.

Yadav UC, Srivastava SK, and Ramana KV 2010 Inhibition of aldose reductase

attenuates endotoxin signals in human non-pigmented ciliary epithelial cells.

Experimental Eye Research 90 555-563.

Young SL, Lyddon TD, Jorgenson RL, and Misfeldt ML 2004 Expression of toll-like

receptors in human endometrial epithelial cells and cell lines. American Journal of

Reproductive Immunology 52 67-73.