Pharmacology of Bradykinin , pentagastrin, cholecystokinin and angiotensin
The Bradykinin Type 2 Receptor is a Target for p53-Mediated ...
Transcript of The Bradykinin Type 2 Receptor is a Target for p53-Mediated ...
1
The Bradykinin Type 2 Receptor is a Target for p53-Mediated Transcriptional Activation
Zubaida Saifudeen, Hong Du, Susana Dipp, and Samir S. El-Dahr‡
From the Department of Pediatrics, Section of Pediatric Nephrology, Tulane University School of Medicine, New Orleans, Louisiana 70112
‡To whom correspondence and reprint requests should be addressed: Tulane University School of Medicine, 1430 Tulane Avenue, New Orleans, LA 70112. Tel: (504) 588-5377; Fax: (504) 584-1852; E-mail: [email protected]
JBC Papers in Press. Published on March 15, 2000 as Manuscript M909810199 by guest on A
pril 16, 2018http://w
ww
.jbc.org/D
ownloaded from
2
Running title: p53-dependent regulation of the B2 kinin receptor gene.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
3
Summary
The bradykinin type 2 receptor (BK2) is a developmentally regulated G protein-coupled
receptor that mediates diverse actions such as vascular reactivity, salt and water excretion,
inflammatory responses and cell growth. However, little is known regarding regulation of
the BK2 gene. We report here that the rat BK2 receptor is transcriptionally regulated by the
tumor suppressor protein p53. The 5'-flanking region of the rat BK2 gene contains two p53-
like binding sites: a sequence at -70 bp (P1 site) that is conserved in the murine and human
BK2 genes; and a sequence at -707 (P2) that is not. The P1 and P2 motifs bind specifically
to p53, as assessed by gel mobility shift assays. Transient transfection into HeLa cells of a
CAT reporter construct driven by 1.2-kb of the BK2 gene 5'-flanking region demonstrated
that the BK2 promoter is dose-dependently activated by co-expression of wild-type p53. Co-
expression of a dominant negative mutant p53 suppresses the activation of BK2 by wild-
type p53. Promoter truncation localized the p53-responsive element to the region between
-38 and -94 bp encompassing the p53-binding P1 sequence. Furthermore, the
transcriptional co-activators, CBP/p300, augment p53-mediated activation of the BK2
promoter. Interestingly, removal of the P2 site by truncation or site-directed deletion
amplifies p53-mediated activation of the BK2 promoter. These results demonstrate that the
rat BK2 promoter is a target for p53-mediated activation and suggest a new physiological
role for p53 in the regulation of G protein-coupled receptor gene expression.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
4
Introduction
The type 2 bradykinin (BK) receptor, BK2, is a G protein-coupled receptor that
mediates diverse actions, such as vascular relaxation, urinary sodium excretion,
inflammatory responses, and cellular growth (1). The rat BK2 gene is composed of 4
exons, the last of which contains the entire open reading frame (2). Initial characterization
of the rat BK2 gene by Pesquero and co-workers (2) revealed that this gene lacks a typical
TATA module and identified potential binding sites for a number of transcription factors,
including cyclic AMP response element binding protein (CREB), AP-1, NF-KB, SP-1, and
Egr-1. Although traditionally thought to be expressed in a constitutive manner, the BK2
gene is developmentally regulated in the kidney and cardiovascular system (3), and is
induced by mitogenic growth factors (4) and inflammatory cytokines (5,6). Furthermore,
BK2 receptors are overexpressed in ras-transformed fibroblasts (7) and are coupled with
mitogenic signaling pathways (8,9). The nuclear factors regulating BK2 gene expression
are largely unknown.
The tumor suppressor protein, p53, is present at low levels in normal cells but is
activated in response to cellular stress such as hypoxia, oncogene activation, and DNA
damage (10,11). Tight regulation of p53 activity appears to be essential for normal
development as overexpression of p53 in transgenic mice produces abnormal kidneys (12)
and knockout of its negative regulator, mdm2, is fatal (13). The consensus DNA sequence
specific for p53 binding consists of two copies of the inverted repeat sequence
[RRRC(A/T)(T/A)GYYY] separated by 0-13 nucleotides (14,15). p53 binds DNA as a
tetramer with a stoichiometry of one p53 molecule per consensus pentamer (16,17).
Recent studies have also shown the importance of protein-protein interactions between p53
and the co-activators, CREB-binding protein (CBP)/p300, in mediating the transcriptional
effects of p53 (18-21).
p53 transactivates a number of genes important for cell cycle control (e.g., p21/Waf-
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
5
1), DNA repair (e.g., GADD45) and apoptosis (e.g., IGF-BP3, Bax) (22-29). p53 regulated
genes also include, among others, the c-fos and c-met proto-oncogenes, tyrosine kinase
receptors (e.g., the epidermal growth factor receptor), proliferating cell nuclear antigen, and
nitric oxide synthase type 2 (30-34). In addition to its transactivation function, p53 can
directly repress transcription by interfering with basal promoter function (35-39) or by
sequence-specific DNA binding and exclusion of a trans-acting factor (40).
We report here that the promoter region of the rat BK2 gene contains a p53-binding
site and that p53 activates BK2 promoter-driven transcription of a reporter gene. We
further found an upstream p53 binding DNA element that down modulates p53-mediated
activation of the BK2 promoter. These data may have important implications regarding the
regulation of BK2 gene expression in early development and in response to cellular stress.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
6
EXPERIMENTAL PROCEDURES
Plasmids and BK2 promoter constructs - A DNA fragment spanning from -1184 to +93 of
BK2 5'-flanking region was amplified by polymerase chain reaction from rat liver genomic
DNA. The primers (5'-GTCCTTCGTTTTGAGTCTGG-3') and (5'-
GGTTCTGTGTTGTAGGGAGT-3') were selected from the gene sequence published by
Pesquero et al (2). The DNA fragment was inserted into the SmaI site in the polylinker
region of a T/A cloning vector, pCR2.1 (Invitrogen). Following digestion with KpnI (in the
polylinker of pCR2.1, upstream to the SmaI site) and NheI (at position +55 of the insert), the
DNA fragment was ligated into the reporter plasmid pCAT3Basic (Promega) upstream from
the chloramphenicol acetyl transferase (CAT) open reading frame. For the generation of
promoter constructs with serial deletions in the 5'-upstream region, the original construct (-
1184+55/CAT) was digested with XhoI (-1087), NcoI (-827), BglII (-635), and EcoRI (-563).
The -384, -200, -94 and -38/CAT promoter constructs were generated by polymerase chain
reaction using the -1184+55/CAT construct as a DNA template. Partial (15/20 bp) or
complete (20/20 bp) deletion of the p53 binding site at -707 to -688 was performed by the
QuickChangeTM Site-Directed Mutagenesis System (Stratagene, La Jolla, CA) following the
manufacturer’s recommendations. All constructs were sequenced to verify the sequence
and orientation by manual DNA sequencing using T7 Sequenase (Amersham) or by
automated DNA sequencing (Applied Biosystems, Model 373A).
Tissue Culture and Transfections - HeLa cells (American Type Culture Collection) were
maintained in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine
serum (FBS), penicillin (100 U/ml), and Streptomycin (100 µg/ml) (Gibco BRL) at 37 oC in a
humidified incubator with 5% CO2.. Cells were plated in duplicates in six-well plates at 1.8 X
104 cells/well in DMEM containing 10% FBS one day prior to transfection. Cells were
transfected with 1.2 µg of DNA per well of pCAT vectors, driven by various BK2 promoter
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
7
fragments. A control β-galactosidase vector pSVZ (Promega, 0.5 µg of DNA/well) was
cotransfected with BK2-pCAT plasmids to correct for transfection efficiency. CMV-driven
expression vectors for wild-type or mutant p53 (33) were co-transfected using 10-500 ng of
DNA/well. Transfections were performed using LipofectAMINE PLUS Reagent (Gibco BRL)
according to the manufacturer’s recommendations. Four hours after transfection, fresh
medium was replaced and cell extracts were prepared 24 hours later using a reporter lysis
reagent (Promega). After normalization for β-galactosidase activity in the lysate, aliquots of
cell lysates were analyzed for CAT activity by the addition to the aliquot of 20 µl of 4µM
acetyl-CoA, 70 µl of 1M Tris-Cl (pH 7.8), 5 µl of 25 µCi/ml [14C]chloramphenicol (40-60
mCi/mmol), and H2O to a final volume of 150 µl, and incubated at 37 oC for 1 h. The
reaction was extracted with 1 ml of ethyl acetate and the ethyl acetate evaporated in a
Speedvac evaporator. Samples were suspended in 25 µl of ethyl acetate and spotted 2 cm
above the edge of a plastic-backed TLC sheet. Thin layer chromatography was run in 19:1
chloroform/methanol, and the sheet was air-dried and placed on film for autoradiography.
The optical density of the radioactive spots was measured by densitometry and CAT activity
was calculated as percent acetylated product.
Oligonucleotides - The oligonucleotide sequences used were as follows (double-
stranded): Consensus p53, 5'-TAGGCATGTCTAGGCATGTCTAAGCT-3' (14); p21, 5'-
ATCAGGAACATGTCCCAACATGTTGGAACATGTCCCAACATGTTGAGCTC-3' with the
p53 consensus in the p21 gene; BK2-P1 5'-AGGGGGGAGGTGCCCAGGAGAGTGATGA-3'
with the p53 site in the rat B2 receptor gene (positions -70 to -50 bp) and BK2-P2 5'-
ACTCTTGCCTGGTCTTCCCT-3' (positions -707 to -688) (2).
Nuclear extracts and electrophoretic mobility shift assay (EMSA) - Nuclear extracts
containing wild-type p53 were prepared from the embryonic fibroblast cell line, SVT-2 (from
ATCC). In addition, we used purified C-terminus truncated and constitutively active p53 (gift
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
8
from M. Barton, Univ. of Cincinnati). Double stranded oligonucleotides were 5'-end
labeled with [32P]γ-dATP with T4 kinase for use as probes in the gel mobility shift assays.
The labeled probe was incubated for 20 min at room temperature with nuclear extracts and
the binding buffer (5 µM Hepes, pH 7.9, 5% glycerol, 0.2 µM dithiothreitol, 5 µM
spermidine, 1.5 µg poly(dI-dC). Reactions containing a p53-specific activating antibody,
pAb421 (Oncogene Science), were preincubated on ice for 15 min before adding the
radiolabeled probe. Specific competitor oligonucleotides were added in 100 to 300-fold
molar excess 15 min before addition of the radioactive probe.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
9
Results
Putative Binding Sites for Wild-Type p53 in the BK2 Promoter - Based on homology
alignment, two putative binding sites for p53 were identified at positions -70 to -50 (BK2-
P1): 5'-GGAGGTGCCCAGGAGAAGTGA-3' and -707 to -688 (BK2-P2): 5'-
ACTCTTGCCTGGTCTTCCCT-3' of the rat BK2 receptor promoter (Fig. 1A). Sequence
variation from the tandem 10 bp motif, RRRC(A/T)(T/A)GYYY, described as a consensus
p53 recognition sequence (14) is underlined (See also Fig. 1B). Whereas the P1
sequence is conserved in the human (41,42) and mouse (Saifudeen and El-Dahr,
unpublished) BK2 genes, the P2 site is not (Fig. 1C).
Specific Binding of p53 to the P1 element Identified in the BK2 Promoter- We next
examined whether p53 binds to these putative p53 binding sites (P1 and P2) using
electrophoretic mobility shift assays (EMSA). As a source of p53, we used nuclear extract
from SVT-2 embryonic fibroblasts as well as recombinant p53. Western blots using the p53
antibodies, PAb421 (Oncogene Science) and FL-393 (Santa Cruz), showed that SVT-2
cells contain p53 (data not shown). EMSA assays utilizing a 32P-labeled BK2-P1
oligonucleotide and SVT-2 nuclear extracts revealed two major DNA-protein complexes
(Fig. 2A, lane 2). The addition of the p53-activating antibody, PAb421 (1, 2 µl) resulted in
enhanced DNA-binding activity (Fig. 2A, lanes 3, 4), demonstrating the presence of p53 in
the complexes. To test the specificity of the DNA-protein interactions, EMSA competition
experiments were performed (Fig. 2B). Incubation of the consensus p53 oligoduplex probe
with SVT-2 nuclear extracts produced two major DNA-protein complexes (Fig. 2A, lane 1).
The addition of 100-fold molar excess of unlabeled consensus p53 oligoduplex eliminated
both band shifts (Fig. 2B, lane 2). An unlabeled oligonucleotide corresponding to the p53
binding site in the p21 gene prevented the formation of the higher mobility complex when
added at 100-fold molar excess (Fig. 2B, lane 3) and both low and high mobility complexes
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
10
when added at 200- and 300-fold excess (Fig. 2B, lanes 4 and 5). An 100-200 fold molar
excess of unlabeled BK2-P1 oligoduplex also competed efficiently with binding to the
consensus p53 probe (Fig. 2B, lanes 6, 7). In contrast, a P1 probe containing point
mutations in the p53 BK2-P1 sequence did not produce any specific band shifts (Fig. 2B,
lanes 8-10, see figure legend). Finally, the band shift produced by binding of nuclear
proteins to the P1 probe was greatly diminished upon addition of 100-fold molar excess of
unlabeled p53 consensus sequence (Fig. 2B, lanes 11, 12).
To further document the specific binding of p53 to the p53-like motif in the P1 site,
we examined the binding of the P1 duplex to purified p53 (Fig. 2C). Binding of p53 to the
P1 oligoduplex (Fig. 2C, lane 1) is competed, albeit not completely, by 100-fold excess of
unlabeled oligoduplexes corresponding to the p53 binding site in the p21 promoter (lane 2)
or the p53 consensus (lane 3). However, when added at 200-fold excess, the p53
consensus sequence and the p53 motif in the p21 gene compete efficiently with the BK2-P1
for binding to purified p53 (Fig. 2D). Binding of the p53 consensus oligoduplex to purified
p53 (Fig. 2C, lane 4) is abolished or attenuated by 100-fold excess of unlabeled p53
consensus sequence (lane 5), p53 motif in the p21 gene (lane 6), or BK2-P1 (lane 7).
These cross competition experiments demonstrate that p53 binds specifically to the P1
sequence in the BK2 promoter. In addition, the results suggest that the binding affinity of the
p53 site in BK2-P1 to p53 may be higher than that of the consensus p53 sequence or the
p21 gene p53 site. We speculate that the difference in mobility of the DNA-protein
complexes in SVT-2 nuclear extracts (two major bands) as compared to recombinant p53
(one major band) may be related to the presence of p53-interacting proteins in the former
but not the latter.
p53-dependent Transactivation of the BK2 Promoter - In HeLa cells, p53 is bound to the
human papillomavirus E6 protein, which targets p53 for degradation (43) and renders these
cells functionally deficient in p53. Other studies have shown that these cells can be used to
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
11
study p53-mediated transcriptional responses (33). HeLa cells were transiently transfected
with CAT vectors containing segments of the BK2 promoter with and without a CMV
promoter-driven p53 expression plasmid. As shown in Fig. 3A, cells cotransfected with
pCMV-p53(wt) and seven different BK2 promoter-CAT constructs, pBK2 (-1184), (-827), (-
635), (-563), (-384), (-200), and (-94), showed a clear induction of CAT activity only in the
presence of wild-type p53. In contrast, no increase in CAT expression was observed in
cells cotransfected with pCMV-p53(wt) and pBK2(-38) (Fig. 3A). Wild-type p53 stimulated
pBK2(-1184) or pBK2(-94)-driven CAT expression in a dose-dependent manner (Fig. 3B).
These results suggest that the p53 response element in the BK2 promoter is located in the
region between -38 to -94 bp, which is consistent with the location of the P1 p53 binding
site.
To test the specificity of the stimulatory effect of wild-type p53 on BK2 promoter-
driven CAT transcription, HeLa cells were co-transfected with a CMV promoter-driven
expression plasmid, pCMVp53E258K, which encodes a dominant negative mutant of p53,
with a Glu → Lys change at amino acid 258 (33). Co-transfection with this p53 mutant
which lacks the ability to bind DNA, failed to induce BK2 promoter-driven CAT expression
(data not shown and Fig. 5B), and in experiments in which both pCMV-p53(wt) and
pCMVp53258K were cotransfected, the mutant p53 repressed the activation of the BK2
promoter by wild-type p53 in a dose-dependent manner (Fig. 3C, D).
Effect of CBP/p300 on p53-mediated activation of the BK2 promoter - CBP/p300 are
transcriptional co-activators that bind and activate a number of transcription factors
including the p53 protein (18-21, 44,45). Accordingly, we examined the effect of CBP/p300
on p53-mediated transcriptional responses of the BK2 promoter. As shown in Fig. 4A & B,
co-transfection of viral promoter driven expression plasmids for CBP/p300 (0, 10, 50 ng
DNA) into HeLa cells augmented the p53-mediated activation of BK2 promoter in a dose-
dependent manner. The transactivation by CBP/p300 most likely occurs via the p53-like
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
12
motif at the P1 site (located at -70), rather than via the NF-KB site which overlaps with the
upstream BK2-P2 motif, for two reasons. First, CBP/p300 activates CAT transcription from
the pBK(-94) construct, which lacks the NF-KB site (Fig. 4C). Second, deletion of the BK2-
P2 site (see below) destroys the NF-KB site, yet this mutant construct (with an intact P1
site) remains responsive to CBP/p300 (data not shown).
The P2 p53 site modulates p53-mediated activation of BK2 promoter - In addition to
the proximal P1 p53-like binding site, the rat BK2 5'-flanking region contains a second p53-
like motif at positions -707 to -688 (Fig. 1B). Unlike P1, P2 is not conserved in the human
BK2 gene. This DNA sequence binds specifically to p53 present in SVT-2 cells’ nuclear
extracts as indicated by the enhanced DNA binding activity following treatment with the
PAb421 antibody (Fig. 5A). Specificity of the complex was demonstrated by competition
by unlabeled p21 and BK2-P2 (Fig. 5A) but not by irrelevant oligoduplex (Jun/AP-1) (data
not shown). To determine the functional relevance of the P2 site, we compared the effect of
wild-type p53 on the activity of BK2 promoter constructs either containing (pBK-1184) or
lacking (pBK-635) the P2 site. As shown in Fig. 5B, p53-mediated transactivation is
approximately 2-fold higher in pBK2-635 than pBK2-1184. To validate this finding, we
utilized a deletion mutagenesis approach in which we removed either 3/4 (∆P215bp) or 4/4
(∆P220bp) pentamers of the P2 site. As shown in Fig. 5C and D, pCMV-p53(wt) activates
the activity of the BK2(-1184) promoter construct in a dose-dependent manner. When co-
transfection was performed using the mutant pBK2(-1184) constructs, up to 2-fold further
increase in CAT activity was observed. This finding suggests that the P2 site has a
negative modulation effect on p53-mediated activation of the BK2 promoter.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
13
Discussion
The bradykinin type 2 receptor, BK2, is a heptahelical G protein-coupled receptor.
Upon ligand activation, BK2 engages numerous second messenger systems such as
phospholipase C and D, phospho inositol-3-kinase, protein kinase C, and tyrosine kinases.
Among the nuclear factors activated by BK are AP-1 (9) and NF-KB (46) which are believed
to mediate the effects of BK on growth, differentiation, and gene expression of inflammatory
cytokines and growth factors. Activation of BK2 on endothelial cells mediates nitric oxide
release and vasorelaxation, consistent with the hypertensive phenotype of BK2-deficient
mice (47-49).
In the present study, transient transfections into HeLa cells of promoter-reporter
constructs containing serial deletions of the BK2 5'-flanking region localized the p53
activation effect to a 56-bp region extending from -38 to -94 of the promoter. This region
contains a p53-like binding motif (P1 site) at -70 to -50. This finding together with the
sequence-specific binding of p53 to the P1 site, the inhibition of p53-mediated activation by
co-expression of a mutant p53, and the species conservation of this site strongly implicate
this DNA element in p53-mediated activation of the BK2 promoter.
CREB-binding protein and p300 (CBP/p300) are structurally related activators of
numerous transcription factors including p53. CBP/p300 possess intrinsic histone
acetyltransferase activity (18-21). Acetylation of lysine residues in the N-terminal domains
of histones facilitates gene activation, perhaps by reducing histone tail affinity for DNA,
leading to a more favorable transcription factor binding to nucleosomal DNA. CBP/p300
acetylate components of the basal transcription machinery, such as TFIIEβ and TFIIF in
vitro (50-52). Furthermore, p300 acetylates p53 on its C-terminus thereby enhancing its
DNA-binding activity in vitro (21). In our model, co-expression of CBP/p300 with p53
augmented the transactivation function of p53. Based on these results, we propose that
the interaction of p53 with the P1 site acts as a recruiting vehicle for CBP/p300 to the
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
14
vicinity of the proximal promoter thereby activating the basal transcription machinery.
We also identified a second p53-like binding site (P2) at position -707 of the rat
BK2 gene. This site differs from P1 in many aspects. First, unlike P1, P2 is not conserved
in the mouse or human BK2 genes. Second, removal of P2 by truncation or deletion
amplified p53-mediated transactivation. It is not clear how the P2 site down modulates the
positive transcriptional activity of p53 that is exerted at the level of the proximal promoter.
One possibility may involve the displacement of an activator protein from binding to the
same regulatory element, as recently reported in the alpha-fetoprotein gene (40). Indeed,
the P2 sequence overlaps with a putative binding site for the transcription factor, NF-KB.
Another may be that p53, when bound to the P2 site, interacts with an early stage of the
assembling complex of general transcription factors, blocking further assembly. It is also
conceivable that HeLa cells have a limited pool of CBP/p300 (53) and that binding of p53 to
P2 “sequesters” the available pool of p53 and its co-activators. Ongoing studies in our
laboratory are testing these various hypotheses.
The biological significance of p53-mediated regulation of BK2 gene expression
remains unclear. We speculate that endogenous p53 may be important in the regulation of
BK2 expression under at least two conditions. Both p53 and BK2 are highly expressed in
certain tissues during development (3). Our preliminary studies have shown a remarkable
overlap in the cellular expression of p53 and BK2 in the developing kidney (54). Thus, it is
conceivable that p53 may have a role in the developmental regulation of the BK2 gene, as
has recently been proposed for the "-fetoprotein gene (40). In addition, p53 is induced and
activated by cellular injury and chronic inflammation (55) and this may represent a new
mechanism to activate BK2 gene expression in response to inflammation (5,6).
We conclude that the rat bradykinin B2 receptor gene is a target for the tumor
suppressor p53. This is the first report of a G-protein-coupled receptor gene regulated by
p53. Future challenges will be to determine the biological relevance of p53-mediated
regulation of BK2 in vivo and if p53 regulates other G protein-coupled receptor genes.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
15
Acknowledgments
We thank Dr. Michelle Barton for generously providing activated purified p53, and for
helpful discussions and critical reading of the manuscript. We also thank Drs. R. Kwok for
the CBP expression vector, and G. Morris for the wild-type and mutant p53 expression
plasmids. Grants DK-53595 and DK-56264 from the National Institutes of Health supported
this study.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
16
References
1. Bhoola, K. D., Figueroa, C. D., and Worthy, K. (1992) Pharmacol. Rev. 44, 1-80
2. Pesquero J. B., Lindsey C. J., Zeh, K., Paiva A. C. M., Ganten D., and Bader M.
(1994) J. Biol. Chem. 269, 26920-26925
3. El-Dahr, S. S., Figueroa, C. D., Gonzalez, C. B., and Müller-Esterl, W. (1997) Kidney
Int. 51, 739-749
4. Dixon, B. S., Sharma, R. V., and Dennis, M. J. (1996) J. Biol. Chem. 271, 13324-
13332
5. Schmidlin, F., Scherrer, D., Daeffler, L., Bertrand, C., Landry, I., and Gies, J-P (1998)
Mol. Pharmacol. 53, 1009-1015
6. Lung, C-C., Jagels, M. A., Daffern, P. J., Tan, E. M., and Zuraw, B. L. (1998) 39, 243-
253
7. Hembree, T. N., and Leeb-Lundberg, L. M. F. (1996) J. Cell. Physiol. 169, 248-255
8. Owen, N. E., and Villereal M. L. (1983) Cell 32, 979-985
9. El-Dahr, S. S., Dipp, S., Baricos, W. H. (1998) Am. J. Physiol. 275, F343-F352
10. Agarwal, M. L., Taylor, W. R., Chernov, M. V., Chernova, O. B., and Stark, G. R.
(1998) J. Biol. Chem. 273, 1-4
11. Ko, L. J., and Prives, C. Genes & Dev. (1996) 10, 1054-1072
12. Godley, L. A., Kopp, J. B., Eckhaus, M., Paglino, J. J., Owens, J., and Varmus, H. E.
(1996) Genes & Dev. 10, 836-850
13. De Oca Luna, R. M., Wagner, D. S., and Lozano, G. (1995) Nature 378, 203-206
14. El-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B.
(1992) Nat. Genet. 1, 45-49
15. Funk, W. D., Pak, D. T., Karas, R. H., Wright, W. E., and Shay, J. W. (1992) Mol.
Cell. Biol. 12, 2866-2871
16. Nagaich, A. K., Zhurkin, V. B., Durell, S. R., Jernigan, R. L., Appella, E., Harrington,
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
17
R. E. (1999) Proc. Natl. Acad. Sci. USA 96, 1875-1880
17. McLure, K. G., and Lee, P. W. K. (1998) EMBO J. 17, 3342-3350
18. Avantaggiati, M. L., Ogryzko, V., Gardner, K., Giordano, A., Levine, A. S., and Kelly,
K. (1997) Cell 89, 1175-1184
19. Gu, W., Shi, X.-L., and Roeder, R. G. (1997) Nature 387, 296-299
20. Lill, N. L., Grossman, S. R., Ginsberg, D., DeCaprio J., and Livingston, D. M. (1997)
Nature 387, 823-827
21. Liu, L., Scolnick, M., Trievel, R. C., Zhang, H. B., Marmorstein, R., Halazonetis, T. D.,
and Berger, S. L. (1999) Mol. Cell. Biol. 19, 1202-1209
22. Buckbinder, L., Talbott, R., Velasco-Moguel, S., Takenaka, I., Faha, B., Seizinger, B.
R., and Kley, N. (1995) Nature 377, 646-649
23. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M.,
Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B (1993) Cell 75, 817-825
24. El-Deiry, W. S, Tokino, T., Waldman, T., Oliner, J. D., Velculescu, V. E., Burrell, M.,
Hill, D. E., Healy, E., Rees, J. L., Hamilton, S. R., Kinzler, K, W., and Vogelstein, B (1993)
Cancer Res. 55, 2910-2919
25. Hollander, M. C., Alamo, I., Jackman, J., Wang, M. G., McBride O. W., and Fornace,
A. J. Jr. (1993) J. Biol. Chem. 268, 24385-24393
26. Macleod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein,
B., and Jacks, T. (1995) Genes Dev. 9, 935-944
27. Miyashita, T., and Reed, J. C. (1995) Cell 80, 293-299
28. Perry, M. E., Piette, J., Zawadski, J. A., Harvey, D., and Levine, A. J. (1993) Proc.
Natl. Acad. Sci. U. S. A. 90, 11623-11627
29. Zauberman, A., Lupo, A., and Oren, M. (1995) Oncogene 10, 2361-2366
30. Elkeles, A., Juven-Gershon, T., Israeli, D., Wilder, S., Zalcenstein, A., and Oren, M.
(1999) Mol. Cell. Biol. 19, 2594-2600
31. Deb, S. P., MuÁoz, R. M., Brown, D. R., Subler, M. A., and Deb, S. (1994)
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
18
Oncogene 9, 1341-1349
32. Seol, D-W., Chen, Q., Smith, M. L., and Zarnegar, R. (1999) J. Biol. Chem. 274,
3565-3572
33. Morris, G. F., Bischoff, J. R., and Mathews, M. B. (1996) Proc. Natl. Acad. Sci. U.
S. A. 93, 895-899
34. Forrester, K., Ambs, S., Lupold, S. E., Kapust, R. B., Spillare, E. A., Weinberg, W.
C., Felley-Bosco E., Wang, X. W., Geller, D. A., Tzeng, E., Billiar, T. R., and Har:ris, C. C.
(1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2442-2447
35. Agoff, S. N., Hou, J., Linzer, D. I. H., and Wu, B. (1993) Science 259, 84-87
36. Farmer, G., Colgan, J., Nakatani, Y., Manley, J. L., and Prives, C. (1996) Mol. Cell.
Biol. 16, 4295-4304
37. Farmer, G., Friedlander, P., Colgan, J., Manley, J. L., and Prives, C. (1996) Nucleic
Acids Res. 24, 4281-4288
38. Wang, Q., Zambetti, G. P., and Suttle, D. P. (1997) Mol. Cell. Biol. 17, 389-397
39. Wang, X. W., Forrester, K., Yeh, J., Feitelson, M. A., Gu, J.-R., and Harris, C. C.
(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2230-2234
40. Lee, K. C., Crowe, A. J., and Barton, M. C. (1999) Mol. Cell. Biol. 19, 1279-1288
41. Ma, J-X., Wang, D-Z., Ward, D. C., Chen, L., Dessai, T., Chao, J., and Chao, L.
(1994) Genomics 23, 362-369
42. Kammerer, S., Braun, A., Arnold, N., and Roscher, A. A. (1995) Biochem. Biophys.
Res. Commun. 211, 226-233
43. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and Howley, P. M.
(1991) Cell 63, 1129-1136
44. Utley, R. T., Ikeda, K., Grant, P. A., Côté, J., Steger, D. J., Eberharter, A., John, S.,
Workman, J. L. (1998) Nature 394, 498-502
45. Berger, S. L. (1999) Cur. Op. Cell Biol. 11, 336-341
46. Pan, Z. K., Zuraw, B. L., Lung, C-C., Prossnitz, E. R., Browning, D. D., and Ye, R. D.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
19
(1996) J. Clin. Invest. 98, 2042-2049
47. Alfie, M. E., Sigmon, D. H., Pomposiello, S. I., and Carretero, O. A. (1997)
Hypertension 29, 483-487
48. Madeddu, P., Varoni, M. V., Palomba, D., Emanueli, C., Demontis, M. P., Glorioso, N,
Dessi-Fulgheri, P., Sarzani, R., and Anania, V. (1997) Circulation 96, 3570-3578
49. Cervenka, L., Harrison-Bernard, L. M., Dipp, S., Primrose, G., Imig, J. D., and El-Dahr,
S. S. (1999) Hypertension 34, 176-180
50. Truant, R., Xiao, H., Ingles, C. J. and Greenblatt, J. (1993) J. Biol. Chem. 268,
2284-2287
51. Thut, C. J., Chen, J. L., Klemm, R., and Tjian, R. (1995) Science 267, 110-104
52. Lu, H., and Levine, A. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5154-5158
53. Wadgaonkar, R., Phelps, K. M., Haque, Z., Williams, A. J., Silverman, E. S., and
Collins, T. (1999) J. Biol. Chem. 274, 1879-1882
54. Saifudeen, Z., and El-Dahr, S. S. (1998) J Am Soc Nephrol 9, 367A (abstract)
55. Arai, N., Mitomi, H., Ohtani, Y., Igarashi, M., Kakita, A., and Okayasu, I. (1999) Mod
Pathol 12, 604-611
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
20
Figure Legends
FIG. 1. The rat bradykinin B2 receptor promoter contains two p53-like binding sites.
A, schematic showing the promoter-reporter BK2 (pBK2-CAT) construct and the relative
positions of the p53-binding sites, P1 and P2. B. Sequence comparisons of the P1 and P2
sites with the consensus p53 binding sequence (ref. 14). Underlined bases denote
sequence variation from the consensus p53 element. C. Species conservation of P1 site.
FIG. 2. p53 binds the p53-like motif (P1 site) in the BK2 promoter. (A) EMSA using a
32P-labeled BK2-P1 oligoduplex (5'-AGGGGGGAGGTGCCCAGGAGAGTGATGACA-3').
Lane 1, free probe; lane 2-4, in the presence of SVT-2 nuclear extracts (-10 µg). Lanes 3
and 4 contain 1 or 2 µl, respectively, of the p53-activating antibody, PAb421. (B) EMSA
using 32P-labeled oligoduplexes containing the p53 consensus sequence (5'-
TAGGCATGTCTAGGCATGTCTAAGCT-3') (lanes 1-7), mutant BK2-P1 oligoduplexes (5'-
AGGGGTGAGGCGCACAGGAGATTGATGACA-3', lane 8; 5'-
AGGGGTGAGGTTACCAGGAGAGTGATGACA-3', lane 9; 5'-
AGGGGGGAGGTAGCAAGGAGAGTGATGACA-3', lane 10), or wild-type BK2-P1
oligoduplex (lanes 11, 12). All lanes contain SVT-2 nuclear extracts. In lane 2, 100-fold
excess of unlabeled consensus p53 sequence was added. Lanes 3-5 represent
competition with increasing amounts (100 to 300-fold molar excess) of unlabeled
oligoduplex corresponding to the p53 DNA binding sequence in the p21/waf-1gene (5'-
ATCAGGAACATGTCCAACATGTTGGAACATGTCCCAACATGTTGAGCTG-3'). Lanes 6 &
7 represent competition with 100- or 200-fold excess of BK2-P1. Lanes 8-10 show lack of
specific binding of mutant BK2-P1 site to nuclear extracts. Lanes 11 and 12 show that
protein binding to the p53-like motif in the P1 site is competed by 100-fold excess unlabeled
p53 consensus sequence. (C) EMSA using recombinant p53 and either radiolabeled BK2-
P1 oligoduplex (lanes 1-3) or the consensus p53 binding oligoduplex (lanes 4-7) as probes.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
21
Unlabeled competitors (100-fold excess) used included the p53 sequence in the p21/waf-1
gene (lane 2 and 6), consensus p53 site (lanes 3 and 5), or BK2-P1 (lane 7). (D) EMSA
using recombinant p53 and BK2-P1 probe. Unlabeled competitors used included 200-fold
excess of BK2-P1 (lane 2), consensus p53 sequence (lane 3) or the p53 site in the p21
gene (lane 4).
FIG. 3. Wild-type p53 activates BK2 promoter-driven transcription in HeLa cells.
A, representative CAT assay result. Using the Lipofectoamine reagent, 1.2 µg of each
reporter construct was cotransfected with 50 ng of the plasmid expressing wild-type p53.
Cells were harvested 24 h after transfection and analyzed for CAT activity. Transfection
and CAT assays were performed in duplicate in at least three independent experiments,
and consistent results were obtained. B, dose-response effect of wild-type p53 (10, 50, 75
ng) on CAT activity of the BK2 promoter constructs, pBK2(-1184) and pBK2(-94). C and D,
Co-transfection of pBK2(-1184) construct with a fixed amount, 50 ng, of pCMV-p53(wt), and
increasing amounts (0, 50, 100, 500 ng) of pCMV-p53(mutant) showing that the dominant
negative mutant p53 suppresses the transcriptional activation of the BK2 promoter by wild-
type p53.
FIG. 4. The transcriptional co-activators, CBP/p300, augment p53-mediated
transactivation of the BK2 promoter. HeLa cells were co-transfected with pBK2(-1184)
(A, B) or pBK2-(-94) (C) constructs (1.2 µg) with or without expression plasmids for wild-
type p53 (50 ng) and increasing amounts of CBP (A) or p300 (B) (0, 10, 50 ng DNA).
FIG. 5. The upstream BK2-P2 sequence modulates p53-mediated transactivation. A,
EMSA gels. 32P-labeled oligoduplexes corresponding to the BK2-P2 sequence (5'-
ACTCTTGCCTGGTCTTCCCT-3') were incubated with SVT-2 nuclear extracts (-10 µg
protein/sample) in the presence or absence of the p53-activating antibody, PAb421 (1 µl).
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
22
The position of the band shifts is indicated by (*). Addition of PAb421 enhanced the DNA-
binding activity, while addition of unlabeled p53 sequence from the p21 gene attenuated the
binding. B, HeLa cells were co-transfected with pBK2 reporter constructs either containing
(-1184) or lacking (-635) the P2 site with expression plasmids for wild-type (wt) or mutant
(mut )p53. CAT activity is 2-fold higher in pBK2(-635) than pBK2(-1184) (n=3 assays in
duplicates). A DNA-binding mutant p53 fails to activate the BK2 promoter. C,
representative CAT assay showing the effect of deletion of the BK2-P2 site on p53-
mediated activation of the BK2 promoter. HeLa cells were transfected with 1.2 µg each of
the promoter-reporter plasmids. BK2 promoter activity is increased in a dose-dependent
manner by wild-type p53. Removal of 3/4 or 4/4 pentamers of the P2 site amplifies the p53-
mediated activation. D, quantitative analysis of the CAT assay in C; white bar: pBK-2(-
1184), gray bar: pBK2-(P2∆15bp), black bar: pBK2-(P2∆20bp). Similar results were obtained in
3 independent experiments.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
A
B
BK2-P1Rat GGAGGTGCCCAGGAGAGTGAMouse GGAGGTGCCCAGGAGAGTGAHuman GGAAGTGCCCAGGAGGCTGA
CAT
NheI+5
5
KpnI
-118
4
BglII
-635
Nco
I-827
XhoI
-108
7
Eco
RI-5
63
ACTCTTGCCTGGTCTTCCCT GGAGGTGCCCAGGAGAGTGA
C
-50-688
Consensus p53 RRRCA/T T/AGYYY
Rat BK2-P1 GGAGGTGCCCAGGAGAGTGARat BK2-P2 ACTCTTGCCTGGTCTTCCCT
P1P2
-70-707
FIG. 1.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
1 2 3 4 5 6 7 8 9 10 11 12
FIG. 2.
Cons. p53 BK2-P1Probe:
SVT-2 cells nuclear extracts
BK2-P1 Cons. p53
1 2 3 4 5 6 7
Probe:
Purified p53
B
C
A
1 2 3 4
Probe: BK2-P1SVT-2 nuclear extracts
MutantP1
1 2 3 4
BK2-P1
D
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
- + - + - + - + - + - + - + - +pCMV-p53
pBK2(-1184)pBK2(-827)
pBK2(-635)pBK2(-563)
pBK2(-384)
pBK2(-200)
pBK2(-94)
pBK2(-38)
0 10 20 30 40 50 60 70 80 90 1000
5
10
15
20
25
pBK2(-1184 )pBK2(-94 )
A
B
Amount of pCMV-p53 (ng)
CA
T/b
-ga
lF
old
activ
atio
n
C
0
20
40
60
80
100
0 50 100 500
D
FIG. 3 Amount of mutant p53 vector (ng)
CA
T/b
-ga
lP
erce
nt in
hibi
tion
pCMV-p53 (wt) ng 50 50 50 50pCMV-p53 (mut) 0 50 100 500
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
pCMV-p53 - + + + + pRSV-CBP - - -pRSV-p300 - - -
A B
FIG. 4.
pCMV-p53 + + + + + + -pRSV-CBP - - - - -pRSV-p300 - - - - -
C
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Competitor - P2 - - P2 - p21 P2 PAb421 - - + + + + + +
Probe: BK2-P2
**
pBK
2(-1884)
pBK
2(-635)
pBK
2(-1884)
pBK
2(-635)
pCMV-p53(wt) pCMV-p53(mut)
pBK2
pBK2
∆P215bp
∆P2 20bp
pBK2∆P2
15bp
∆P220bp
pBK2
∆P2 15bp∆ P2 20bp
A
B
C D
0 10 ng 25 ng 50 ngpCMV-p53
FIG. 5
0
5
10
15
20
10 ng 25 ng 50 ng
CAT/b-gal (fold)
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Zubaida Saifudeen, Hong Du, Susana Dipp and Samir S El-DahrActivation
The Bradykinin Type 2 Receptor is a Target for p53-Mediated Transcriptional
published online March 15, 2000J. Biol. Chem.
10.1074/jbc.M909810199Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from