Proc. Nati. Acad. Sci. USAVol. 85, pp. 1826-1830, March 1988Biochemistry

DNA bending is induced in an enhancer by the DNA-bindingdomain of the bovine papillomavirus E2 protein

(transcriptional control/DNA-protein interactions)

CHRISTOPHER MOSKALUK AND DEEPAK BASTIA*Department of Microbiology and Immunology, Duke University Medical Center, Durham, NC 27710

Communicated by Irwin Fridovich, December 3, 1987

ABSTRACT The E2 gene of bovine papillomavirus type 1has been shown to encode a DNA-binding protein and totrans-activate the viral enhancer. We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126amino acids of the E2 open reading frame. The DNA-bindingdomain has been expressed in Escherichia coli and partiallypurified. Gel retardation and DNase I "footprinting" on thebovine papillomavirus type 1 enhancer identify the sequencemotif ACCN6GGT (in which N = any nucleotide) as the E2binding site. Using electrophoretic methods we have shownthat the DNA-binding domain changes conformation of theenhancer by inducing significant DNA bending.

The role of DNA-binding proteins in eukaryotic gene acti-vation is a topic of considerable interest. An attractive modelsystem to study transcriptional activation is bovine papillo-mavirus type 1 (BPV-1). Although the virus cannot bepropagated in tissue culture, the cloned viral DNA, upontransfection into mouse C127 cells, causes the cells todisplay a transformed phenotype and is maintained as amulticopy plasmid (1). The essential transforming region ofBPV-1 includes eight open reading frames (EJ-E8) and along control region (2). Several promoters in the transform-ing region have been mapped (3, 4). The promoters atcoordinates 89 and 7940 are under the control of a cis-actingenhancer located in the long control region in a Hpa I-Cla Ifragment between the coordinates 7476 and 7946 (4). Bygenetic analyses and transient expression assays, the E2open reading frame of the virus was found to encode atransactivator of the enhancer (5). The regulation of tran-scription of BPV-1 apparently involves not only the posi-tively acting E2 protein but also a truncated form of E2,which lacks the NH2-terminal region. The truncated proteinnegatively controls viral transcription and transformation(6).The E2 protein of BPV-1 has been expressed in Esche-

richia coli, partially purified, and shown to bind specificallyto the enhancer element of the long control region segment(7, 8). The DNA-binding activity of E2 protein has beenshown to be enhanced at an acidic pH (9). By deletionanalyses, the E2-responsive element was mapped to a 1%base pair (bp) fragment between coordinates 7611 and 7806(4). The putative E2 consensus binding site ACCN6GGT(where N = any nucleotide) was found to occur near bothends of this minimal enhancer region.To further characterize this enhancer-transactivator inter-

action we have functionally dissected the E2 protein ofBPV-1 by expressing parts of the E2 open reading frame inE. coli. We show that the COOH terminus of the E2 proteinencodes a DNA-binding domain and provide evidence thatthe peptide specifically interacts with the ACCN6GGT se-

quence motif. We further show that a pronounced bending ofthe enhancer occurs from binding of the truncated E2protein.

MATERIALS AND METHODSPlasmid Constructions. Plasmid pDS100 was constructed

by converting the Ava I site distal to the f3-galactosidasegene in pJG200 (10) to an EcoRI site with linkers. Thepolylinker region of pUC13 (11) was excised as a Pvu IIfragment, and the plasmid was closed by the ligation ofEcoRI linkers. The EcoRI fragment from the modifiedpJG200 was inserted into the EcoRI site of the modifiedpUC13. The plasmid pCMD1 was constructed by cloning theCla 1-HinPI fragment of BPV-1 (bp 7477-7700) into AccI-cut pUC19 (12). The Hae III-EcoRI fragment (BPV-1 bp7590-7700) was cloned into Sma I-EcoRI-cut pUC19. TheBPV fragment was now flanked by a BamHI site on the 5'end and Xba I and BamHI sites on the 3' end. The BamHIfragment was cloned into pBR322 (13). The EcoRI-Xba Ifragment was excised from this construct and cloned intopUC19. This generated an insert with pBR322 sequences1-375 linked to the BPV fragment. This construct was cutwith Cla I and Pst I, and the small fragment was ligated tothe same construct cut with Pst I and Acc I. This generateda head-to-tail dimer of the BPV-1/pBR322 insert. All otherplasmids were constructed as described in the text.

Protein Preparation and Purification. E. coli protein ex-tracts were prepared essentially as described by Germinoand Bastia (10), except that the E. coli strain used was TG-1(14). The fusion protein was partially purified by n-propylamine-Sepharose (15). The E2 moiety was releasedfrom ,f-galactosidase by incubation with collagenase and wasfurther purified by anion-exchange chromatography. Proteinwas stored in 10 mM Tris HCI, pH 7.6/100 mM KCI/2 mMEDTA/10 mM 2-mercaptoethanol/0.05% Nonidet P-40/50%(vol/vol) glycerol. Details of the purification will be pub-lished elsewhere. The E2Kpn380 protein was 90% pure asvisualized by gel electrophoresis. Protein extracts used inimmunoprecipitation were obtained from 40% ammoniumsulfate precipitates of cell extracts treated with 1% NonidetP-40. The precipitates from 30-ml cultures of E. coli wereresuspended in 200 1ul of the buffer described above.DNA Fragment Preparation, 32P-End-Labeling of DNA,

and Guanine (G) Reactions. These procedures were done asdescribed by Maxam and Gilbert (16).

Immunoprecipitation of Antigen-DNA Complexes. Theprocedure is a modification of the procedure of McKay (17).For each reaction, 5 ug of unlabeled calf thymus DNA,20,000 cpm of 32P-end-labeled HindIII-EcoRI-cut pCM92,and 5 jul of protein extract in 50 p1 of binding buffer [25 mM2-(N-morpholino)ethanesulfonic acid (MES), pH 6.0/7.5mM MgCl2/50 mM KCl/100 mM NaCI/0.05 mM EDTA/4

Abbreviation: BPV-1, bovine papillomavirus type 1.*To whom reprint requests should be addressed.

1826

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 85 (1988) 1827

mM dithiothreitol] were used. After incubation for 20 min atroom temperature, 4 Al of anti-f-galactosidase antibody (18)was added. After 20 min at 40C, 50 p1 of a 10%6 suspension ofStaphlococcus aureus cells (Pansorbin, Calbiochem) in bind-ing buffer/0.1% Nonidet P-40 were added and incubated at40C for 15 min. The immune complexes were centrifuged,washed twice with binding buffer/0.1% Nonidet P-40, andresuspended in 100 1ul of stop solution (1% NaDodSO4/50mM EDTA/1 M NaOH/2.5 M urea). One hundred microli-ters of phenol/chloroform (1:1) was added, incubated 5 minat 650C, and the aqueous layer was extracted. The DNA wasalcohol precipitated, resuspended in TE buffer (10 mMTris-HCl, pH 8.0/1 mM EDTA) and electrophoresed on a 5'polyacrylamide gel.

Gel Retardation. The procedure is a modification of Friedand Crothers (19). Labeled DNA fragment (15,000 cpm) wasincubated as before with 0.5 ,g of'calf thymus DNA andvarious amounts of E2Kpn380 protein in 40 A1 of bindingbuffer. Ten micrograms of calf thymus DNA and 10 1 ofbinding buffer/50% glycerol/0.03% bromophenol blue wereadded to the samples immediately before electrophoresis.The gel was 1.5 mm thick, 5% polyacrylamide (acrylamide/bisacrylamide, 30:0.8)/10%o glycerol in GS buffer {10 mM[Bis(2-hydroxyethyl)amino]tris(hydroxymethyl)methane(Bistris), pH 6.0/5 mM KOAc/0.5 mM EDTA}. The gel waspreelectrophoresed for 2 hr at room temperature at 8.75V/cm, and the GS buffer was changed. Fifteen microliters ofeach sample was loaded onto the gel, and electrophoresiswas done at 11.9 V/cm until the blue dye reached gelbottom. Electrophoresis for the DNA-bending experimentwas done at 7.8 V/cm at 40C.

"Footprinting" Experiments. DNase I footprints wereobtained as described by Galas and Schmitz (20). Bindingconditions were the same as described for gel retardation.DNA probe of 20,000 cpm was used per reaction. DNase Iwas obtained from Cooper Biomedical. DNase I cleavagewas terminated by the stop solution described for immuno-precipitation.

RESULTSExpression of Partial E2 Proteins in E. col and LoaliaNtion

of the DNA-Binding Domain. The physical map of the trans-acting E2 gene is shown in Fig. 1A. The open reading frameof E2 was divided into four overlapping regions by cloningoligonucleotide linkers containing BamHI sites at the Acc Iand Kpn I sites. The resultant fragments (Acc400, Kpn800,Acc830, and Kpn380) were cloned, in proper transcriptionaland translational fiame, into the BamHI site of the expres-sion vector pDS100 (Fig. LA). The structure of pDS100 isidentical to that of pJG200 (10), except that it has thereplication origin and copy-control elements of pUC13 (11)and, therefore, exists at a higher-copy number than pJG200,which was based on the lower-copy number vector pBR322.These vectors utilize the promoter PR of bacteriophage A,under transcriptional control of the temperature-labile c1857repressor. The recombinant plasmids, after thermal induc-tion, yielded fusion proteins of the expected sizes (Fig. 1B).The fusion proteins were examined for DNA-binding

activity by an immunoprecipitation DNA-binding assay us-ing anti-(3-galactosidase antibodies. This technique precipi-tates from solution proteins displaying f-galactosidase anti-gens. 3-galactosidase/DNA-binding fusion proteins will co-precipitate specifically bound DNA fragments. A recom-binant DNA clone containing a portion of the BPV-1 en-hancer was cleaved with restriction enzymes and labeledwith 32p. All fusion proteins that included the COOH-terminal 126 amino acids of E2 showed sequence-specificDNA-binding (Fig. lA, lanes 3, 5, and 6), whereas theNH2-terminal fusion proteins that lacked the COOH-

A E2DNA binding domain

DNA binding LaneBagm Acci Kpnl Bi mE2(1230) - 6

Acc400 4*Kpn850 -- -2

-_________L___ Acc830- - + 3- ..- Kpn380- 5

^<_ I 1 2 3 4 5 6

B0

161- Tco2 C) LU YC3 0 c0i

. wi

08 CO UoV co co

at r_OL

< < ~e205

611 11197_ w_-_

66 ww

FIG. 1. Localization of the DNA-binding domain of the E2protein to the carboxyl terminus. (A) The entire E2 open readingframe (7) and E2 subfragments were modified with oligonucleotidesto contain BamHI sites at the beginning and end of the readingframes to make them compatible with the expression vectorpDS100. These constructs were expressed in E. coli as fusionproteins with 0-galactosidase through a collagen linker. Proteinextracts were tested for specific DNA binding in an immunoprecip-itation assay with 32P-end-labeled pCM92 (Fig. 2) digested withHindIII and EcoRI. Lane 1: input DNA, showing the large plasmidband and the smaller BPV insert (arrow); other lanes are immuno-precipitations with protein extracts as labeled. Only constructscontaining the terminal 380 bp of the reading frame encoded a

protein that bound BPV enhancer DNA specifically. (B) NaDod-S04/7% polyacrylamide gel electrophoresis of total cellular proteinfrom induced E2 subclones in pDS100. Arrows indicate location ofinduced proteins. Markers show molecular weight (MW) x 10-3.

terminal region failed to bind specifically to the enhancerfragment (lanes 2 and 4). From these results, we concludethat the COOH-terminal 126 amino acids that are common tothe activator and repressor forms of the E2 protein (6)contain a DNA-binding domain.The COOH-terminal E2Kpn38O-collagen-p-galactosidase

fusion protein was expressed in E. coli in higher yield thanthe intact E2-collagen-f-galactosidase fusion protein (Fig.18). Furthermore, unlike the intact E2 protein or the E2fusion protein, which are highly insoluble (7, 8), theE2Kpn38O-collagen-p-galactosidase fusion protein is solu-ble. This allowed purification of this fusion protein on thebasis of the B-galactosidase moiety, and after site-specificproteolysis by collagenase, purification of the E2 moietyaway from f-galactosidase (see Materials and Methods).

Biochemistry: Moskaluk and Bastia

1828 Biochemistry: Moskaluk and Bastia

The collagenase-treated E2 DNA-binding domain will bereferred to as E2Kpn380.

Interaction of the DNA-Binding Domain with the EnhancerSequence.'The region of the Cla I-Hpa I DNA fragment thatcontains the minimal enhancer sequence (4) was subclonedin two blocks into pUC19 vector (Fig. 2). The subcloneswere digested with EcoRI and HindIII, and the enhancersubfragments were purified and 3'-end-labeled with 32p. Thelabeled DNA was incubated with increasing amounts ofpurified E2Kpn380 protein, and the DNA-protein com-plexes were examined by polyacrylamide gel electrophore-sis. The enhancer fragment containing BPV-1 bp 7588-7700undergoes three mobility shifts (Fig. 3 Left). This fragmentcontains three ACCN6GGT motifs. The enhancer fragmentcontaining BPV-1 bp 7747-4840 undergoes two mobilityshifts (Fig. 3 Right). This DNA fragment contains twoACCN6GGT motifs.To further characterize the DNA-protein interactions,

5'-end-labeled DNA fragments of the enhancer subcloneswere incubated with the purified E2Kpn380 protein, treatedwith DNase I, and analyzed by denaturing PAGE. Regionsof the enhancer protected from DNase digestion byE2Kpn380 correspond to the location of the ACCN6GGTmotifs (Fig. 4). Note that the DNA-binding domain presentin E2Kpn380 protein shows similar DNase protection re-gions tQ intact E2 protein (ref. 7, and unpublished data).Data from the gel retardation and DNase footprints is most

simply interpreted as a single unit of E2Kpn38O proteinbinding to each of the ACCN6GGT motifs; this explains thenumber of mobility shifts in gel retardation corresponding tothe number of motifs found in the DNA fragment. Whetherthe protein binds as a monomer or as a multimer at a singlesite is unknown. Al ACCN6GGT motifs are protected by theE2 DNA-binding domain from DNase digestion, and noother DNA sequences are shared between, the DNase-protected regions.

A B C D E F G

3 -.;. ."~

2- ..M W

A 6 C D E

_" -2

FIG. 3. Autoradiograms of gel retardation assays using thepurified E2 DNA binding domain. (Left) 32P-labeled pCM110 Hin-dIII-EcoRI fragment (lane a) was incubated with increasingamounts of purified E2Kpn380 protein and electrophoresed througha 5% nondenaturing polyacrylamide gel. Lanes: B, 1.2 ng of protein;C, 6 ng of protein; D, 12 ng of protein; E, 60 ng of protein; F, 300 ngof protein; G, 600 ng of protein. Three distinct DNA-protein com-plexes appear. (Right) 32P-labeled pCM92 HindIII-EcoRI fragment(lane A) was incubated with increasing amounts of purified E2K-pn380 protein and electrophoresed as above. Lanes: B, 6 ng ofprotein; C, 12 ng of protein; D, 60 ng of protein; E, 300 ng of protein.Two distinct DNA-protein complexes appear.

The E2 DNA-Binding Domain Bends the BPV-1 Enhancer.To investigate protein-induced DNA bending, we con-structed a tandem dimer of the cloned part of the enhancerfrom pCM110 with a section of "spacer" DNA frompBR322. The tandem dimer, shown in Fig. 5, was convertedto circularly permuted linear monomers by cutting at variousrestriction sites; it was then 3' end-labeled and electropho-resed in 5% polyacrylamide gels, either as naked DNA or asDNA-protein complexes (22). Each identical-length mono-mer contained a cluster of three ACCN6GGT motifs; thelocation'of the cluster with respect to ends of the DNAfragment varied depending on the restriction sites used tocreate the monomer. Naked DNAs showed no changes inelectrophoretic mobility regardless of location of the threebinding sites. In contrast, the DNA-protein complex showedsignificant mobility differences depending on location of the

7477CIO I

BPV-I I

7588Has III

7700 7747HIn Pi Sau3AI

%I

% ~~~~~~~~~I%S It x 1A

pCM 110

7600 7620 7640pCM1 10: CCACCAGTAATGGTGCATAGCGGATGTCTGTACCGCCATCGGTGC ACCGATATAGGTF

7660 7680 7700TGGGGCTCCCCAAGGGACTGCT GGGATGACAGCTTCATATTATATTGAATGGGCGC

7750 7770 7790pCM92: GATCTCCACAAAGTACCGTTGCCGGTCGGGGTCAAACCGTC1TCGGTGCTCGAAACCGC

7810 7830CTTAAACTACAGACAGGTCCCAGCCAAGTAGGCGGATC

FIG. 2. Cloning of BPV-1 enhancer subfragments. The Cla I-Hpa I DNA fragment of BPV-1, which contains the functional E2 responsiveenhancer (4), was further digested with Hae III and HinPI to yield pCM110 and with Sau3A1 to yield pCM92. Both plasmids when digestedwith HindIII and EcoRI release the BPV inserts. The BPV-1 bp coordinates are after Chen et al. (21) but'are amended to include two additionalresidues (3, 4). ACCN6GGT motifs are underlined.

7840Sau 3AI

1/ 7947Hpa I

pCM 92

Proc. Natl. Acad. Sci. USA 85 (1988)

I.

Biochemistry: Moskaluk and Bastia Proc. Natl. Acad. Sci. USA 85 (1988) 1829

A B C D E F G H I J

Is

A B C D E F

7679-."p

_ = _

7624-4 _

_59 Amu-- MU

'Mom_,._ -_~4

__5_6 _

am__om

_Z.FIG. 4. Autoradiograms of DNase footprinting. DNase I foot-

printing was done as described in the text. BPV-1 coordinates areindicated by arrows, and the locations of the ACCN6GGT motifs areshown by brackets. The limits of DNase protection are shown by thecurved arrows. (Left) The HindIII-EcoRI fragment of pCM92 wasend-labeled at HindI1 (sense strand). Partially purified E2Kpn380-collagen-(-galactosidase fusion protein (-75% pure) was used.Lanes: A and H, Maxam-Gilbert guanine (G) reactions; B and G,DNase cleavage without fusion protein; C-F, DNase cleavage with1.5 Ag of protein but with decreasing amount of calf thymus DNA-lane C, 5 ,ug of calf thymus DNA; lane D, 1 ,ug of calf thymus DNA;lane E, 0.5 Ag of calf thymus DNA; lane F, 0.1 I.g of calf thymusDNA. Nonspecific protection disappears at carrier DNA levels of0.5 Atg and higher. (Right) HindIII-EcoRI fragment of pCM110 wasend-labeled at HindIl (sense strand). Purified E2Kpn380 protein(150 ng; collagenase treated) and 0.5 ,ug of calf thymus carrier DNAwere used. Lanes: A and F, Maxam-Gilbert guanine (G) reactions;B and E, DNase cleavage in the absence of E2Kpn380 protein; Cand D, DNase cleavage in the presence of E2Kpn380 protein.

three binding sites (Fig. 5 Top). The more centrally locatedthe binding sites were, the more retarded were the DNA-protein complexes in mobility. This pattern of altered mo-bility is consistent with a persistent bend in the DNA and notto differential protein-binding stoichiometry (22, 23). Bend-ing occurred as a result of protein binding to one, two, andthree of the binding sites on a DNA molecule as revealed bythe mobility shifts of the DNA-protein complexes at each ofthe three positions. Bending is thus a consequence of proteinbinding to a single site and is not due to protein-proteininteraction between adjacent complexes. Fig. 5 Bottomsummarizes the bending experiment of the DNA-proteincomplex with all three binding sites filled.

DISCUSSIONIn this work we have localized the DNA-binding domain ofE2 to the carboxyl-terminal 126 amino acids. Gel retardationand DNase I footprint analysis using the E2 DNA-bindingdomain have shown that the protein interacts with theACCN6GGT motif. In our previous work, DNase footprint-ing with the intact E2 protein revealed only a subset of allpossible binding sites (7). We have recently discovered ahierarchy of affinity of E2 for various ACCN6GGT sites

m0

w

w

ir

IP

0

-'0.0 .40 #a

aoa

_> E EFz Ecc- i --a Si I ~~.Ii Si E

(L) x uZ (am UD wZ II IX I'I

100 200 300 400

Map location

FIG. 5. Circularly permuted binding sites reveal that the E2DNA-binding domain bends DNA. (Top) Plasmid pCMD1 wascleaved with restriction enzymes to yield circularly permuted frag-ments that were end-labeled with 32P and were gel electrophoresedwith and without E2Kpn380 protein. Lanes A-E show naked DNAand lanes F-J show DNA-protein complexes. DNA was cut withBamHI (lanes A and F), Nhe I (lanes B and G), EcoRV (lanes C andH), HindIl (lanes D and I) and Cla I and Xba I (lanes E and J).DNA-protein complexes are seen corresponding to first occupiedsite (o), second occupied site (m), and third occupied site ().

Location of E2 binding sites within the identical-length DNAfragments has a profound effect on the mobility of otherwiseidentical DNA-protein complexes. (Middle) The tandem dimer isshown with location of E2 binding sites (U); length of a single repeatis 479 bp. (Bottom) Relative mobility (defined as distance traveledby complexed DNA over distance traveled by naked DNA) of thethree-sites-occupied complex is shown graphically versus the loca-tion of the midpoint of the three binding sites within each DNAfragment. Location of DNA bending is revealed by minimumrelative mobility. Note that location ofDNA bending coincides withlocation of E2 binding sites.

(unpublished data). The previous footprint was of a "high-affinity" site, whereas "low-affinity" sites were not re-

-4

7785-__

_._

7759- 4_

1830 Biochemistry: Moskaluk and Bastia

vealed. Combination of a high yield of soluble purifiedpartial protein and more optimal binding conditions (9)revealed all possible E2 binding sites in the present work.A significant question in eukaryotic gene activation is the

role of DNA-binding proteins in transcriptional activation(24). Is the DNA-binding domain merely an anchor point thatbrings the protein to the right sequence on DNA or does itplay a more active role in transactivation? The answer

appears to differ depending on the system. For example, inGAL4 transactivator protein of yeast, the DNA-bindingdomain can be replaced by a prokaryotic DNA-bindingdomain without losing transactivation function (25). In con-

trast, in glucocorticoid receptor protein of mammals, thetransactivating domain overlaps the DNA-binding domain(26, 27). Transcriptional activation activity of the BPV-1 E2protein appears distinct from the DNA-binding domain. Anaturally occurring version of the truncated E2 proteinfunctions as a transcriptional repressor and acts at the E2responsive elenients (6). The naturally truncated E2 proteincontains the COOH-terminal DNA-binding domain de-scribed here. A possible mechanism of repression involvesthe transcriptionally inactive truncated E2 protein compet-ing with the active intact protein for binding sites in enhancersequences.DNA bending has been shown to occur upon binding of

the simian virus 40 large tumor antigen (28) and the Drosoph-ila heat shock transcription factor (29) to their respectivebinding sites. Although DNA-binding and transcriptionalactivation activities of E2 appear separate, such a role forDNA bending in transactivation is not ruled out. Spalholz etal. (4) noted from deletion analysis that at least one bindingsite at each end of the enhancer element is needed fortransactivation. Because clusters of E2 binding sites on thetwo ends of the minimal enhancer are separated by >100 bpof DNA, cooperative interaction between the two clustersby DNA looping may be necessary for enhancer activity(30). Looping has been demonstrated for DNA-bound pro-

gesterone receptors (31). If E2 engages in such cooperativeinteraction, these interactions may be promoted or stabilizedby the bending of DNA at the binding site. Additional workmust be done to ascertain whether intact E2 protein pro-

motes such interactions.

We thank Dr. David Schmidt for help in the construction ofplasmid pDS100 and Miss Hilda Smith for help in manuscriptpreparation. This work was supported by grants from the NationalInstitutes of Health (NIH) and the National Cancer Institute. C.M.is supported by the NIH Medical Scientist Training Program. D.B.is an Established Investigator of the American Heart Association.

1. Law, M. F., Lowy, D. R., Dvoretzky, I. & Howley, P. M.(1981) Proc. Natl. Acad. Sci. USA 78, 2727-2731.

2. Lowy, D. R., Dvoretzky, I., Shober, R., Law, M. F., Engel,L. & Howley, P. M. (1980) Nature (London) 287, 72-74.

3. Stenlund, A., Zabielski, J., Ahola, H., Moreno-Lopez, J. &Petterson, U. (1985) J. Mol. Biol. 182, 541-554.

4. Spalholz, B. A., Lambert, P. F., Yee, C. L. & Howley, P. M.(1987) J. Virol. 61, 2128-2137.

5. Spalholz, B. A., Yang, Y.-C. & Howley, P. M. (1985) Cell 42,183-191.

6. Lambert, P. F., Spalholtz, B. A. & Howley, P. M. (1987) Cell50, 69-78.

7. Moskaluk, C. & Bastia, D. (1987) Proc. Natd. Acad. Sci. USA84, 1215-1218.

8. Androphy, E. J., Lowy, D. R. & Schiller, J. T. (1987) Nature(London) 325, 70-73.

9. Mallon, R. G., Wojciechowicz, D. & Defendi, V. (1987) J.Virol. 61, 1655-1660.

10. Germino, J. & Bastia, D. (1984) Proc. Natl. Acad. Sci. USA81, 4692-4696.

11. Messing, J. (1983) Methods Enzymol. 101, 20-78.12. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33,

103-119.13. Bolivar, F., Rodriguez, R., Greene, P., Betlach, M., Hey-

hecker, H., Boyer, H., Crosa, J. & Falkow, S. (1977) Gene 2,95-113.

14. Carter, P., Bedouelle, H. & Winter, G. (1985) Nucleic AcidsRes. 13, 4431-4443.

15. Raibaud, O., Hogberg-Raibaud, A. & Goldberg, M. (1975)FEBS Lett. 50, 130-134.

16. Maxam, A. & Gilbert, W. (1980) Methods Enzymol. 65,499-560.

17. McKay, R. (1981) J. Mol. Biol. 145, 471-488.18. Germino, J. & Bastia, D. (1983) Cell 32, 131-140.19. Fried, M. & Crothers, D. (1981) Nucleic Acids Res. 9,

6505-6525.20. Galas, D. & Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170.21. Chen, E. Y., Howley, P. M., Levinson, A. D. & Seeburg,

P. H. (1982) Nature (London) 287, 529-534.22. Wu, H.-W. & Crothers, D. (1984) Nature (London) 308,

509-513.23. Stenzel, T., Patel, P. & Bastia, D. (1987) Cell 49, 709-717.24. Ptashne, M. (1986) Nature (London) 322, 697-701.25. Keegan, L., Gill, G. & Ptashne, M. (1986) Science 231,

699-704.26. Hollenberg, S. M., Giguere, V., Segui, P. & Evans, R. (1987)

Cell 49, 39-46.27. Miesfeld, R., Godowski, P., Maler, B. A. & Yamamoto, K.

(1987) Science 236, 423-427.28. Ryder, K., Silver, S., DeLucia, A. L. & Tegtmeyer, P. (1986)

Cell 44, 719-725.29. Shuey, D. J. & Parker, C. S. (1986) Nature (London) 323,

459-461.30. Schleif, R. (1987) Nature (London) 327, 369-370.31. Theveny, B., Bailly, A., Rauch, M., Delain, E. & Migrom, E.

(1987) Nature (London) 329, 79-81.

Proc. Natl. Acad. Sci. USA 85 (1988)