The Core Promoter of the Capsule Operon of Streptococcuspneumoniae Is Necessary for Colonization and Invasive Disease

Mara G. Shainheit, Matthew Mulé, Andrew Camilli

Department of Molecular Biology and Microbiology, Tufts University School of Medicine and Howard Hughes Medical Institute, Boston, Massachusetts, USA

Streptococcus pneumoniae is a commensal of the human nasopharynx but can cause invasive diseases, including otitis media,pneumonia, sepsis, and meningitis. The capsular polysaccharide (capsule) is a critical virulence factor required for both asymp-tomatic colonization and invasive disease, yet the expression level is different in each anatomical site. During colonization, re-duced levels of capsule promote binding to the host epithelium and biofilm formation, while during systemic infection, in-creased capsule is required to evade opsonophagocytosis. How this regulation of capsule expression occurs is incompletelyunderstood. To investigate the contribution of transcriptional regulation on capsule level in the serotype 4 strain TIGR4, we con-structed two mutants harboring a constitutive promoter that was either comparably weaker (Pcat) or stronger (PtRNAGlu) than thewild-type (WT) capsule promoter, Pcps. Mild reductions in cpsA and cpsE transcript levels in the Pcat promoter mutant resulted ina 2-fold reduction in total amounts of capsule and in avirulence in murine models of lung and blood infection. Additionally, thePtRNAGlu mutant revealed that, despite expressing enhanced levels of cpsA and cpsE and possessing levels of capsule comparableto those of WT TIGR4, it was still significantly attenuated in all tested in vivo niches. Further analysis using chimeric promotermutants revealed that the WT �10 and �35 boxes are required for optimal nasopharyngeal colonization and virulence. Thesedata support the hypothesis that dynamic transcriptional regulation of the capsule operon is required and that the core pro-moter region plays a central role in fine-tuning levels of capsule to promote colonization and invasive disease.

Streptococcus pneumoniae (pneumococcus) is a Gram-positivebacterium that asymptomatically colonizes human nasal pas-

sages. However, it can cause potentially devastating diseases suchas pneumonia, sepsis, and meningitis if it gains access to the lungs,blood, or central nervous system (1–3). As a consequence of thesepneumococcal diseases, approximately 1 million children, pri-marily in developing parts of the world, die each year (2, 4). Inaddition, a similar number of adults, particularly the elderly, dieeach year from invasive pneumococcal diseases (5). The capsularpolysaccharide (capsule) is a critical virulence factor required forboth asymptomatic colonization and invasive disease (1, 6, 7).Interestingly, the amount of capsule present on the surface of S.pneumoniae in each anatomical niche is strikingly different (8–11). Capsule facilitates pneumococcal passage through the mucuslayer in the nasopharynx and prevents detection by host immunecells (1, 12). Once S. pneumoniae passes through the mucus layer,it likely expresses less capsule in order to expose underlying sur-face molecules that promote binding to epithelial cells and theformation of bacterial aggregates called biofilms (9, 13, 14). Bio-films further protect S. pneumoniae from immune surveillanceand antibiotic treatment and allow long-term persistence in thisniche (15, 16). However, during systemic blood infection, S. pneu-moniae must increase capsule expression in order to evade de-struction mediated by complement-mediated opsonophagocyto-sis (17–19). Survival in these different niches thus requires tightcontrol of capsule expression levels. However, the exact molecularmechanisms responsible for regulating capsule expression are un-known.

Earlier work demonstrated that the cps locus is likely tran-scribed as an operon from a single promoter upstream of cpsA (20)and that in the majority of the �90 capsule serotypes, cpsA-cpsD(cpsA-D) are highly conserved and contribute to modulating cap-sule levels (7, 21, 22). Genes downstream of cpsD encode enzymesrequired for serotype-specific synthesis, polymerization, and ex-

port of capsular polysaccharide (7, 23, 24) (Fig. 1A). One potentialmechanism by which S. pneumoniae regulates the amount of cap-sule is at the posttranslational level via a multiprotein phosphore-lay system encoded by cpsA-D (7, 24). Although the role of CpsA islargely unknown, previous work demonstrated that CpsC andCpsD are the transmembrane and cytoplasmic domains of an au-tophosphorylating protein tyrosine kinase, respectively, whileCpsB serves as a phosphotyrosine phosphatase that controls thephosphorylation status of CpsD (25, 26). While it has been shownthat an intact phosphorelay system is needed for production ofwild-type amounts of full-length capsule (27), it remains unclearif the phosphorylation state of CpsD positively or negatively af-fects production of capsule (28–30).

S. pneumoniae may also alter levels of capsule via phase varia-tion between two distinct phenotypes: opaque and transparent.The opaque phenotype is characterized by increased amounts ofcapsule, which promotes virulence in the blood due to enhancedresistance to opsonophagocytosis. Conversely, the transparentvariant possesses less capsule and more exposed cell wall phospho-rylcholine (P-Cho) and surface proteins and is consequently bet-ter at binding epithelial cells and colonizing the nasopharynx (10,11, 17, 18). While the mechanism(s) responsible for capsule phasevariation remains unclear (31–33), it is likely that this processprovides S. pneumoniae with a way to rapidly alter capsule level in

Received 9 October 2013 Returned for modification 3 November 2013Accepted 19 November 2013

Published ahead of print 25 November 2013

Editor: L. Pirofski

Address correspondence to Andrew Camilli, andrew.camilli@tufts.edu.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.01289-13

694 iai.asm.org Infection and Immunity p. 694 –705 February 2014 Volume 82 Number 2

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

order to adapt to dynamic environments and immune pressuresexperienced during infection.

One potential means of controlling the amount of capsule is atthe transcriptional level. Previous work revealed that levels of cap-sule transcripts were significantly enhanced in a mouse model ofblood infection, supporting the notion that S. pneumoniae evadesopsonophagocytic killing by increasing capsule (34). In order toexamine whether the native TIGR4 capsule promoter, Pcps, wasrequired for fine-tuning capsule expression level, we replaced itwith a comparably weaker (Pcat) or stronger (PtRNAGlu) constitu-tively active promoter derived from the chloramphenicol resis-

tance gene from pAC1000 or S. pneumoniae TIGR4 tRNA-Glu-1gene, respectively. Expression of capsule transcripts, totalamounts of capsular polysaccharide, resistance to C3 complementdeposition, and exposed P-Cho were determined for each of thecps promoter mutants. Competition experiments between TIGR4and Pcat or PtRNAGlu mutants in murine models of colonizationand invasive disease in the lungs and blood revealed that dynamiccontrol of the capsule operon via transcriptional control was re-quired for optimal colonization and virulence. Additional exper-iments using two chimeric promoter mutants, PcpsCore, whichcontains the Pcps core promoter sequence and upstream sequencefrom the PtRNAGlu promoter, and PtRNAGluCore, which containsthe PtRNAGlu core promoter sequence and upstream sequence fromPcps, demonstrated that the wild-type �10 and �35 hexamers arekey to colonization and virulence.

MATERIALS AND METHODSBacterial strains and growth conditions. S. pneumoniae TIGR4 (serotype4) and its unencapsulated derivative AC4421 were from our laboratorystock. For the experiments indicated in the text, D39 (serotype 2) was alsoused.

S. pneumoniae was grown in Todd-Hewitt yeast extract (THY) me-dium at 37°C in a 5% CO2 incubator. THY medium was Todd-Hewittbroth (Becton, Dickinson, Co.) supplemented with 0.5% yeast extract(Fischer Scientific, Inc.) and 5 �l/ml Oxyrase (Oxyrase, Inc.). Growth onplates was done on blood agar (BA) plates at 37°C in a 5% CO2 incubator.BA plates were tryptic soy agar plates supplemented with 5% (vol/vol)sheep blood (Northeast Laboratories, Inc.). Where appropriate duringgrowth in THY medium or on BA plates, antibiotics at the followingconcentrations were included: spectinomycin (Spc) at 200 �g/ml andchloramphenicol (Cm) at 4 �g/ml.

5= RACE to identify the transcriptional start site of the capsule pro-moter. To identify the transcriptional start site of Pcps shown in Fig. 1C, aFirst Choice RNA ligase-mediated rapid amplification of cDNA ends(RLM-RACE) kit (Ambion, Inc.) was used per the manufacturer’s in-structions. Briefly, DNase-treated RNA was prepared from mid-exponen-tial-growth-phase TIGR4 cells grown in THY medium (optical density at600 nm [OD600] of 0.6 to 0.8) and subsequently treated with calf intestinephosphatase. After phenol-chloroform extraction, RNA was incubatedwith tobacco acid pyrophosphatase to yield a free 5=monophosphate usedfor adapter ligation using T4 RNA ligase. Samples were reverse tran-scribed and used as a template for nested PCR with forward adapter andreverse cpsA specific primers (Table 1). The resultant amplicon was se-quenced by the Tufts University Core Facility (TUCF) to determine thetranscription start site.

Generation of promoter mutant strains. Promoter mutant strainsillustrated in Fig. 1B were generated by allelic exchange. Each allelic ex-change construct was generated in vitro using splicing by overlap exten-sion PCR (35). The upstream and downstream arms of homology flank-ing the new sequences were PCR amplified from TIGR4 genomic DNA(gDNA). To aid in making these promoter replacements, Spcr and Cmr

cassettes were incorporated into the constructs to allow direct selection oftransformants. These antibiotic resistance cassettes were PCR amplifiedusing plasmids pAC1294 and pAC100, respectively (Table 1), as templates(36–38). In each mutant construction, the three insertion (IS) elementsupstream of the capsule promoter were deleted to avoid recombination ofthe replacement construct with identical IS elements scattered through-out the genome. The cpsA promoter in D39 was replaced with Pcat usingthe same strategy. Transformation of S. pneumoniae was done as previ-ously described (39). All promoter replacement mutations were con-firmed by DNA sequencing.

RNA isolation and cDNA synthesis. Total RNA was isolated from 1ml of mid-exponential-growth-phase bacteria. Cell pellets were snap fro-zen in liquid nitrogen and stored at �80°C until use. Pellets were resus-

FIG 1 Genetic architecture of the cps locus in S. pneumoniae and schematic ofDNA constructs used to generate cps promoter mutant strains and promotersequences. (A) The locus shown is representative of the Wzx-Wzy-dependentcapsule cassette of serotype 4. The capsule locus, �15 kb in size, is locatedbetween the conserved genes dexB and aliA and is flanked on either side byinsertion sequences (IS). cpsA-D are highly conserved across most serotypes.Serotype-specific genes encode all enzymes required to synthesize serotype-specific capsular polysaccharides. (B) Using the depicted DNA constructs, theWT TIGR4 capsule promoter (solid line) was replaced with the mutant pro-moter PtRNAGlu (dotted line, strong constitutive; Spcr) or Pcat (weak constitu-tive; Cmr) by allelic exchange. Chimeric promoter mutants PcpsCore andPtRNAGluCore (both Spcr) were generated in the same fashion. For the pseu-dorevertant PtRNAGluRev (Cmr) and PcatRev (Spcr) strains, the respective mu-tant strain was transformed with a DNA construct containing the native cap-sule promoter. The stem-loop represents a bidirectional terminator. (C)Sequences of the promoters for WT Pcps, PtRNAGlu (strong constitutive), Pcat

(weak constitutive), and chimeric mutants PcpsCore and PtRNAGluCore. Thetranscriptional start site for the WT promoter Pcps was experimentally deter-mined using 5= RACE and is indicated by the solid-line arrowhead. Putativetranscriptional start sites in Pcat, PtRNAGlu, and PtRNAGluCore promoter mu-tants are indicated by the dashed-line arrowheads. Nucleotide differences rel-ative to Pcps are bolded.

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 695

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

TABLE 1 Relevant plasmids and primers used in this study

Plasmid or primer functionand name Sequencea Descriptionb

Reference(s)or source

PlasmidspAC1294 Contains Spcr cassette 36, 37pAC1000 Contains Cmr cassette 36, 38

Primers for qRT-PCR primersF cps4A TGTCAGCTCTGTGTCGCTCT Forward primer in cps4A This workR cps4A ATTAGTCCCAGTCGGTGCTG Reverse primer in cps4A This workF cps4E GGGATAATAATATTGTGTCCGGTTT Forward primer in cps4E This workR cps4E CATTTTTAGGTGCATCTATTTTCA Reverse primer in cps4E This workF cps2A CGCTCAGTGTCGCTGTTTTA Forward primer in cps2A This workR cps2A TCTCCCCTGCAATCAAACTC Reverse primer in cps2A This workF cps2E TGATATCATGGGTGCATTGG Forward primer in cps2E This workR cps2E TCCACCCTGCATGGTATTTT Reverse primer in cps2E This workF rplI CGACCATCTGGACCAACTTT Forward primer in rplI

(housekeeping gene)This work

R rplI CTAGCCAAAGAAGCGACTGC Reverse primer in rplI(housekeeping gene)

This work

Primers for DNA constructsF cat CGGTATCGATAAGCTTGATGAAAATTT Forward primer to amplify cat

gene from pAC1000This work

R cat_noterm_cps4ATail GATTAATACCTATAATTGACATTCAGTCGGCATTATCTCAT Reverse primer to amplify cat genelacking the terminator frompAC1000

This work

R cat_term TGGAGCTGTAATATAAAAACCTTC Reverse primer to amplify cat genewith the terminator frompAC1000

This work

F spc ATCAAGCTTATCGATACCG Forward primer to amplify spcgene from pAC1294

This work

R spc CCTTCAAGAGCGATACC Reverse primer to amplify spc genefrom pAC1294

This work

F dexB CTATCTCCACTTTTTCAGCA Forward primer to amplify dexBfor upstream arm of homologyused in SOE constructs

This work

R dexB_term_catTail ATGAGATAATGCCGACTGAAAAAGGCTGACATTTTTCATGTCAGCCTTTTTCAGTCCTCCCTTGTTTTT

Reverse primer to amplify dexB forupstream arm of homologyused in SOE constructs;bidirectional terminator and tailfor cat gene

This work

F cps4A AATGTTCAATGTATAGGTATTAATCA Forward primer to amplify cps4Afor downstream arm ofhomology used in SOEconstructs

This work

R cps4A AAGATGAACATTGCCTGC Reverse primer to amplify cps4Afor downstream arm ofhomology used in SOEconstructs

This work

F PtRNAGlu spcTail CGGTATCGATAAGCTTGATTCCCAC ATACAGCTCGAA Forward primer to amplifyPtRNAGlu; tail for spc cassette;used to make PtRNAGlu promotermutant

This work

R PtRNAGlu cps4ATail GATTAATACCTATACATTGAACATTCCTGAGTTGTTATTTTCA

Reverse primer to amplifyPtRNAGlu; tail for cps4A; used tomake PtRNAGlu promotermutant

This work

F PtRNAGluRev_catTail GTAGTTCGAATAGCTATGGCTGTGTACTATATTAGATTGAAACTAGA

Forward primer to amplify Pcps;tail for cat cassette; used tomake PtRNAGluRev

This work

R dexB_termPtRNAGluRev CCAAAAATATAATGTCGAGGTAAAAAGGCTGACATTTTTCATGTCAGCCTTTTTCAGTCCTCCCTTGTTTTT

Reverse primer to amplify Pcps; tailfor cps4A; used to makePtRNAGluRev

This work

(Continued on following page)

Shainheit et al.

696 iai.asm.org Infection and Immunity

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

pended in 1 ml of TRIzol (Invitrogen, Corp.) with 4 �l/ml of glycogen (5mg/ml; Ambion, Inc.) and added to O-ring tubes with 400 �l of 0.1-mmZirconia beads (Bio Spec, Inc.). Cells were lysed using a bead beater, andRNA was extracted per the TRIzol manufacturer’s instructions, followedby ethanol precipitation. Samples were further purified using a QiagenRNeasy Kit (Qiagen, Inc.), eluted in 32 �l of diethyl pyrocarbonate(DEPC)-treated water (Ambion, Inc.), and DNase treated using a TurboDNase-free kit (Ambion, Inc.) for 1 h at 37°C. One microgram of theresulting RNA was reverse transcribed in a 20-�l reaction mixture usingan iScript cDNA synthesis kit (Bio-Rad, Inc.) with the following parame-ters: 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. In parallel, foreach sample, controls lacking reverse transcriptase (RT) were run to en-sure that subsequent quantitative reverse transcription-PCR (qRT-PCR)analysis was free of contaminating gDNA. Subsequently, samples werediluted 2-fold with DEPC-treated water and stored at �20°C until anal-ysis.

Quantitation of capsule gene transcription. To determine relativeexpression levels of genes in the capsule operon, quantitative reverse tran-scription-PCR (qRT-PCR) was done using primers specific for cpsA andcpsE and the housekeeping gene rplI (a constitutively expressed ribosomalprotein) (Table 1) that were designed using Primer 3 software (40). SYBRgreen Super Mix (2�; Bio-Rad, Inc.) reaction mixtures contained 1 �leach of forward and reverse primers (10 �M) and 1 �l of cDNA template.Using the housekeeping gene rplI as an internal control, relative expres-sion levels were calculated using the average mean cycle threshold (CT)value for rplI and the gene of interest for each sample and the equation1.8e(CT rplI � CT gene of interest) (41).

Immunodot blot assays. For the purpose of quantifying the amountof capsule present in wild-type and promoter mutant strains using immu-nodot blotting, 1 ml of OD600-matched mid-exponential-growth-phasebacteria was pelleted and stored at �20°C until use. Samples were resus-pended in 300 �l of cell wall lysis buffer (50 mM Tris, pH 7.5, 1 mg/mllysozyme, 300 U/ml mutanolysin [Sigma-Aldrich, Co.]) and incubated at37°C for 30 min. Subsequently, samples were sonicated for 3 min at 4°C atmaximum amplitude using a water bath sonicator (Branson, Inc.). Sam-ples were 2-fold serially diluted in phosphate-buffered saline (PBS), and 5�l was spotted on 0.2-�m-pore-size nitrocellulose membranes (Invitro-

gen, Inc.) with suction. Membranes were processed according to theSNAP i.d. Protein Detection System (Millipore, Corp.) instructions usingrabbit anti-serotype 4 serum (Statens Serum Institut) and Cy5-conju-gated goat anti-rabbit secondary antibody (Invitrogen, Inc.), both at adilution of 1:600. Membranes were scanned on a Fuji scanner, and relativefluorescence as normalized to a blank was calculated using MultiGaugeanalysis software (Fujifilm, Corp.). To ensure that differences in capsuleintensity were not due to differences in total amounts of cells amongsamples, aliquots were subjected to protein analysis using a MicroBCAProtein Kit (Thermo Scientific, Inc.).

C3 deposition, exposed phosphocholine (P-Cho) assays, and fluo-rescence-activated cell sorter (FACS) analysis. For C3 deposition assays,1 ml of mid-exponential-growth-phase bacteria was pelleted, washed inPBS, and resuspended in 500 �l of Hanks buffer with Ca2� and Mg2�

(Gibco, Corp.) supplemented with 0.1% gelatin (Fischer Scientific, Inc.).C3 deposition reaction mixtures (150 �l) were comprised of 107 CFU in50 �l and 100 �l of infant rabbit serum to a final concentration of 10%(AbD Serotec, Co.). Samples were incubated in a 37°C rolling incubatorfor 30 min. Next, opsonization reaction mixtures were chilled for 3 minon ice, quenched with 500 �l of Hanks buffer without Ca2� and Mg2�

(Gibco) with 0.1% gelatin and pelleted at 4,000 rpm for 5 min. Pellets wereresuspended in fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit C3 antibody in 100 �l of Hanks buffer without Ca2� and Mg2�

with 0.1% gelatin at 1:200 (MP Biomedicals) and incubated on ice in thedark for 30 min. Staining reactions were quenched with 500 �l of Hanksbuffer without Ca2� and Mg2� with 0.1% gelatin and centrifuged at 4,000rpm for 5 min, and pellets were resuspended in 300 �l of 2% paraformal-dehyde (PFA; Sigma-Aldrich, Co.). Samples were collected (25,000events) on a FACSCalibur analytical flow cytometer.

For exposed P-Cho assays, 300 �l of mid-exponential-growth-phasebacteria was pelleted and washed in PBS. Pellets were resuspended in 100�l of unconjugated mouse IgA anti-P-Cho at 1:100 in 1� PBS and incu-bated on ice for 30 min. Samples were quenched with 500 �l of 1� PBSand centrifuged at 4,000 rpm for 5 min. Pellets were resuspended in 100 �lof phycoerythrin (PE)-conjugated rat anti-mouse IgA secondary antibodyat 1:100 in PBS and kept on ice, in the dark, for 30 min. Staining reactionswere quenched with 500 �l PBS, and products were pelleted, resuspended

TABLE 1 (Continued)

Plasmid or primer functionand name Sequencea Descriptionb

Reference(s)or source

F PcatRev_spcTail CGGTATCGATAAGCTTGATTGTGTACTATATTAGATTGAAACTAGA

Forward primer to amplify Pcps;tail for cat cassette; used tomake PcatRev

This work

R dexB_termPcatRev GGTATCGCTCTTGAAGGAAAAAGGCTGACATTTTTCATGTCAGCCTTTTTCAGTCCTCCCTTGTTTTT

Reverse primer to amplify Pcps; tailfor cps4A; used to make PcatRev

This work

F PtRNAGluCore TTGACAAAGTTTGAAAAGACTGTATAATAGTAAGAGTTGAAAATAACAACTCAGGGTTCAATGTATAGGTATTAATCA

Forward primer to amplify corepromoter of PtRNAGlu with 5=tail for Pcps upstream sequence;used to make PtRNAGluCore

This work

R PtRNAGluCore CCTGAGTTGTTATTTTCAACTCTTACTATTATACAGTCTTTTCAAACTTTGTCAACACCTTTATTTTTACTATCTGC

Reverse primer to amplify Pcps

upstream sequence with 5= tailfor core promoter of PtRNAGlu;used to make PtRNAGluCore

This work

F PcpsCore AAAAAAGTTTAAAAAGTAGTAGACATTACCGTAAAAAAG Forward primer to amplify corepromoter of Pcps with 5= tail forPtRNAGlu upstream sequence;used to make PcpsCore

This work

R PcpsCore CTACTTTTTTAAACTTTTTTTATTAATTTTACA Reverse primer to amplifyPtRNAGlu upstream sequencewith 5= tail for core promoter ofPcps; used to make PcpsCore

This work

a Primer sequences are given 5= to 3=.b SOE, spliced overlap extension.

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 697

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

in 300 �l of 2% PFA and analyzed as described above. All FACS data wereanalyzed and plotted using Flowlogic (Inivai Technologies).

Animal infections. All procedures involving mice were reviewed andapproved by the Institutional Animal Care and Use Committee at TuftsUniversity School of Medicine. All competition experiments used femaleSwiss Webster mice, 6 to 9 weeks old (Taconic Laboratories). TIGR4 orD39 and isogenic promoter mutant strains of interest were grown to mid-exponential phase in THY medium and mixed at a 1:1 ratio. For nasopha-ryngeal colonization and lung infection, isoflurane-anesthetized micewere inoculated with 10 �l (5 �l/nare; 109 CFU/ml) and 40 �l (2.5 � 108

CFU/ml) of the 1:1 mix, respectively. For blood infections, mice received�104 CFU in 100 �l by intraperitoneal (i.p.) injection. Mice were eutha-nized at the appropriate time points (5 days after nasopharyngeal coloni-zation, 36 to 48 h after lung infection, and 24 to 36 h after blood infection)by CO2 asphyxiation. Nasal flushes were performed with 500 �l of sterilePBS. Lungs were perfused with 10 ml of PBS, aseptically removed, andhomogenized in 1 ml of sterile PBS. To recover bacteria from the blood,500 �l of blood was removed by cardiac puncture, and clotting was pre-vented with 3 �l of 500 mM EDTA. Serial dilutions of recovered bacteriafrom each mouse were plated on BA and BA supplemented with Spc orCm where appropriate. The competitive index (CI) of each promotermutant strain was calculated using the following equation: (mutant out-put CFU/WT output CFU)/(mutant input CFU/WT input CFU). On theoccasion that no mutant bacteria were recovered from an animal, thenumerator was given a value of 1 in order to calculate a maximum CIvalue.

To rule out the possibility that any observed in vivo attenuation inpromoter mutant strains was due to a defect in overall viability, in vitrocompetition experiments were performed between wild-type TIGR4 andPcat, PtRNAGlu, or PtRNAGluCore strains. Wild-type and promoter mutantstrains were grown to mid-exponential phase in THY medium; 1-ml ali-quots were pelleted and resuspended in THY medium. Strains were mixedat a 1:1 ratio, serially diluted, and differentially plated on BA and BA plusthe appropriate antibiotic (Spc or Cm) to determine the input ratio ofmutant/wild type. Subsequently, the 1:1 mix was inoculated at a 1:100dilution into THY medium and grown to mid-exponential phase (�4 h).A volume of bacteria was serially diluted and differentially plated on BAand BA plus antibiotic to calculate the output ratio of wild-type versuspromoter mutant bacteria at the end of the competition. The CI wasdetermined by the same equation described for the in vivo experimentsabove. All promoter mutants demonstrated no in vitro growth defectcompared to the wild type (data not shown).

Statistical analysis. Wilcox signed-rank tests and one-way analysis ofvariance (ANOVA) statistical tests were performed where indicated in thefigure legends using GraphPad Prism (GraphPad Software, Inc.).

RESULTSGenerating cps promoter mutant strains and evaluating in vitrolevels of capsule gene expression. S. pneumoniae occupies drasti-cally different anatomical niches during nasopharyngeal coloniza-tion and invasive disease in the blood or lungs (8–11). Theamounts of capsule present on the pneumococcal surface in eachsite have been reported to be markedly different. This supports thehypothesis that S. pneumoniae tightly controls the level of capsuleexpression in order to optimize fitness. One potential means bywhich S. pneumoniae controls the amount of capsule is at thetranscriptional level (34). A bioinformatics approach was previ-ously taken to identify the promoter elements in the sequenceimmediately upstream of the first gene in the capsule operon, cpsA(Fig. 1A) (42). However, there has been no experimental datareported that identify the transcriptional start site and promotersequences for the capsular operon. To do so, we performed 5=RACE on RNA isolated from mid-exponential-growth-phaseTIGR4 bacteria. As shown in Fig. 1C, data from this experiment

located the transcription start site to a position 12 bp downstreamfrom the start of a consensus �10 box and 35 bp downstream of anear consensus sigma-70 Pribnow box or �35 box which con-tained one mismatch from the consensus, TTGACA. Of note, the17-bp spacing between the �10 and �35 boxes differs from theoptimal 16-bp spacing (43, 44). We designated these the core ele-ments of the native Pcps in TIGR4, and we utilized this informationto construct a panel of cps promoter replacements to determinehow transcriptional regulation impacts capsule expression as wellas colonization and virulence phenotypes. Two promoter replace-ment mutants, Pcat and PtRNAGlu, were constructed by replacingthe entire intergenic region and divergent IS elements upstream ofcpsA. We showed that Pcat and PtRNAGlu constituted weak andstrong constitutively active promoters relative to Pcps, respectively(Fig. 2). A priori, Pcat was predicted to be weaker than Pcps due to its�35 box having two mismatches from the consensus, while PtRNAGlu

was predicted to be a stronger promoter based on its consensus �10/�35 boxes, ideal spacing of 16 bp, and presence of an extended �10sequence (TG motif) known to stabilize RNA polymerase-DNA in-teractions (43–46). Additionally, we constructed two chimeric pro-moter mutant strains, the PcpsCore mutant, which possesses thewild-type Pcps core promoter (�35 to start site) paired with thePtRNAGlu sequence upstream of the �35 box, and the PtRNAGluCoremutant, which possesses the wild-type sequence from down-stream of the deleted IS elements to the �35 box paired with the

FIG 2 Capsule gene expression in cps promoter mutant strains. Promotermutant strains were grown to mid-exponential phase in THY. Total RNA wasextracted from 1-ml aliquots and reverse transcribed into cDNA. qRT-PCRwas performed using primers specific for cpsA or cpsE, and results were normal-ized to the housekeeping gene rplI. Data are presented as relative units compared tothe WT (TIGR4 or D39). Data shown for TIGR4, Pcat, and PtRNAGlu are means �standard deviations of three to five independent experiments. ***, P 0.001,compared to TIGR4 using one-way ANOVA. Data shown for PcatRev,PtRNAGluRev, D39, D39 Pcat mutant, and chimeric promoter mutants aremeans � standard deviations of two to three independent experiments.

Shainheit et al.

698 iai.asm.org Infection and Immunity

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

core promoter including the extended �35 box from PtRNAGlu

(Fig. 1B and C). This panel of mutants allowed us to investigate thefollowing: (i) how modulation of capsule transcripts impactsamounts of capsular polysaccharide on the cell surface, (ii) if dy-namic control of capsule genes is required for optimal coloniza-tion and invasive disease, and (iii) which region(s) of the nativePcps promoter is critical for colonization and virulence.

To evaluate the effect of the mutant cps promoters on capsuletranscript levels, we performed qRT-PCR analysis on mid-exponen-tial-growth-phase bacteria using primers for cpsA and cpsE (Fig. 2).Gene expression was normalized to rplI, and values shown are relativeunits compared to TIGR4. As anticipated, the mutant strain contain-ing a strong constitutively active promoter, PtRNAGlu, expressed ap-proximately 2-fold higher levels of cpsA and cpsE than TIGR4 (Fig. 2).Importantly, the pseudorevertant PtRNAGluRev strain, in which thenative promoter and upstream sequences were restored while theantibiotic cassette was retained (Fig. 1B), expressed WT levels of cap-sule transcripts, thus confirming that any observed phenotype wasdue to the promoter replacement and not to the presence of the cis-encoded antibiotic cassette, deletion of the IS elements, or to secondsite mutations. Although not statistically significant, the mutantstrain containing a weak constitutively active promoter, Pcat, exhib-ited slightly reduced levels of cpsA and cpsE, which was also observedin a serotype 2 strain, D39, suggesting that this phenotype is not se-rotype specific (Fig. 2). The PcpsCore chimeric promoter mutant ex-pressed levels of cpsA comparable to the TIGR4 level. Surprisingly, thePtRNAGluCore mutant had a lower expression level of cpsA than itsparental PtRNAGlu strain. It is possible that a synergistic interactionbetween the core promoter sequence and the upstream element isrequired for increased expression, and its disruption in the PtRNAGlu-

Core strain results in an expression level similar to that of wild type.Taken together, these findings indicate that the presence of a pro-moter with various strengths upstream of the capsule operon canaccordingly influence expression levels of cps transcripts.

Characterization of capsular polysaccharide on cps pro-moter mutant strains using C3 deposition, exposed phospho-choline, and immunodot blot assays. Previous work demon-strated that S. pneumoniae serotypes possessing enhanced levels ofcapsule were more resistant to complement C3 deposition andsubsequent phagocytosis by neutrophils, while less encapsulatedstrains were extremely sensitive (17, 47–49). Additionally, resis-tance to complement deposition was shown to correlate with en-hanced virulence in an animal model of otitis media (50), sup-porting the notion that the capsule is a critical virulence factor thatfacilitates the development of disease. With this knowledge, weused a FACS-based complement C3 deposition assay to indirectlyquantify the amounts of capsule on cps promoter mutant strains.For these experiments, mid-exponential-growth-phase bacteriawere subjected to in vitro opsonization assays with infant rabbitserum (a rich source of complement C3) and subsequent stainingwith anti-C3 antibody followed by flow cytometric analysis. Asexpected, an unencapsulated mutant strain of S. pneumoniae, thecps strain, was the most sensitive to C3 deposition and exhibited�60-fold larger amounts of C3 deposition than TIGR4 (Fig. 3Aand D). In accordance with the qRT-PCR data that revealed a mildreduction in cpsA and cpsE gene expression, the Pcat promotermutant was approximately 3-fold more susceptible to C3 deposi-tion, indicating that it possesses reduced capsule expression (Fig.3A, B, and D), while the PcatRev strain recovers the wild-type C3deposition phenotype (Fig. 3B and D). Despite the significant in-

crease in capsule gene transcript levels, the PtRNAGlu promoter mu-tant strain did not exhibit enhanced resistance to C3 depositioncompared to WT TIGR4 as we might have anticipated (Fig. 3A andD). Additionally the PcpsCore and PtRNAGluCore chimeric pro-moter mutant strains demonstrated amounts of C3 depositioncomparable to the amount of TIGR4 (Fig. 3 C and D).

In another approach to assess capsule-related phenotypes ofcps promoter mutant strains, we examined the amount of exposedP-Cho on mid-exponential-growth-phase bacteria using flow cy-tometry. Akin to the inverse relationship between amount of cap-sule and C3 deposition, opaque variants of S. pneumoniae havethicker capsules and less exposed P-Cho, while transparent vari-ants have less capsule and consequently possess more exposedP-Cho (10, 17, 18). Our experiments corroborated the resultsfrom the C3 deposition assays and revealed that both the cps andPcat promoter mutant strains have significantly higher levels ofexposed P-Cho than TIGR4, while the PcatRev strain was restoredto the TIGR4 level (Fig. 4A and B). Again, despite the augmentedlevels of cps transcripts in the PtRNAGlu strain, this did not result inreduced levels of exposed P-Cho (Fig. 4A and B). Additionally, thePcpsCore and PtRNAGluCore chimeric promoter mutant strains ex-hibited P-Cho phenotypes similar to the phenotype of TIGR4(Fig. 4B).

In a third assay we directly quantified the amount of capsulepresent on the cps promoter mutant strains using an immunodotblot assay. Bacteria were grown to mid-exponential phase in THYmedium, adjusted to identical optical densities, and subsequently2-fold serially diluted and transferred to a nitrocellulose mem-brane. In additional experiments, samples were normalized to cellnumber or to total protein content to ensure that any differencesin capsule signal were not due to discrepancies between opticaldensity and these other valid measurements (data not shown).Blots were developed using unconjugated rabbit anti-serotype 4serum and a Cy5-conjugated goat anti-rabbit secondary antibody.The Pcat promoter mutant strain possessed approximately 2-foldless capsule than TIGR4, while the PtRNAGlu strain exhibited com-parable levels of capsular polysaccharide (Fig. 5A and B). Thepseudorevertant PcatRev strain restored capsule levels back to thewild-type level. Taken together, these data reveal that even a mildreduction in cps transcripts, observed in the Pcat strain, can resultin a significant phenotype related to the amount of capsule foundon the cell surface. Conversely, overexpression of capsule genes inthe PtRNAGlu strain may not directly result in overproduction ofcapsule. It may be possible that other regulatory mechanisms suchas the phosphorelay system encoded by cpsA-D contribute to thetotal amount of capsular polysaccharide on the cell surface (24, 25,28, 29).

Analysis of cps promoter mutant strains in murine models ofnasopharyngeal colonization and invasive disease. Based on ourhypothesis that S. pneumoniae exerts transcriptional control of thecapsule expression level in order to thrive in different host niches,we tested the panel of cps promoter mutants in murine models ofcolonization and invasive disease in the lung and blood. For theseexperiments, we competed TIGR4 against each of the cps pro-moter mutant strains. These experiments revealed that despiteonly a 2-fold reduction in capsule (Fig. 5A and B), the Pcat pro-moter mutant strain was severely attenuated in all tested niches(Fig. 6A). The Pcat strain was attenuated 50-fold in the nasophar-ynx, while in the lungs and blood we failed to recover any of themutant, indicating that it was completely avirulent in these niches

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 699

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

(Fig. 6A). To ensure that the inability to recover Pcat bacteria fromthe blood following i.p. inoculation was not due to a defect in thebacteria’s ability to escape the peritoneal cavity and gain access tothe blood, we repeated these experiments using intravenous (i.v.)

injections. Regardless of route of administration, there were norecovered Pcat mutant cells in the bacteremia model of infection(data not shown). Importantly, the PcatRev pseudorevertant strainwas restored to full virulence in all three animal infection models

FIG 3 Complement C3 deposition on cps promoter mutant strains of S. pneumoniae. Mid-exponential-growth-phase bacteria were incubated with 10% infantrabbit serum, and C3 deposition on pneumococcal cells was determined by flow cytometry using an FITC-conjugated goat anti-rabbit C3 antibody. (A)Representative histogram overlay plots comparing the C3 deposition phenotypes of WT TIGR4, cps, Pcat, and PtRNAGlu promoter mutant strains. (B and C)Representative histogram overlay plots, from a different independent experiment, comparing C3 deposition phenotypes of WT TIGR4, Pcat, and PcatRev or of WTTIGR4, PcpsCore, and PtRNAGluCore. (D) Mean fluorescence intensity (MFI) of the C3� population, shown as fold increase relative to WT TIGR4 � standarddeviations from three to five independent experiments. *, P 0.05, compared to TIGR4 using one-way ANOVA.

Shainheit et al.

700 iai.asm.org Infection and Immunity

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

(Fig. 6A). Given the striking loss of virulence of the Pcat mutant inthe TIGR4 strain background, we tested whether the same cpspromoter mutation in another capsular serotype strain wouldyield the same phenotype. For this we evaluated the Pcat mutantpromoter in the serotype 2 strain, D39. Similar to data obtained inthe TIGR4 background, the D39 Pcat mutant demonstrated an8-fold defect in the nasopharynx and complete attenuation in theblood compared to the WT D39 (Fig. 6B).

Remarkably, despite exhibiting a comparable level of capsuleexpression to TIGR4 in vitro, the constitutive PtRNAGlu promotermutant demonstrated �10-fold attenuation in models of naso-pharyngeal colonization and invasive disease in the lungs andblood (Fig. 6C). The pseudorevertant PtRNAGluRev strain was re-stored for colonization and virulence. These data indicate that,despite the wild-type amount of capsule provided by the PtRNAGlu

promoter during growth in vitro, the levels of expression in vivoare not optimal for colonization and systemic infection. Althoughseveral possible explanations for these observations exist, we favorthe possibility that this promoter lacks the dynamic transcrip-tional regulation afforded by the native Pcps promoter in vivoneeded to ensure that optimal amounts of capsule are made ineach host niche.

Examining regions of Pcps necessary for colonization and vir-ulence. Based on our observations from the in vivo competitionexperiments between the TIGR4 strain and cps Pcat and PtRNAGlu

promoter mutants, we hypothesized that some characteristic af-forded by the Pcps promoter, such as dynamic transcriptional reg-ulation of cps genes or possibly stochasticity of the promoter itself,is required for optimal colonization and virulence. To start exam-ining regions of the Pcps promoter involved in controlling capsuleexpression to allow for the aforementioned in vivo processes, wegenerated two chimeric promoter mutant strains, the PcpsCoreand PtRNAGluCore strains, which are designed to test the role of thePcps core elements. The PcpsCore promoter contains native (Pcps)sequence starting from the �35 hexamer and proceeding down-stream, paired with the upstream sequence from the PtRNAGlu pro-moter, while the PtRNAGluCore strain harbors PtRNAGlu sequence

FIG 4 Exposed phosphocholine on cps promoter mutant strains. WT TIGR4and cps promoter mutant strains were grown to mid-exponential phase andstained with an unconjugated TEPC15 mouse IgA anti-phosphocholine anti-body, followed by a PE-conjugated rat anti-mouse secondary antibody. Sam-ples were fixed in 2% PFA and read on a FACSCalibur flow cytometer. (A) Arepresentative histogram plot of the mean fluorescence intensity of TEPC15antibody binding to exposed phosphocholine (P-Cho�) on WT TIGR4, cps,Pcat, and PtRNAGlu promoter mutant strains. The gate was set based on a nega-tive control that was treated with secondary antibody only. (B) Mean fluores-cence intensity (MFI) of exposed P-Cho bound by TEPC15 antibody on WTTIGR4, cps, and capsule promoter mutant strains. Data shown for TIGR4,cps, Pcat, PtRNAGlu, and PcatRev strains are means � standard deviations ofthree to four independent experiments; data for chimeric promoter mutantsare from two independent experiments. ***, P 0.001, compared to TIGR4using one-way ANOVA.

FIG 5 Quantitative immunodot blot analysis of total capsule in cps promotermutant strains. Strains of interest were grown to mid-exponential phase inTHY medium; 1-ml aliquots were pelleted and resuspended in 1� PBS tomatch OD600 values across samples. Samples were serially 2-fold diluted, and 5�l was spotted onto a nitrocellulose membrane with suction. Membranes weredeveloped using rabbit anti-serotype 4 sera and a Cy5-conjugated goat anti-rabbit secondary antibody. Blots were read, and relative fluorescence unitswere calculated using a Fuji Imager and MultiGauge software. (A) Represen-tative immunodot blots from two independent experiments showing a 2-folddilution series for each strain. (B) Quantitation of relative fluorescence inten-sity compared to a blank lane relative to the WT TIGR4. Data shown forTIGR4, cps, Pcat, and PtRNAGlu strains are means � standard deviations fromfour independent experiments; data for the PcatRev strain are from two inde-pendent experiments. **, P 0.01, and ***, P 0.001, compared to TIGR4using one-way ANOVA.

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 701

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

starting from the �35 hexamer and proceeding downstream,paired with the native upstream sequence (Fig. 1B and C). Forthese experiments, in vivo competitions between TIGR4 and thePcpsCore or PtRNAGluCore strain were performed in the nasophar-ynx and blood. As shown in Fig. 7A and B, the PcpsCore chimericpromoter mutant exhibited wild-type levels of both colonization

and virulence. However, the PtRNAGluCore mutant was attenuatedto the same extent as the PtRNAGlu mutant in both tested niches(Fig. 6C and 7). These data indicate that the wild-type �10/�35promoter elements play a central role in regulating transcriptionof the cps operon to allow for optimal colonization and invasivedisease.

DISCUSSION

The capsular polysaccharide is a critical virulence factor requiredfor effective S. pneumoniae colonization of the nasal passages andinvasive disease in the lungs and blood (1, 6, 7). Previous workhighlights the need to fine-tune levels of capsule expression duringthese different stages within the host. During nasopharyngeal col-onization, an initial amount of capsule is necessary to preventmucus-mediated clearance (12), but this transitions to a scenariowhere less capsule is favored to expose underlying surface mole-cules that facilitate adherence to epithelial cells and promote bio-film formation (9, 13, 14, 51). Conversely, during invasive disease,enhanced levels of capsule are necessary to resist C3-mediatedopsonophagocytic killing (11, 17, 18, 47). Taken together, thesedata demonstrate that S. pneumoniae must effectively fluctuatebetween two strikingly different capsule phenotypes, yet the un-derlying regulatory mechanisms are poorly understood.

In this study, we examined the role of transcriptional regula-tion as a potential mechanism of controlling capsule expression.To do so, we constructed two cps promoter mutants, each of whichharbored a constitutively active promoter driving transcription ofthe capsule operon. As expected, the PtRNAGlu mutant strain, witha strong constitutively active promoter compared to the nativepromoter Pcps, exhibited augmented cps transcripts, while theweaker mutant promoter Pcat yielded a mild reduction in capsuletranscripts. Although the PtRNAGlu mutant demonstrated elevatedcps transcripts, in vitro characterization experiments using C3 de-position, exposed P-Cho, and immunodot blot assays revealedthat this failed to result in more total capsular polysaccharide onthe cell. It is possible that despite the presence of more cps tran-scripts, the cell may possess a maximum synthesis or export limitthat has already been achieved, and, consequently, the presence ofmore transcripts fails to yield more capsule on the cell surface.Surprisingly, despite only a modest reduction in cpsA and cpsEexpression levels, the Pcat mutant exhibited a major (2-fold) re-duction in capsule expression. These data suggest that posttran-scriptional regulatory mechanisms, such as those mediated by theill-defined CpsA-D phosphorelay system, may also play a role incontrolling capsule levels that could either prevent the increase ofcapsular polysaccharide in the presence of more transcripts oraccentuate mild decreases in cps transcripts (7, 28, 29). Addition-ally, certain environmental conditions such as the availability ofoxygen may also play a role in posttranscriptional regulation ofcapsule (30).

In regard to the effect of capsule expression on colonizationand invasive disease, our data suggest that modulation of capsularpolysaccharide, with either an increase or decrease in capsule lev-els, is critical. It was somewhat expected that a 2-fold reduction incapsular polysaccharide in the Pcat promoter mutant would ren-der this strain more susceptible to mucus-mediated clearance dur-ing in vivo nasopharyngeal colonization experiments (12). How-ever, the striking in vivo defect observed in lung and blood modelsof invasive disease, where the Pcat mutant was completely aviru-lent, was rather surprising. These data are at odds with a previous

FIG 6 PtRNAGlu and Pcat promoter mutant strains are attenuated during in vivocolonization and invasive disease. Competition experiments between the WTTIGR4 and Pcat (A) or PtRNAGlu (C) strain were conducted in the nasopharynx(Naso), lung, and blood. (B) D39 Pcat mutant versus WT D39 competitionexperiments were performed in the nasopharynx and blood. In all experi-ments, mutant and WT bacteria were grown to mid-exponential phase,washed in 1� PBS, mixed 1:1, and inoculated into Swiss Webster mice (107

CFU/mouse, nasopharynx and lungs; 104 CFU/mouse, blood). Mice were eu-thanized, and bacterial counts in nasopharyngeal lavage fluids, lung homoge-nates, or blood were determined by plating for CFU. CI values were calculatedby dividing the numbers of CFU for the cps promoter mutant by those for theWT. The horizontal bar shows the median for each group. Each point repre-sents an individual mouse. Open symbols indicate a mouse that yielded nodetectable mutant colonies; a value of 1 was assigned for the numerator inorder to determine a maximum CI value for these animals. **, P 0.01, usingWilcox signed-rank tests.

Shainheit et al.

702 iai.asm.org Infection and Immunity

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

study conducted in a serotype 3 strain, which reported that a mu-tant expressing �20% capsule level compared to the wild type wasstill virulent in the blood (6). However, the disparity between ourdata may be due to the fact that serotype 3 strains typically expresslarger amounts of capsule and a simpler polysaccharide structurethat is produced via a unique synthesis mechanism (7), coupledwith there being a wide range in virulence dependent upon cap-sular serotypes (52, 53). One potential mechanism for the com-plete attenuation of the Pcat promoter mutant strain during bloodinfection may be due to the increase in exposed P-Cho. Previousreports demonstrated that high concentrations of C-reactive pro-tein found in the blood bind exposed P-Cho molecules and initi-ate the classical complement cascade leading to enhanced clear-ance (17, 54, 55). Another possibility is that the observed increaseof C3 complement deposited on the Pcat mutant likely increases itssusceptibility to opsonophagocytic killing (17, 47, 48). Whateverthe defect, the phenotype of increased clearance of the Pcat mutantmanifests very rapidly, as revealed by the mutant being clearedfrom the blood by 15 min after intravenous injection (data notshown). In contrast, the complete attenuation of the Pcat mutantin the mouse lung is harder to explain. One possibility is thatmechanisms of clearance dependent on C-reactive protein and/orC3 are also happening in the lung. Alternatively, dynamic regula-tion of capsule is needed for different stages of lung colonizationand bacterial multiplication.

The in vivo attenuation of the PtRNAGlu promoter strain, whichhad comparable levels of capsular polysaccharide compared toTIGR4 in vitro, indicates that some level of dynamic regulationmay be needed during colonization and systemic infection. Basedon previous work, it is possible to hypothesize that the PtRNAGlu

promoter mutant is incapable of effectively colonizing the naso-pharynx due to its inability to downregulate capsule and exposeunderlying surface molecules that facilitate adhesion to the epi-thelium and subsequent biofilm formation (9, 13, 14). Similarly, ifS. pneumoniae needs to augment capsule levels during invasivedisease in the lungs or blood (34), the PtRNAGlu promoter mutantmay be more sensitive to immune killing due to the presence ofconstitutively active promoter driving expression of capsulegenes. While it is possible that constitutive expression of capsulegenes may impact posttranscriptional regulatory mechanisms, wefavor the model that the inability to dynamically tune capsule level

in various host niches with different capsule requirements resultsin significant defects during colonization and invasive disease.

The data from experiments using Pcat and PtRNAGlu promotermutants suggest that the native Pcps promoter possesses someunique property that allows modulation of the capsule level. Ouranalysis of two chimeric promoter mutant strains, the PcpsCoreand PtRNAGluCore mutants, demonstrated that the PcpsCore mu-tant was capable of colonizing the nasopharynx and causing sys-temic infection, while the PtRNAGluCore mutant that contained themutant �10/�35 hexamers was �10-fold defective in bothniches. These data suggest that the potential regulatory compo-nent of the Pcps promoter is located within the core promotersequences. These data are supported by reports demonstratingthat the sequences of the �10/�35 boxes, as well as the sequenceand spacing between these two hexamers, can significantly impacttranscription of downstream genes (43–45).

In conclusion, this study describes the potential contributionof the native capsular operon promoter, Pcps, on the regulation ofcapsular polysaccharide levels in S. pneumoniae. These experi-ments support the model that capsule is a critical virulence factorthat must be dynamically controlled in order for S. pneumoniae tothrive in niches in which amounts of capsule are differentiallyrequired. Observations from in vivo experiments revealed that amild reduction in capsular polysaccharide is sufficient to yield acompletely avirulent TIGR4 strain. However, a constitutive pro-moter mutant strain possessing similar initial amounts of capsulecompared to the wild-type strain is also attenuated during coloni-zation and invasive disease. Taken together, these data indicatethat Pcps and its core elements, in particular, are required forproper modulation of capsule expression to allow optimal coloni-zation and virulence. Future studies are needed to determine if thecore promoter sequences, spacing, or both are required for mod-ulating capsular polysaccharide expression and also to determinewhether the regulation is graded or stochastic in nature.

REFERENCES1. Kadioglu A, Weiser JN, Paton JC, Andrew PW. 2008. The role of

Streptococcus pneumoniae virulence factors in host respiratory coloniza-tion and disease. Nat. Rev. Microbiol. 6:288 –301. http://dx.doi.org/10.1038/nrmicro1871.

2. Mitchell TJ. 2000. Virulence factors and the pathogenesis of disease

FIG 7 Core promoter of Pcps is necessary and sufficient for intact colonization and virulence. In vivo competition experiments between WT TIGR4 and thechimeric PcpsCore or PtRNAGluCore promoter mutant were performed in the nasopharynx and blood. For all experiments, WT TIGR4 and PcpsCore or PtRNAGlu-

Core mutant strains were grown to mid-exponential phase in THY medium, washed in 1� PBS, and mixed at a 1:1 ratio. Swiss Webster mice were inoculatedeither intranasally (107 CFU/mouse) or i.p. (104 CFU/mouse) and euthanized at the appropriate time point, and bacteria were recovered from nasopharyngeallavage fluids or blood for enumeration. CI values were calculated by dividing the numbers of CFU for the chimeric promoter mutant by those for TIGR4. Thehorizontal bar shows the median for each group. Each point represents an individual mouse. **, P 0.01, using Wilcox signed-rank tests.

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 703

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

caused by Streptococcus pneumoniae. Res. Microbiol. 151:413– 419. http://dx.doi.org/10.1016/S0923-2508(00)00175-3.

3. Tuomanen EI, Austrian R, Masure HR. 1995. Pathogenesis of pneumo-coccal infection. N. Engl. J. Med. 332:1280 –1284. http://dx.doi.org/10.1056/NEJM199505113321907.

4. O’Brien KL, Wolfson LJ, Watt JP, Henkle E, Deloria-Knoll M, McCallN, Lee E, Mulholland K, Levine OS, Cherian T. 2009. Burden of diseasecaused by Streptococcus pneumoniae in children younger than 5 years:global estimates. Lancet 374:893–902. http://dx.doi.org/10.1016/S0140-6736(09)61204-6.

5. Bogaert D, De Groot R, Hermans PW. 2004. Streptococcus pneumoniaecolonisation: the key to pneumococcal disease. Lancet Infect. Dis. 4:144 –154. http://dx.doi.org/10.1016/S1473-3099(04)00938-7.

6. Magee AD, Yother J. 2001. Requirement for capsule in colonization byStreptococcus pneumoniae. Infect. Immun. 69:3755–3761. http://dx.doi.org/10.1128/IAI.69.6.3755-3761.2001.

7. Yother J. 2011. Capsules of Streptococcus pneumoniae and other bacteria:paradigms for polysaccharide biosynthesis and regulation. Annu. Rev. Mi-crobiol. 65:563–581. http://dx.doi.org/10.1146/annurev.micro.62.081307.162944.

8. Arai J, Hotomi M, Hollingshead SK, Ueno Y, Briles DE, Yamanaka N.2011. Streptococcus pneumoniae isolates from middle ear fluid and naso-pharynx of children with acute otitis media exhibit phase variation. J. Clin.Microbiol. 49:1646 –1649. http://dx.doi.org/10.1128/JCM.01990-10.

9. Hammerschmidt S, Wolff S, Hocke A, Rosseau S, Muller E, Rohde M.2005. Illustration of pneumococcal polysaccharide capsule during adher-ence and invasion of epithelial cells. Infect. Immun. 73:4653– 4667. http://dx.doi.org/10.1128/IAI.73.8.4653-4667.2005.

10. Weiser JN. 1998. Phase variation in colony opacity by Streptococcus pneu-moniae. Microb. Drug Resist 4:129 –135. http://dx.doi.org/10.1089/mdr.1998.4.129.

11. Weiser JN, Austrian R, Sreenivasan PK, Masure HR. 1994. Phase vari-ation in pneumococcal opacity: relationship between colonial morphol-ogy and nasopharyngeal colonization. Infect. Immun. 62:2582–2589.

12. Nelson AL, Roche AM, Gould JM, Chim K, Ratner AJ, Weiser JN. 2007.Capsule enhances pneumococcal colonization by limiting mucus-mediated clearance. Infect. Immun. 75:83–90. http://dx.doi.org/10.1128/IAI.01475-06.

13. Munoz-Elias EJ, Marcano J, Camilli A. 2008. Isolation of Streptococcuspneumoniae biofilm mutants and their characterization during nasopha-ryngeal colonization. Infect. Immun. 76:5049 –5061. http://dx.doi.org/10.1128/IAI.00425-08.

14. Sanchez CJ, Kumar N, Lizcano A, Shivshankar P, Dunning Hotopp JC,Jorgensen JH, Tettelin H, Orihuela CJ. 2011. Streptococcus pneumoniaein biofilms are unable to cause invasive disease due to altered virulencedeterminant production. PLoS One 6:e28738. http://dx.doi.org/10.1371/journal.pone.0028738.

15. Flemming HC, Wingender J. 2010. The biofilm matrix. Nat. Rev. Micro-biol. 8:623– 633. http://dx.doi.org/10.1038/nrmicro2415.

16. Karatan E, Watnick P. 2009. Signals, regulatory networks, and materialsthat build and break bacterial biofilms. Microbiol. Mol. Biol. Rev. 73:310 –347. http://dx.doi.org/10.1128/MMBR.00041-08.

17. Kim JO, Romero-Steiner S, Sorensen UB, Blom J, Carvalho M, BarnardS, Carlone G, Weiser JN. 1999. Relationship between cell surface carbo-hydrates and intrastrain variation on opsonophagocytosis of Streptococcuspneumoniae. Infect. Immun. 67:2327–2333.

18. Kim JO, Weiser JN. 1998. Association of intrastrain phase variation inquantity of capsular polysaccharide and teichoic acid with the virulence ofStreptococcus pneumoniae. J. Infect. Dis. 177:368 –377. http://dx.doi.org/10.1086/514205.

19. Hava DL, LeMieux J, Camilli A. 2003. From nose to lung: the regulationbehind Streptococcus pneumoniae virulence factors. Mol. Microbiol. 50:1103–1110. http://dx.doi.org/10.1046/j.1365-2958.2003.03764.x.

20. Guidolin A, Morona JK, Morona R, Hansman D, Paton JC. 1994.Nucleotide sequence analysis of genes essential for capsular polysaccha-ride biosynthesis in Streptococcus pneumoniae type 19F. Infect. Immun.62:5384 –5396.

21. Hathaway LJ, Brugger SD, Morand B, Bangert M, Rotzetter JU, HauserC, Graber WA, Gore S, Kadioglu A, Muhlemann K. 2012. Capsule typeof Streptococcus pneumoniae determines growth phenotype. PLoS Pathog.8:e1002574. http://dx.doi.org/10.1371/journal.ppat.1002574.

22. Oliver MB, van der Linden MP, Kuntzel SA, Saad JS, Nahm MH. 2013.Discovery of Streptococcus pneumoniae serotype 6 variants with glycosyl-

transferases synthesizing two differing repeating units. J. Biol. Chem. 288:25976 –25985. http://dx.doi.org/10.1074/jbc.M113.480152.

23. Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E,Collins M, Donohoe K, Harris D, Murphy L, Quail MA, Samuel G,Skovsted IC, Kaltoft MS, Barrell B, Reeves PR, Parkhill J, Spratt BG.2006. Genetic analysis of the capsular biosynthetic locus from all 90 pneu-mococcal serotypes. PLoS Genet. 2:e31. http://dx.doi.org/10.1371/journal.pgen.0020031.

24. Yother J. 2004. Capsules, p 30 – 49. In Tuomanen E (ed), The pneumo-coccus. ASM Press, Washington, DC.

25. Bender MH, Yother J. 2001. CpsB is a modulator of capsule-associatedtyrosine kinase activity in Streptococcus pneumoniae. J. Biol. Chem. 276:47966 – 47974. http://dx.doi.org/10.1074/jbc.M105448200.

26. Morona JK, Morona R, Miller DC, Paton JC. 2002. Streptococcus pneu-moniae capsule biosynthesis protein CpsB is a novel manganese-dependent phosphotyrosine-protein phosphatase. J. Bacteriol. 184:577–583. http://dx.doi.org/10.1128/JB.184.2.577-583.2002.

27. Morona JK, Miller DC, Morona R, Paton JC. 2004. The effect thatmutations in the conserved capsular polysaccharide biosynthesis genescpsA, cpsB, and cpsD have on virulence of Streptococcus pneumoniae. J.Infect. Dis. 189:1905–1913. http://dx.doi.org/10.1086/383352.

28. Morona JK, Paton JC, Miller DC, Morona R. 2000. Tyrosine phosphor-ylation of CpsD negatively regulates capsular polysaccharide biosynthesisin Streptococcus pneumoniae. Mol. Microbiol. 35:1431–1442. http://dx.doi.org/10.1046/j.1365-2958.2000.01808.x.

29. Bender MH, Cartee RT, Yother J. 2003. Positive correlation betweentyrosine phosphorylation of CpsD and capsular polysaccharide produc-tion in Streptococcus pneumoniae. J. Bacteriol. 185:6057– 6066. http://dx.doi.org/10.1128/JB.185.20.6057-6066.2003.

30. Weiser JN, Bae D, Epino H, Gordon SB, Kapoor M, Zenewicz LA,Shchepetov M. 2001. Changes in availability of oxygen accentuate differ-ences in capsular polysaccharide expression by phenotypic variants andclinical isolates of Streptococcus pneumoniae. Infect. Immun. 69:5430 –5439. http://dx.doi.org/10.1128/IAI.69.9.5430-5439.2001.

31. Saluja SK, Weiser JN. 1995. The genetic basis of colony opacity in Strep-tococcus pneumoniae: evidence for the effect of box elements on the fre-quency of phenotypic variation. Mol. Microbiol. 16:215–227. http://dx.doi.org/10.1111/j.1365-2958.1995.tb02294.x.

32. Waite RD, Penfold DW, Struthers JK, Dowson CG. 2003. Spontaneoussequence duplications within capsule genes cap8E and tts control phasevariation in Streptococcus pneumoniae serotypes 8 and 37. Microbiology149:497–504. http://dx.doi.org/10.1099/mic.0.26011-0.

33. Waite RD, Struthers JK, Dowson CG. 2001. Spontaneous sequenceduplication within an open reading frame of the pneumococcal type 3capsule locus causes high-frequency phase variation. Mol. Microbiol. 42:1223–1232. http://dx.doi.org/10.1046/j.1365-2958.2001.02674.x.

34. Ogunniyi AD, Giammarinaro P, Paton JC. 2002. The genes encodingvirulence-associated proteins and the capsule of Streptococcus pneumoniaeare upregulated and differentially expressed in vivo. Microbiology 148:2045–2053.

35. Heckman KL, Pease LR. 2007. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2:924 –932. http://dx.doi.org/10.1038/nprot.2007.132.

36. Hava DL, Camilli A. 2002. Large-scale identification of serotype 4 Strep-tococcus pneumoniae virulence factors. Mol. Microbiol. 45:1389 –1406.http://dx.doi.org/10.1046/j.1365-2958.2002.03106.x.

37. Akerley BJ, Rubin EJ, Camilli A, Lampe DJ, Robertson HM, MekalanosJJ. 1998. Systematic identification of essential genes by in vitro marinermutagenesis. Proc. Natl. Acad. Sci. U. S. A. 95:8927– 8932. http://dx.doi.org/10.1073/pnas.95.15.8927.

38. Martin B, Prudhomme M, Alloing G, Granadel C, Claverys JP. 2000.Cross-regulation of competence pheromone production and export in theearly control of transformation in Streptococcus pneumoniae. Mol. Micro-biol. 38:867– 878. http://dx.doi.org/10.1046/j.1365-2958.2000.02187.x.

39. Bricker AL, Camilli A. 1999. Transformation of a type 4 encapsulatedstrain of Streptococcus pneumoniae. FEMS Microbiol. Lett. 172:131–135.http://dx.doi.org/10.1111/j.1574-6968.1999.tb13460.x.

40. Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users andfor biologist programmers. Methods Mol. Biol. 132:365–386.

41. Chen Y, Langrish CL, McKenzie B, Joyce-Shaikh B, Stumhofer JS,McClanahan T, Blumenschein W, Churakovsa T, Low J, Presta L,Hunter CA, Kastelein RA, Cua DJ. 2006. Anti-IL-23 therapy inhibitsmultiple inflammatory pathways and ameliorates autoimmune encepha-

Shainheit et al.

704 iai.asm.org Infection and Immunity

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

lomyelitis. J. Clin. Invest. 116:1317–1326. http://dx.doi.org/10.1172/JCI25308.

42. Moscoso M, Garcia E. 2009. Transcriptional regulation of the capsularpolysaccharide biosynthesis locus of Streptococcus pneumoniae: a bioinfor-matic analysis. DNA Res. 16:177–186. http://dx.doi.org/10.1093/dnares/dsp007.

43. Paget MS, Helmann JD. 2003. The �70 family of sigma factors. GenomeBiol. 4:203. http://dx.doi.org/10.1186/gb-2003-4-1-203.

44. Singh SS, Typas A, Hengge R, Grainger DC. 2011. Escherichia coli �70

senses sequence and conformation of the promoter spacer region. NucleicAcids Res. 39:5109 –5118. http://dx.doi.org/10.1093/nar/gkr080.

45. Barne KA, Bown JA, Busby SJ, Minchin SD. 1997. Region 2.5 of theEscherichia coli RNA polymerase �70 subunit is responsible for the recog-nition of the “extended-10” motif at promoters. EMBO J. 16:4034 – 4040.http://dx.doi.org/10.1093/emboj/16.13.4034.

46. Mulligan ME, Brosius J, McClure WR. 1985. Characterization in vitro ofthe effect of spacer length on the activity of Escherichia coli RNA polymer-ase at the TAC promoter. J. Biol. Chem. 260:3529 –3538.

47. Hyams C, Camberlein E, Cohen JM, Bax K, Brown JS. 2010. TheStreptococcus pneumoniae capsule inhibits complement activity and neu-trophil phagocytosis by multiple mechanisms. Infect. Immun. 78:704 –715. http://dx.doi.org/10.1128/IAI.00881-09.

48. Hyams C, Yuste J, Bax K, Camberlein E, Weiser JN, Brown JS. 2010.Streptococcus pneumoniae resistance to complement-mediated immunity

is dependent on the capsular serotype. Infect. Immun. 78:716 –725. http://dx.doi.org/10.1128/IAI.01056-09.

49. Winkelstein JA. 1984. Complement and the host’s defense against thepneumococcus. Crit. Rev. Microbiol. 11:187–208. http://dx.doi.org/10.3109/10408418409105903.

50. Sabharwal V, Ram S, Figueira M, Park IH, Pelton SI. 2009. Role ofcomplement in host defense against pneumococcal otitis media. Infect.Immun. 77:1121–1127. http://dx.doi.org/10.1128/IAI.01148-08.

51. Hammerschmidt S. 2006. Adherence molecules of pathogenic pneumo-cocci. Curr. Opin. Microbiol. 9:12–20. http://dx.doi.org/10.1016/j.mib.2005.11.001.

52. Briles DE, Crain MJ, Gray BM, Forman C, Yother J. 1992. Strongassociation between capsular type and virulence for mice among humanisolates of Streptococcus pneumoniae. Infect. Immun. 60:111–116.

53. Sanchez CJ, Hinojosa CA, Shivshankar P, Hyams C, Camberlein E,Brown JS, Orihuela CJ. 2011. Changes in capsular serotype alter thesurface exposure of pneumococcal adhesins and impact virulence. PLoSOne 6:e26587. http://dx.doi.org/10.1371/journal.pone.0026587.

54. Clark SE, Snow J, Li J, Zola TA, Weiser JN. 2012. Phosphorylcholine allowsfor evasion of bactericidal antibody by Haemophilus influenzae. PLoS Pat-hog. 8:e1002521. http://dx.doi.org/10.1371/journal.ppat.1002521.

55. Weidenmaier C, Peschel A. 2008. Teichoic acids and related cell-wallglycopolymers in Gram-positive physiology and host interactions. Nat.Rev. Microbiol. 6:276 –287. http://dx.doi.org/10.1038/nrmicro1861.

S. pneumoniae Capsule Regulation

February 2014 Volume 82 Number 2 iai.asm.org 705

on April 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from