The CMBI: Bioinformatics

38
The CMBI: Bioinformatics Content Bioinformatics Bioinformatics@CMBI Bioinformatics tools & databases Celia van Gelder CMBI UMC Radboud February 2010 [email protected]

description

The CMBI: Bioinformatics. Content Bioinformatics Bioinformatics@CMBI Bioinformatics tools & databases Celia van Gelder CMBI UMC Radboud February 2010 [email protected]. What is bioinformatics?. - PowerPoint PPT Presentation

Transcript of The CMBI: Bioinformatics

Page 1: The CMBI: Bioinformatics

The CMBI: Bioinformatics

Content

Bioinformatics Bioinformatics@CMBI Bioinformatics tools & databases

Celia van GelderCMBI

UMC RadboudFebruary 2010

[email protected]

Page 2: The CMBI: Bioinformatics

2/38 ©CMBI 2010

What is bioinformatics?

• Bioinformatics is the use of computers in solving information problems in the life sciences

• You are "doing bioinformatics" when you use computers to store, retrieve, analyze or predict the sequence, function and/or structure of biomolecules.

Bioinformatics

Page 3: The CMBI: Bioinformatics

3/38 ©CMBI 2010

Why do we need Bioinformatics?

Flood of biological data:

– DNA-sequences (genomes)– protein sequences and structures– gene expression profiles (transcriptomics)– cellular protein profiles (proteomics)– cellular metabolite profiles (metabolomics)

We want to :

– collect and store the data– integrate, analyze, compare and mine the data– predict genes, protein function and protein structure– predict physiology (models, mechanisms, pathways)– understand how a whole cell works

Bioinformatics

Page 4: The CMBI: Bioinformatics

4/38 ©CMBI 2010

Human genome, great expectations

Data ≠ Knowledge, insight !!!

Bioinformatics

Page 5: The CMBI: Bioinformatics

5/38 ©CMBI 2010

A large fraction of the human genes has an unknown function

(Science, 2001)

Bioinformatics

Page 6: The CMBI: Bioinformatics

6/38 ©CMBI 2010

What is protein function?

Homology

Genomic context

Bioinformatics

Page 7: The CMBI: Bioinformatics

7/38 ©CMBI 2010

How can we predict function of proteins?

“similar sequence with known function. E.g. proteine kinase”“new, unknown

protein”

Extrapolate the function

Compare with database of proteinsBLAST

The importance of sequence similarity and sequence alignment

Similar sequences have:– A similar evolutionary origin– A similar function– A similar 3D structure

Bioinformatics

Page 8: The CMBI: Bioinformatics

8/38 ©CMBI 2010

CMBI - Centre for Molecular and Biomolecular Informatics

•Dutch national centre for computational molecular sciences research

•Research groups –Comparative Genomics (Huynen) –Bacterial Genomics (Siezen)–Computational Drug Design (De Vlieg)–Bioinformatics of Macromolecular Structures (Vriend)

•Training & Education –MSc, PhD and PostDoc programmes –International workshops–Hotel Bioinformatica–High school courses

•Computational facilities, databases, and software packages via (inter-)national service platforms (NBIC, EBI, etc)

•NBIC: National BioInformatics Centre.

Bioinformatics @CMBI

Page 9: The CMBI: Bioinformatics

9/38 ©CMBI 2010

Computational Drug Discovery (CDD) Group

• Head: Prof. Jacob de Vlieg

• Key goalDevelop molecular modeling and computer-based simulation techniques for structure-based drug design, translational medicine and protein family based approaches to design and identify drug-like compounds

• Key Research Fields– Structural bioinformatics for drug design– Bioinformatics for genomics (microarray analysis, text mining, etc)– Translational medicine informatics

Academic ResearchNew scientific approachesTraining & education

ApplicationsExciting real life problems

‘wet’ validation

CDD

Bridging academic research and applied genomics

Bioinformatics @CMBI

Page 10: The CMBI: Bioinformatics

10/38 ©CMBI 2010

Examples of CDD Projects

•Exploiting Structural Genomics Information To Incorporate Protein Flexibility In Drug Design

•Protein knowledge building through comparative genomics and data integration  •In silico studies on p63 as a new drug-target protein

Bioinformatics @CMBI

Page 11: The CMBI: Bioinformatics

11/38 ©CMBI 2010

International Computational Drug Discovery Course

•Course covers the entire research pipeline from genomics and proteomics in target discovery to Structure Based Drug Design and QSAR in drug optimization.

•Lectures and practicals

•2 week course

•21 June – 2 July 2010

•www.cmbi.ru.nl/ICDD2010

Bioinformatics @CMBI

Page 12: The CMBI: Bioinformatics

12/38 ©CMBI 2010

Bacterial Genomics Group

• Head: Prof Roland Siezen

• Research interest: Biological questions in the interest of Dutch Food Industry

• How can we improve:– fermentation – safety – health

• Micro-organisms studied: Gram-positive food bacteria:– lactic acid bacteria (Lactococcus, Lactobacillus)– spoilage bacteria (Listeria, Clostridium, Bacillus cereus)

listeria

lactococcus

Bioinformatics @CMBI

Page 13: The CMBI: Bioinformatics

13/38 ©CMBI 2010

Bacterial Genomics: from sequence to predicted function

Key research fields: – Genome sequencing and interpretation– Network reconstruction and analysis– Systems biology, dynamic modelling

Raw sequence data: 2 to 5 million nucleotides

AAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAA

A virtual cell: overview of predicted pathways

Bioinformatics @CMBI

Page 14: The CMBI: Bioinformatics

14/38 ©CMBI 2010

Bacterial Genomics: Example

Differential NF-κB pathways induction by Lactobacillus plantarum in the duodenum of healthy humans correlating with immune tolerance Peter van Baarlen et al., PNAS, Febr 3, 2009

Bioinformatics @CMBI

Page 15: The CMBI: Bioinformatics

15/38 ©CMBI 2010

Comparative Genomics Group

• Head: Prof. Martijn Huynen

• Research Focus: – How do the proteins encoded in genomes interact with each other to

produce cells and phenotypes ? – To predict such functional interactions between proteins as there exist

e.g. in metabolic pathways, signalling pathways or protein complexes

A genome is more than the sum of its genes ->

Use “genomic context” for function prediction

Types of genomic context:

Gene fusion/fissionChromosomal locationGene order/neighbourhoodCo-evolutionCo-expression

Bioinformatics @CMBI

Page 16: The CMBI: Bioinformatics

16/38 ©CMBI 2010

Turning data into knowledge

Research topics:• Develop computational genomics techniques that exploit the information in

sequenced genomes and functional genomics data• Make testable predictions about pathways and the functions of proteins

therein. • Evolution of the eukaryotic cell & the origin and evolution of organelles like

the mitochondria and the peroxisomes

Education: • Comparative Genomics Course, 3 EC, 8-23 April 2010

website: http://www.cmbi.ru.nl/huynen/

Comparative genomics

Prediction of protein function, pathways

Bioinformatics @CMBI

Page 17: The CMBI: Bioinformatics

17/38 ©CMBI 2010

Frataxin Example

• Frataxin is a well-known disease gene (Friedreich's ataxia) whose function has remained elusive despite more than six years of intensive experimental research.

• Using computational genomics we have shown that frataxin has co-evolved with hscA and hscB and is likely involved in iron-sulfur cluster assembly in conjunction with the co-chaperone HscB/JAC1.

Prediction Confirmation

Bioinformatics @CMBI

Page 18: The CMBI: Bioinformatics

18/38 ©CMBI 2010

Bioinformatics of macromolecular structures

•Head: Prof. Gert Vriend

•Research Focus: Understanding proteins (and their environment)

•Proteins are the core of life, they do all the work, and they give you feelings, contact with the outside world, etc.

•Proteins, therefore, are the most important molecules on earth.

•We want to understand life; why are we what we are, why do we do what we do, how come you can think what you think?

Bioinformatics @CMBI

Page 19: The CMBI: Bioinformatics

19/38 ©CMBI 2010

Bioinformatics of macromolecular structures

Research topics Vriend group

•Homology modeling technology and applications•Application of bioinformatics in medical research (Hanka Venselaar)•Structure validation and structure determination improvement•Molecular class specific information systems (e.g. GPCRDB & NucleaRDB)•Data mining•WHAT IF molecular modelling and visualization software

Education:•Introduction in bioinformatics (3 EC (MLW) or 6 EC (biology), 2nd year BSc)•Structure, Function and Bioinformatics (3rd year BSc)•Bioinformatics of Protein Structures (MSc)

Bioinformatics @CMBI

Page 20: The CMBI: Bioinformatics

Hearing loss

Unknown structure

MGTPWRKRKGIAGPGLPDLSCALVLQPRAQVGTMSPAIALAFLPLVVTLLVRYRHYFRLLVRTVLLRSLRDCLSGLRIEERAFSYVLTHALPGDPGHILTTLDHWSSRCEYLSHMGPVKGQILMRLVEEKAPACVLELGTYCGYSTLLIARALPPGGRLLTVERDPRTAAVAEKLIRLAGFDEHMVELIVGSSEDVIPCLRTQYQLSRADLVLLAHRPRCYLRDLQLLEAHALLPAGATVLADHVLFPGAPRFLQYAKSCGRYRCRLHHTGLPDFPAIKDGIAQLTYAGPG

LRTOMT protein:

Homology Modeling

Homology modeling:Prediction of 3D structure based upon a highly similar structure

Bioinformatics @CMBI

Page 21: The CMBI: Bioinformatics

21/38 ©CMBI 2010

Prediction of 3D structure based upon a highly similar structure

Add sidechains, Molecular Dynamics simulation on model

Unknown structure

NSDSECPLSHDG

NSDSECPLSHDG

|| || | ||

NSYPGCPSSYDG

Alignment of model and template sequenceKnown structure

Known structure

Back bone copiedCopy backbone and conserved

residues

Model!

Homology Modeling

Bioinformatics @CMBI

Page 22: The CMBI: Bioinformatics

Hearing loss

Structure!

MGTPWRKRKGIAGPGLPDLSCALVLQPRAQVGTMSPAIALAFLPLVVTLLVRYRHYFRLLVRTVLLRSLRDCLSGLRIEERAFSYVLTHALPGDPGHILTTLDHWSSRCEYLSHMGPVKGQILMRLVEEKAPACVLELGTYCGYSTLLIARALPPGGRLLTVERDPRTAAVAEKLIRLAGFDEHMVELIVGSSEDVIPCLRTQYQLSRADLVLLAHRPRCYLRDLQLLEAHALLPAGATVLADHVLFPGAPRFLQYAKSCGRYRCRLHHTGLPDFPAIKDGIAQLTYAGPG

LRTOMT:

Homology Modeling

Bioinformatics @CMBI

Page 23: The CMBI: Bioinformatics

23/38 ©CMBI 2010

Saltbridge between Arginine andGlutamic acid is lost in both cases

Mutation: Arginine 81 -> Glutamic acid

Homology Modeling

Bioinformatics @CMBI

Mutation:Glutamic acid 110 ->Lysine

Page 24: The CMBI: Bioinformatics

24/38 ©CMBI 2010

Mutation: Tryptophan 105 -> Arginine

Hydrophobic contacts from the Tryptophan are lost

Introduction of a hydrophilic and charged residue

Homology Modeling

Bioinformatics @CMBI

Page 25: The CMBI: Bioinformatics

25/38 ©CMBI 2010

The three mutated residues are all important for the correct positioning of Tyrosine 111

Tyrosine 111 is important for substrate binding

Ahmed et al., Mutations of LRTOMT, a fusion gene with alternative reading frames, cause nonsyndromic deafness in humans. Nat Genet. 2008 Nov;40(11):1335-40.

Homology Modeling

Bioinformatics @CMBI

Interested? Contact Hanka Venselaar ([email protected])Project HOPE: Have yOur Protein Explained

Page 26: The CMBI: Bioinformatics

26/38 ©CMBI 2010

Hotel Bioinformatica

Hotel functions

• Temporary housing, teaching and supervision of experimentalists for data analysis at the CMBI

• Centralization of UMC-wide bioinformaticians

• Shared (weekly) seminars of CMBI with ‘inhouse bioinformaticians’

• Collaboration/advice in acquiring grants with a Bioinformatics aspect

Interested? Contact Martijn Huynen ([email protected])

Bioinformatics @CMBI

Page 27: The CMBI: Bioinformatics

27/38 ©CMBI 2010

Bioinformatics data types

mRNA expression

profiles

MS data

Large amount of data

Growing very very fast

Heterogeneous data types

Bioinformatics Tools & Databases

Page 28: The CMBI: Bioinformatics

28/38 ©CMBI 2010

Biological Databases

• Information is the core of bioinformatics• Literally thousands of databases exist that are relevant for

biology, medicine, and/or chemistry

Content Database

protein sequences SwissProt

UniProt

trEMBL

nucleotide sequences EMBL

GenBank

DDBJ

structures (protein, DNA, RNA) Protein Data Bank (PDB)

Genomes EnsemblUCSC

Mutations OMIM

Patterns, Motifs PROSITE

Protein Domains InterPro

SMART

Pathways KEGG

Bioinformatics Tools & Databases

Page 29: The CMBI: Bioinformatics

29/38 ©CMBI 2010

Important records in SwissProt/UniProt (1)

Bioinformatics Tools & Databases

Page 30: The CMBI: Bioinformatics

30/38 ©CMBI 2010

Important records in SwissProt/UniProt (2)

Cross references

Direct hyperlinks to:• EMBL• PDB• OMIM, • InterPro• etc. etc.

Features

• post-translational modifications• signal peptides• binding sites,• enzyme active sites• domains, • disulfide bridges• etc. etc.

Bioinformatics Tools & Databases

Page 31: The CMBI: Bioinformatics

31/38 ©CMBI 2010

Protein Databank & Structure Visualization

• PDB structures have a unique identifier, the PDB Code:4 digits (often 1 digit & 3 letters, e.g. 1CRN).

• Download PDB structures, give correct file extension: 1CRN.pdb

• Structures from PDB can directly be visualized with:

1. Yasara (www.yasara.org) (developed at CMBI)2. SwissPDBViewer (http://spdbv.vital-it.ch/)3. Protein Explorer (http://www.umass.edu/microbio/rasmol/)4. Cn3D (http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml)

Bioinformatics Tools & Databases

Page 32: The CMBI: Bioinformatics

32/38 ©CMBI 2010

OMIM Database

(O)MIM - Online Mendelian Inheritance in Man

• a large, searchable, current database of human genes, genetic traits, and hereditary disorders

• contains information on all known mendelian disorders and over 12,000 genes

• focuses on the relationship between phenotype and genotype

Bioinformatics Tools & Databases

http://www.ncbi.nlm.nih.gov/omim/

Page 33: The CMBI: Bioinformatics

33/38 ©CMBI 2010

Browsing genomes

UCSC: http://genome.ucsc.edu/Only eukaryotic genomes

NCBI

Ensembl: http://www.ensembl.org/

Bioinformatics Tools & Databases

Genome browsers can be used to examine

•Genomic sequence conservation•Duplications en deletions of pieces chromosome (Copy Number Variations, CNVs)•Single Nucleotide Polymorphisms (SNPs)•Alternative splicing•And much more...

Page 34: The CMBI: Bioinformatics

34/38 ©CMBI 2010

Sequence Retrieval with MRS (1)

Google = Thé best generic search and retrieval system

MRS = Maarten’s Retrieval System (http://mrs.cmbi.ru.nl )

MRS is the Google of the biological database world

Search engine (like Google)Input/Query = word(s)

Output = entry/entries from database

Searching is very intuitive:– Select database(s) of choice– Formulate your query – Hit “Search”– The result is a “query set” or “hitlist” – Analyze the results

Bioinformatics Tools & Databases

Page 35: The CMBI: Bioinformatics

35/38 ©CMBI 2010

Sequence Retrieval with MRS (2)

Formulate query.But think about your query first!!

Select database

MRS hitlist

Bioinformatics Tools & Databases

Page 36: The CMBI: Bioinformatics

36/38 ©CMBI 2010

BLAST and CLUSTAL with MRS

Blast brings you to the MRS-page from which you can

do Blast searches.

Blast results brings you to the page where MRS stores your

Blast results of the current session.

Clustal brings you to the MRS page from which you can

do Clustal sequence alignments.

Bioinformatics Tools & Databases

Page 37: The CMBI: Bioinformatics

37/38 ©CMBI 2010

Your Exercise Today

FAMILIAL VISCERAL AMYLOIDOSIS

You will study Lysozyme:

•Protein•Gene•Mutations causing familial visceral amyloidosis•3D structure

HAVE FUN!!

Bioinformatics Tools & Databases

Page 38: The CMBI: Bioinformatics

The Practical

You can find the practical at http://swift.cmbi.ru.nl/teach/lyso/

38/38 ©CMBI 2010

Work with MRS

Work with Yasara

Read the text carefully

User login = c(your pc number) e.g. c07

User password = t0psp0rt (with zero’s)

The program Yasara is on your desktop