The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma...

The 2-oxoacid dehydrogenase multi-enzyme complex ofthe archaeon Thermoplasma acidophilum ) recombinantexpression, assembly and characterizationCaroline Heath1, Mareike G. Posner1, Hans C. Aass1, Abhishek Upadhyay2, David J. Scott3,David W. Hough1 and Michael J. Danson1

1 Centre for Extremophile Research, Department of Biology and Biochemistry, University of Bath, UK

2 Department of Biology and Biochemistry, University of Bath, UK

3 National Centre for Macromolecular Hydrodynamics, School of Biosciences, University of Nottingham, Sutton Bonington, UK

In aerobic bacteria and eukaryotes, a family of

2-oxoacid dehydrogenase multi-enzyme complexes

(OADHCs) functions in the pathways of central

metabolism. The complexes are responsible for the oxi-

dative decarboxylation of 2-oxoacids to their corre-

sponding acyl-CoAs. Members of the family include

the pyruvate dehydrogenase complex (PDHC), which

catalyzes the conversion of pyruvate to acetyl-CoA

and so links glycolysis and the citric acid cycle; the

2-oxoglutarate dehydrogenase complex (OGDHC),

which catalyzes the conversion of 2-oxoglutarate to

succinyl-CoA within the citric acid cycle; and the

branched-chain 2-oxoacid dehydrogenase complex

(BCOADHC), which oxidatively decarboxylates the

branched-chain 2-oxoacids produced by the transami-

nation of valine, leucine and isoleucine. The complexes

comprise multiple copies of three component enzymes:

2-oxoacid decarboxylase (E1), dihydrolipoyl acyl-trans-

ferase (E2) and dihydrolipoamide dehydrogenase (E3)

[1–3]. E2 forms the structural core of the complex,

with multiple polypeptide chains associating into octa-

hedral (24-mer) or icosahedral (60-mer) configurations,

depending on the particular complex and the source

organism [2,4]. E1 and E3 bind noncovalently to the

Keywords

Archaea; metabolism; multi-enzyme

complex; 2-oxoacid dehydrogenase;

thermophile

Correspondence

M. J. Danson, Centre for Extremophile

Research, Department of Biology and

Biochemistry, University of Bath, Bath,

BA2 7AY, UK

Fax: +44 1225 386779

Tel: +44 1225 386509

E-mail: [email protected]

(Received 29 June 2007, revised 23 August

2007, accepted 24 August 2007)

doi:10.1111/j.1742-4658.2007.06067.x

The aerobic archaea possess four closely spaced, adjacent genes that encode

proteins showing significant sequence identities with the bacterial and

eukaryal components comprising the 2-oxoacid dehydrogenase multi-

enzyme complexes. However, catalytic activities of such complexes have

never been detected in the archaea, although 2-oxoacid ferredoxin oxidore-

ductases that catalyze the equivalent metabolic reactions are present. In the

current paper, we clone and express the four genes from the thermophilic

archaeon, Thermoplasma acidophilum, and demonstrate that the recombi-

nant enzymes are active and assemble into a large (Mr ¼ 5 · 106) multi-

enzyme complex. The post-translational incorporation of lipoic acid into

the transacylase component of the complex is demonstrated, as is the

assembly of this enzyme into a 24-mer core to which the other components

bind to give the functional multi-enzyme system. This assembled complex

is shown to catalyze the oxidative decarboxylation of branched-chain

2-oxoacids and pyruvate to their corresponding acyl-CoA derivatives. Our

data constitute the first proof that the archaea possess a functional 2-oxo-

acid dehydrogenase complex.

Abbreviations

BCOADHC, branched-chain 2-oxoacid dehydrogenase complex; CoASH, coenzyme-A; DLS, dynamic light scattering; E1, 2-oxoacid

decarboxylase; E2, dihydrolipoyl acyl-transferase; E3, dihydrolipoamide dehydrogenase; FOR, ferredoxin oxidoreductase; IPTG, isopropyl

thio-b-D-galactoside; Mr, relative molecular mass; OADHC, 2-oxoacid dehydrogenase complex; OGDHC, 2-oxoglutarate dehydrogenase

multienzyme complex; PDHC, pyruvate dehydrogenase complex; TPP, thiamine pyrophosphate.

5406 FEBS Journal 274 (2007) 5406–5415 ª 2007 The Authors Journal compilation ª 2007 FEBS

E2 core. E1 may occur as a homodimer or as an a2b2hetero-tetramer, depending upon the source and the

type of complex, although in all cases E3 is a dimer of

identical subunits.

E2 also forms the catalytic core of the complex; a

lipoyl moiety, covalently attached to a lysine residue in

the lipoyl domain of the E2, serves as a swinging arm,

connecting the active sites of each enzyme and chan-

nelling substrate through the complex [2,3]. Thus, E1

catalyzes the thiamine pyrophosphate (TPP)-dependent

decarboxylation of the 2-oxoacid and the transfer

of the resulting acyl group to the lipoic acid of E2.

E2 then transfers the acyl-group to coenzyme-A

(CoASH), after which E3 serves to reoxidize the

dihydrolipoyl moiety. It does so by the reduction of

the noncovalently bound cofactor FAD, in conjunction

with a protein disulfide bond and an amino acid base,

all of which are themselves then reoxidized by NAD+

to form NADH.

In Archaea [5] and anaerobic bacteria, the equiva-

lent oxidation of 2-oxoacids is catalyzed by an un-

related, and structurally more simple, family of

2-oxoacid ferredoxin oxidoreductases (FORs). This

comprises the pyruvate FOR, the 2-oxoglutarate FOR

and the 2-oxoisovalerate FOR, which catabolize the

oxidative decarboxylation of pyruvate, 2-oxoglutarate

and the branched-chain 2-oxoacids, respectively [6–8].

The pyruvate FOR from the halophilic archaeon Halo-

bacterium halobium is an a2b2 structure [9], whereas in

Sulfolobus solfataricus and Aeropyrum pernix it is an

ab dimer, and an octamer (a2b2c2d2) in Pyrococcus

furiosus, Methanothermobacter thermoautotrophicum

and Archaeoglobus fulgidus [reviewed in 5,8]. The cata-

lytic reaction of FORs does not involve a lipoic acid

moiety or NAD+; rather, the acyl-moiety formed on

decarboxylation of the 2-oxoacid is handed on directly

to CoASH, and the reducing equivalents to ferredoxin

via the enzyme’s iron-sulfur centre [6–8].

No OADHC activity has ever been detected in any

archaeon [5]. However, detection of E3 and lipoic acid

in various archaea [10–12] led to the discovery of a

putative OADHC operon in Haloferax volcanii [13]

and our subsequent detection of similar putative ope-

rons in the genome sequences of the aerobic archaea

Thermoplasma acidophilum, S. solfataricus, Sulfolobus

acidocaldarius, A. pernix, Pyrobaculum aerophilum,

Halobacterium NRC1 and Ferroplasma acidophilum

(M. G. Posner, unpublished data).

We have previously expressed the E1a and E1bgenes of the putative OADHC from T. acidophilum in

Escherichia coli and shown the recombinant proteins

to assemble into an a2b2 enzyme that catalyzes the

decarboxylation of the branched-chain 2-oxoacids and

pyruvate [14]. In the current paper, we report the clon-

ing and expression of the E2 and E3 genes of the same

operon from T. acidophilum, and the in vitro assembly

and characterization of an active 2-oxoacid dehydro-

genase complex.

This, then, is the first evidence that the putative

OADHC operon in an archaeon encodes a 2-oxoacid

dehydrogenase multi-enzyme complex that is func-

tional in vitro and therefore may have physiological

significance.

Results

Expression and purification of the E1, E2 and E3

components

The E1 component

The E1 a2b2 recombinant enzyme was produced as

described previously, and was shown to be catalyti-

cally active with the branched-chain 2-oxoacids

4-methyl-2-oxopentanoate, 3-methyl-2-oxopentanoate

and 3-methyl-2-oxobutanoate, and with pyruvate [14].

By dynamic light scattering (DLS), its Mr was found

to be 168 000 (± 6000), consistent with the value

of 165 000 determined by gel filtration [14] and the

expected value of 157 000 from the protein

sequences.

The E2 component

The gene encoding the E2 component was PCR-ampli-

fied from T. acidophilum genomic DNA and cloned

into the pET28a expression vector, as described in

Experimental procedures. The E2 protein was then

expressed in two host systems: E. coli BL21(DE3) cells,

in medium supplemented with lipoic acid but without

isopropyl thio-b-d-galactoside (IPTG) induction, and

E. coli BL21(DE3)pLysS cells without supplementation

but with IPTG induction. Both methods yielded solu-

ble E2 protein, although the level of expression was

significantly greater in the pLysS cells. In each case,

E2 was purified to >95% homogeneity using His-

Bind affinity chromatography followed by anion

exchange chromatography.

The E2 Mr values predicted from the published gene

sequence are 46 276 for unlipoylated protein and

46 464 for the polypeptide possessing a single lipoyl

residue. Accordingly, mass spectrometric analysis

revealed that the E2 expressed in E. coli grown in

lipoic acid-supplemented medium comprised an

approximately equimolar mixture of unlipoylated

(Mr ¼ 46 273) and lipoylated (Mr ¼ 46 461) protein.

Furthermore, from MS-analysis of tryptic fragments,

C. Heath et al. 2-Oxoacid dehydrogenase complex from the Archaea

FEBS Journal 274 (2007) 5406–5415 ª 2007 The Authors Journal compilation ª 2007 FEBS 5407

lipoylation was shown to have occurred at K42, which

by sequence comparisons corresponds to the lipoylated

lysine residue in bacterial E2 components (Fig. 1).

However, the E2 protein produced by expression in

induced cells, without lipoic acid supplement to the

growth medium, was <5% lipoylated. As reported

below, consistent with these data is the observation

that only the complex assembled using the lipoylated

E2 component showed detectable catalytic activity in

the overall complex assay.

The E3 component

The gene encoding the E3 component was PCR-

amplified from T. acidophilum genomic DNA and

cloned into the pET28a expression vector, as

described in Experimental procedures. Expression of

the E3 gene was carried out in E. coli BL21(DE3)

cells. Small-scale expression trials with induced versus

uninduced host cells revealed a higher E3 activity in

the soluble cell extract from uninduced cells, and this

was confirmed by SDS ⁄PAGE. The soluble protein

was purified to >95% homogeneity by heat precipi-

tation at 60 �C and His-Bind affinity chromatogra-

phy. The absorption spectrum of the purified protein

showed peaks at 375, 450 and 475 nm that are char-

acteristic of the presence of FAD in the enzyme;

using a molar absorption coefficient for FAD of

11 300 m)1Æcm)1 at 455 nm [15], the flavin content

was calculated to be 1.0 (± 0.1) FAD per polypep-

tide (Mr ¼ 49 867). Analytical gel filtration revealed

an Mr ¼ 100 000 for the purified enzyme, and DLS

gave a similar value (117 000 ± 2000), suggesting a

dimeric structure, as has been found for the bacterial

and eukaryotic enzymes. The maximal specific activity

of the enzyme was found to be 22 (± 1) lmolÆmin)1Æmg)1, a value that is considerably higher than

the overall complex activity (see below).

Assembly of OADHC from the recombinant

components

Complex assembly

When E1, E2 and E3 were incubated at 55 �C for

10 min in 20 mm sodium phosphate buffer, pH 7.5,

containing 2 mm MgCl2 and 0.2 mm TPP, prior to

assay, whole complex activity was subsequently

detected with the branched-chain 2-oxoacids 4-methyl-

2-oxopentanoate, 3-methyl-2-oxopentanoate and

3-methyl-2-oxobutanoate, and with pyruvate. The

10-min incubation is necessary to allow E1-TPP bind-

ing [16], but no increase in rate was seen when the

incubation, after subunit mixing, was extended to 1 h

at 4 �C, 25 �C or 55 �C.With an E2 : E3 molar ratio fixed at 1 : 1 (E2 poly-

peptide to E3 dimer), titration with E1 resulted in an

increase in whole complex activity until a maximum

was reached at a molar ratio (E1 ⁄E2) of approximately

2–3 : 1 [E1 a2b2 tetramer to E2 polypeptide] (Fig. 2).

However, a reduction of the E3 ratio did not cause a

significant change in whole complex activity, and by

investigating the mixing of various amounts of the

complex components it was found that maximum

OADHC activity was achieved when the E1, E2 and

E3 subunits were mixed in a molar stoichiometry of

3 : 1 : 0.1. However, as described below, this stoichio-

metry does not equate to the amounts of the three

enzymes in the assembled complex.

B. subtilis PDHC

B. subtilis BCOADHCTp. acidophilum OADHCE. coli OGDHC

E. coli PDHC (lipoyl domain 3)

Fig. 1. Alignment of various E2 sequences around the lipoylated

lysine residue. The T. acidophilum E2 protein sequence was aligned

with those of the E2 components of the following OADHCs using

the CLUSTALW multiple sequence alignment program: Bacillus subtilis

PDHC; B. subtilis BCOADHC; E. coli OGDHC; E. coli PDHC (lipoyl

domain 3). Residues 27–53 of the T. acidophilum sequence are

shown, along with the aligned regions of the other E2 sequences,

and the lysine residue that is lipoylated in each sequence is marked

by a (*).

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

0.08

0.09

0.1

0 1 2 3 4 5 6 7

Molar Ratio of E1:E2

Act

ivit

y (A

U/m

in)

Fig. 2. Whole complex activity as a function of the E1 : E2 ratio.

Lipoylated E2 and E3 were mixed in a molar ratio of 1 : 1 (E2 poly-

peptide to E3 dimer), and to this mixture varying amounts of E1

were added. The mixture was then incubated at 55 �C for 10 min

in the presence of 2 mM MgCl2 and 0.2 mM TPP, following which

samples were taken and assayed for whole complex activity

(expressed as A (absorbance units).min)1) using the substrate

3-methyl-2-oxopentanoate. The molar ratio of E1 : E2 is expressed

as E1 a2b2 tetramer to E2 polypeptide.

2-Oxoacid dehydrogenase complex from the Archaea C. Heath et al.


OADHC activity

The whole complex activity detected with 4-methyl-2-

oxopentanoate, 3-methyl-2-oxopentanoate, 3-methyl-2-

oxobutanoate, and pyruvate, but not with 2-oxogluta-

rate, is entirely consistent with the substrate specificity

observed for the recombinant E1 enzyme in the

absence of the other complex components [14]. The

relative activities are given in Table 1, along with those

for the isolated E1 component and for the BCOADHC

from bovine kidney. Using 3-methyl-2-oxopentanoate

as substrate, the assembled T. acidophilum complex

exhibited a hyperbolic dependence of velocity on the

2-oxoacid concentration, with KM ¼ 250 (± 40) lm

and Vmax ¼ 4 (± 0.1) lmolÆmin)1Æmg)1 (E2). This spe-

cific activity is comparable to that of the Bacillus

stearothermophilus PDHC [8–10 lmo1Æmin)1Æmg)1 (E2)

[17].

Relative molecular mass of the E2 core and the

assembled complex

Analytical centrifugation and DLS were used to deter-

mine the Mr of both the E2 core and the assembled

complex.

E2 core

Sedimentation velocity analysis was carried out at

40 �C as described in Experimental procedures on

recombinant E2 that was 50% lipoylated and had been

purified by His Bind� (Novagen, Merck Biosciences

Ltd., Nottingham, UK) and then anion-exchange chro-

matography. The sedimentation coefficient distribu-

tions showed a major symmetrical peak constituting

95% of the total protein (Fig. 3). Analysis of the data

by direct fitting using the finite element solution of the

Lamm equation in sedfit [18], gave a sedimentation

coefficient (corrected to water at 20�C and infinite

dilution; s�20,w) ¼ 27 (± 1) S (Svedberg units; 1S =

10)13 seconds) and an Mr ¼ 1.1 (± 0.1) · 106. From

the E2 polypeptide Mr of 46 276, the E2 protein there-

fore comprises 23.8 polypeptides; that is, it assembles

into a core of 24 subunits possessing octahedral sym-

metry.

DLS analysis at 55 �C, the optimum growth temper-

ature of T. acidophilum, gave an E2 Mr value ¼ 1.0

(± 0.1) · 106, in good agreement with the value deter-

mined by analytical centrifugation. This E2 sample

was nonlipoylated, demonstrating that lipoylation is

not a prerequisite for assembly of the core. Interest-

ingly, the Mr of the same E2 at 25 �C, with no prior

heat treatment at 55 �C, was estimated by DLS to be

55 000, close to the sequence-predicted monomer value

(46 276); this indicates that the assembly of E2 into a

24-mer core is temperature dependent.

The assembled complex

Sedimentation velocity analysis at 40 �C of assembled

complex, created by mixing the components in a

3 : 1 : 0.1 (E1 a2b2: E2 polypeptide: E3 a2) molar

ratio, revealed three discrete protein peaks with s�20,wvalues of 50S (24% of total protein), 19S (8%) and 6S

Table 1. Substrate specificities of the T. acidophilum 2-oxoacid

dehydrogenase complex. The T. acidophilum assembled complex

was assayed as described in Experimental procedures. For

3-methyl-2-oxopentanoate, Vmax ¼ 4 lmolÆmin–1Æmg–1 (E2), and

KM ¼ 250 lM; other activities were determined at saturating sub-

strate concentrations.

2-Oxoacid substrate

Ratio of specific activities

T. acidophilum

Bovine kidney

BCOADHCb

Assembled

complex E1a

3-methyl-2-oxopentanoate 1.0 1.0 1.0

4-methyl-2-oxopentanoate 0.5 0.3 1.5

3-methyl-2-oxobutyrate 0.9 0.6 0.2

pyruvate 0.2 0.2 0.4

2-oxoglutarate 0 0 0

a Data from [14]. b Data from [25].

Fig. 3. Sedimentation coefficient distributions of the E2 protein.

Sedimentation velocity of lipoylated E2 protein was carried out at

40 �C as described in Experimental procedures. The sedimentation

velocity distribution was obtained by the c(s) method [34] using the

program SEDFIT, and the data were then directly fitted using the

finite element solution of the Lamm equation in SEDFIT [18] to give

values of the sedimentation coefficient in the buffer of sedimenta-

tion [20 mM Tris ⁄ HCl (pH 8.5), 0.4 M NaCl and 1 mM phenyl-

methanesulfonyl fluoride].



(68%), respectively. Unfortunately, attempts to fit

these data using the finite element solution of the

Lamm equation in sedfit [18] were unsuccessful, thus

failing to give Mr values for these proteins. Using the

relationship that s � (Mr)2 ⁄ 3 for globular proteins, and

incorporating the values of Mr ¼ 6.1 · 106 and

s�20,w ¼ 60S for the E. coli PDHC [19], an approxi-

mate value of Mr ¼ 4.7 · 106 was calculated for what

is assumed to be an assembled Thermoplasma complex

of 50S.

DLS is better able to deal with the polydispersity in

the sample of assembled complex. Analysis of the auto-

correlation curve using the volume distribution algo-

rithm gives an Mr of 5.0 (± 0.2) · 106 for the complex

at 55 �C, in close agreement with that estimated by sed-

imentation velocity experiments described above.

To investigate the identity of the species in the

assembled complex mixture, analytical gel filtration

on SuperdexTM200 (GE Healthcare, Chalfont St Giles,

UK) was carried out. Three protein species were

observed (Fig. 4), one eluting in the column exclusion

volume (where Mr > 1.3 · 106), one of Mr � 160 000,

and a third minor peak at Mr � 100 000. Whole com-

plex activity was only detected in fractions at the

exclusion volume, whereas E1 activity was detected in

the second peak and E3 in the third. SDS ⁄PAGE of

protein from the exclusion volume peak revealed three

protein bands, corresponding to E1a, E1b and E2 ⁄E3(the last two proteins run together due to their similar

polypeptide size). The second peak contained predomi-

nantly excess E1 protein, whilst the third minor peak

comprised E1 and E3 protein that had not been com-

pletely separated. In repeat experiments, uncomplexed

E3 was not always detectable.

Thus it is concluded that the species of Mr ¼ 5 · 106

is assembled, catalytically active whole complex. Given

that the molar ratio of E2 : E3 (E2 polypeptide: E3 a2)

is likely to be 1 : 0.1 at a maximum (that is, the ratio

of mixed components), then an Mr of 5.0 · 106 would

correspond to an approximate stoichiometry (E1 a2b2:E2 polypeptide: E3 a2) of 1 : 1 : 0.1. The other major

peak in the sedimentation velocity analysis (6S) is pre-

sumably excess E1. The minor 19S species remains

unidentified, although it should be noted that a 19.8S

species was also observed in the assembled E. coli

PDHC, where it was concluded that it had the proper-

ties of an incomplete aggregate of the component

enzymes based on a trimer of the E2 chain [19].

Discussion

As described in the introduction, the genomes of aero-

bic archaea contain four genes whose translated pro-

tein products show sequence identities to the E1a,E1b, E2 and E3 components of the 2-oxoacid dehydro-

genase multi-enzyme complexes of aerobic bacteria

and eukarya [reviewed in 5]. Furthermore, the genes

appear to be arranged in an operon, transcriptional

evidence for which has recently been gained in the hal-

ophilic archaeon, H. volcanii [20]. The presence of

0 2 4 6 8 10 12 14 16

Elution volume (mL)

1

3

1

3

1

2

3

1

2

3

Enzyme activityA BComplex E1 E3

45.0

31.0

21.5

66.2

97.4116.3

210.0

M 1 2 3

E2 and E3

E1α

E1β

A280

Fig. 4. Analytical gel filtration and SDS ⁄ PAGE analysis of assembled OADHC. Assembled OADHC was created by mixing the recombinant

protein components in a 3 : 1 : 0.1 (E1 a2b2: E2 polypeptide: E3 a2) molar stoichiometry, followed by incubation at 55 �C for 10 min in the

presence of 2 mM MgCl2 and 0.2 mM TPP. (A) Gel filtration of the assembled complex was carried out at 25 �C as described in Experimental

procedures, and the fractions were assayed for whole complex, E1 and E3 catalytic activity. Active fractions are indicated by bars above the

elution profile. (B) Fractions were also analyzed by SDS ⁄ PAGE. M, marker proteins with their Mr values given in kDa. Lanes 1–3 correspond

to protein peaks 1–3 from the gel filtration; the identity of the component polypeptides is indicated alongside the gel.



these genes is unexpected, as all the archaea possess

ferredoxin oxidoreductases that catalyze the equivalent

oxidation of the same 2-oxoacids as those used by the

bacterial and eukaryal dehydrogenase complexes;

moreover, activity of the 2-oxoacid dehydrogenase

complexes has never been detected in any archaeon.

The obvious question raised by these observations is

whether or not the archaeal ‘OADHC’ genes actually

encode functional proteins that assemble into a multi-

enzyme complex. The E1 component defines the sub-

strate specificity of the whole complex, and we have

previously reported heterologous expression of the

a2b2 E1 enzyme from T. acidophilum and shown it to

be catalytically active with the branched-chain 2-oxo-

acids and pyruvate [14]. In the current paper, the E2

and E3 genes have also been successfully cloned and

expressed as soluble proteins in E. coli, and their cata-

lytic activities have been demonstrated.

Generation of an active E2 enzyme requires lipoyla-

tion of a specific lysine residue. In E. coli the lipoyla-

tion of its own E2 components can occur via two

routes [21,22]. The endogenous pathway involves the

covalent attachment of a C-8 intermediate of fatty acid

biosynthesis to the target lysine on E2 by enzyme LipB;

subsequently, LipA catalyzes the incorporation of sul-

fur atoms to generate the lipoic acid moiety. However,

if lipoic acid is supplied in the growth medium, E. coli

preferentially uses its exogenous pathway, which

employs lipoate protein ligase A; this enzyme catalyzes

the adenylation of lipoic acid after uptake into the cell

and its subsequent transfer to the E2 lysine residue.

Knowing that the lipoylation process can take place

across the species barrier, albeit with varying efficien-

cies [2, and references therein], lipoylation of recombi-

nantly expressed Thermoplasma E2 was tested and

optimized. Up to 50% lipoylation was achieved when

the rate and level of expression in E. coli was slowed

down by decreasing the growth temperature and avoid-

ing induction, whilst at the same time supplementing

the growth medium with lipoic acid.

Clearly, therefore, the E. coli machinery is able to rec-

ognize the lipoyl-domain of the Thermoplasma E2

enzyme, the target lysine of which is flanked by D and V

residues, as it is in the E2 protein of the E. coli OGDHC

and of the Bacillus subtilis BCOADHC (Fig. 1). How-

ever, in addition to the identity of the neighbouring

residues, it is the exact positioning of the lysine in the

lipoyl domain that is fundamental to target lysine recog-

nition [23], implying that the fold of the Thermoplasma

enzyme has been conserved in this region.

Whilst the Thermoplasma recombinant E2 has not

been assayed for catalytic activity in isolation, assem-

bly of the whole active complex from its individually

expressed components shows that it is indeed a func-

tional enzyme. This assembly process, studied by both

analytical ultracentrifugation and DLS, has been dem-

onstrated to involve the formation of a 24-mer E2

core, which binds E1 and E3 components to give a

complex that has the same substrate specificity as that

determined for the isolated E1 enzyme; namely, it is a

branched-chain 2-oxoacid dehydrogenase complex that

is also active with pyruvate. An E2 core that comprises

an assembly of 24 polypeptide chains is consistent with

other branched-chain 2-oxoacid multi-enzyme com-

plexes from bacteria and eukarya [24,25], some of

which also have activity with pyruvate. Additionally,

the E1 subunit in those branched-chain complexes is

also an a2b2 oligomer [24,25]. What is particularly

interesting is that the assembly of the E2 core in the

Thermoplasma enzyme is temperature dependent, incu-

bation to at least 40 �C (the temperature of the ultra-

centrifugation) being required.

The data in Fig. 2 show that overall complex activ-

ity increased linearly with the ratio of E1 : E2 mixed

together, as was found with the E. coli PDHC for

example [26], until maximal activity was achieved at a

mixing ratio of 2 : 1. However, both ultracentrifuga-

tion and DLS estimate the Mr of the assembled com-

plex to be around 5 · 106, closely fitting the tentative

conclusion of an E1(a2b2) ⁄E2 ⁄E3(a2) stoichiometry of

1 : 1 : 0.1. These experiments indicate that not all the

E1 molecules may be tightly bound to the E2 core

and ⁄or that assembly might be substrate enhanced.

Whilst uncertainties remain over the exact subunit

composition of the assembled complex, the important

conclusion from our data is that the four OADHC

ORFs in the archaeon T. acidophilum encode the com-

ponents of a functional 2-oxoacid dehydrogenase

multi-enzyme complex, the first to be identified in this

domain of life. Thus, OADHCs were probably present

in the common ancestor to the Bacteria and Archaea,

and have been retained in aerobic members of each

domain. The Thermoplasma enzyme possesses catalytic

activity with branched-chain 2-oxo acids and pyruvate,

but it remains to be established whether other archaeal

OADHCs have the same or different substrate specific-

ities. However, whatever specificity is found, the physi-

ological role of these OADHCs in the archaea remains

a mystery given the presence of active 2-oxoacid FORs

that catalyze the equivalent chemical reactions.

In studies of the OADHC from the halophilic archa-

eon H. volcanii, we could find no growth substrate that

would induce the expression of OADHC activity [20],

nor was any physiological defect apparent in this

organism when the E3 gene was inactivated by inser-

tional mutagenesis [27]. Interestingly, Wanner & Soppa



[28] have found an additional gene cluster in H. volca-

nii comprising three genes that would appear to code

for OADHC E1a and E1b subunits, and an unat-

tached lipoyl domain; however, no genes for a com-

plete E2 or an E3 were present. Evidence for a

function during nitrate-respirative growth on Casami-

no acids was presented, although the metabolic sub-

strate could not be identified.

In conclusion, with respect to the archaeal four-gene

OADHC cluster that we have studied in this paper, it

is highly unlikely that the genes would have been

retained in a highly sophisticated and functional state

without a physiological role. We suggest that proteo-

mic studies on this thermoacidophile need to be insti-

tuted to reveal this role.

Experimental procedures

Materials

Bacteriological media were purchased from Sigma-Aldrich

(Poole, UK) or Fisher Scientific (Loughborough, UK).

Expression vector pET28a, E. coli expression strain

BL21(DE3), BugBuster Protein Extraction Reagent and

Benzonase� nuclease were purchased from Novagen-Merck

(Nottingham, UK). E. coli JM109 cells, pGEM-T vector,

restriction endonucleases, T4 DNA ligase and Taq polymer-

ase were purchased from Promega (Southampton, UK).

Vent DNA polymerase was from New England Biolabs

(Hitchin, UK). Lipoic acid, phenylmethanesulfonyl fluoride

and antibiotics were purchased from Sigma-Aldrich.

SDS ⁄PAGE molecular mass markers were from Bio-Rad

(Hemel Hempstead, UK).

Plasmids pET19b-E1a and pET28a-E1b, which, respec-

tively, coexpress the a and b subunits of the T. acidophilum

E1, have been described previously [14].

Bioinformatics

The putative OADHC operon was identified in the T. aci-

dophilum DSM1728 genome from the ENTREZ Nucleotide

database (http://www.3.ncbi.nlm.nih.gov). E1a: Ta1438;

E1b: Ta1437; E2: Ta1436; and E3: Ta1435.

Recombinant DNA techniques

E2 and E3 gene amplification

Preparation of genomic DNA from T. acidophilum strain

DSM 1728 has been described previously [29]. The E2 and

E3 genes were PCR-amplified from this genomic

DNA using primers that engineered restriction sites into the

5¢- and 3¢ ends of the gene products: NdeI and XhoI for the

E2 gene, and NheI and EcoRI for E3. Oligonucleotides

were as follows (restriction sequences are underlined):

E2 forward: CGCCATATGTACGAATTCAAACTGC

CAGACATAGG

E2 reverse: CCGCTCGAGTCAGATCTCGTAGAT

TATAGCGTTCGG

E3 forward: CTACGAGAGCTAGCATGTACGATGC

AATAATAATAGGTTC

E3 reverse: TTTAAAAATGGAATTCAATGAGAT

GGT.

PCR amplification was carried out using Vent polymer-

ase, and A-tails were added to the products with Taq poly-

merase. Both genes were then separately cloned into the

intermediate vector pGEM-T using T4 DNA ligase, and

the clones were amplified in E. coli strain JM109 grown in

Luria–Bertani LB media [1% (w ⁄ v) tryptone, 1% (w ⁄ v)NaCl, 0.5% (w ⁄ v) yeast extract] supplemented with carben-

icillin (50 lgÆmL)1). Plasmids were extracted using the BD

Biosciences (Palo Alto, CA) NucleoSpin Plasmid kit, and

the genes were sequenced for fidelity. The E2 and E3 genes

were then excised from pGEM-T, using the appropriate

restriction endonucleases, purified by electrophoresis in a

0.8% (w ⁄ v) agarose gel, and extracted from the gel using

the Qiagen (Hilden, Germany) Qiaex II Gel Extraction kit.

Construction of expression vectors pET28a-E2 and

pET28a-E3

Expression vector pET28a was prepared for recombinant

ligation by NdeI ⁄XhoI restriction endonuclease digestion for

E2, and NheI ⁄EcoRI digestion for E3, and purified by gel

electrophoresis and gel extraction as already described. E2

and E3 genes were separately ligated into the vectors using

T4 DNA ligase, generating the recombinant expression vec-

tors pET28a-E2 and pET28a-E3. This pET28a vector thus

introduced a 20- and a 23-amino acid sequence at the N-ter-

mini of the E2 and E3 recombinant protein products, respec-

tively, with each containing a 6-histidine tag sequence.

Expression and purification of OADHC

components

E2 expression and purification

Two different methods of expression were used. Several col-

onies of E. coli strain BL21(DE3), freshly transformed with

plasmid pET28a-E2, were picked from LB agar plates and

used to inoculate 2 L of LB medium supplemented with

kanamycin (30 lgÆmL)1) and 0.2 mm dl-lipoic acid. Incu-

bation was at 30 �C for 20 h in darkness, with no induction

by IPTG, after which cells were harvested by centrifugation

at 6000 g. Alternatively, an overnight culture (20 mL,

A600 0.6) of freshly transformed E. coli BL21(DE3)pLysS

cells was used to inoculate 1 L of LB medium supple-

mented with kanamycin (30 lgÆmL)1). After induction with

IPTG (at A600 0.6) and subsequent overnight incubation at

37 �C, cells were harvested as described before. The former



method allows production of recombinant E2 of which up

to 50% is lipoylated, whereas in the latter method only 5%

of the E2 is lipoylated.

Purification of the recombinant E2 was carried out at

25 �C, unless otherwise stated. Samples were analyzed by

SDS ⁄PAGE on a 10% (w ⁄ v) polyacrylamide gel at each

step of the purification, and protein concentrations were

determined from A280 values. Frozen cells were disrupted

by resuspension in BugBuster (5 mLÆg)1 wet cells) supple-

mented with Benzonase nuclease (1 lLÆmL)1), incubated on

ice with gentle agitation for 30 min, and centrifuged at

16 000 g for 20 min at 4 �C to pellet cell debris. The solu-

ble cell extract was subjected to His Bind� Resin chroma-

tography, and fractions containing E2 protein were pooled

and dialyzed overnight into 20 mm Tris ⁄HCl buffer,

pH 9.0, 10% (v ⁄ v) glycerol. The protein was then subjected

to anion exchange chromatography on an Amersham Bio-

sciences (Chalfont St Giles, UK) Akta FPLC system, using

a 5 mL Q-Sepharose Hi-Trap column equilibrated with

50 mm Tris ⁄HCl buffer, pH 8.5. Protein was eluted over a

0–0.8 m gradient of NaCl in the same buffer, at a flow rate

of 1 mLÆmin)1 over 60 min. Fractions containing E2 were

stored at 4 �C in the elution buffer supplemented with

1 mm phenylmethanesulfonyl fluoride.

E3 expression and purification

For expression of the E3 enzyme, a 20 mL overnight cul-

ture of transformed BL21(DE3) (A600 0.6) was used to

inoculate 1 L of LB medium supplemented with kanamycin

(30 lgÆmL)1). Cells were incubated at 37 �C until 5 h after

the A600 had reached 0.6 (with no induction by IPTG), and

were then collected by centrifugation. Cell disruption was

carried out as described for the purification of recombinant

E2. The soluble cell extract was subjected to heat precipita-

tion at 65 �C for 5 min, and precipitated material removed

by centrifugation at 16 000 g for 20 min at 4 �C. E3 in the

remaining soluble fraction was purified by His-Bind Resin

chromatography, dialyzed overnight into 20 mm Tris ⁄HCl

buffer, pH 8.4, and then stored at 4 �C.

Assembly of the OADHC multi-enzyme complex

OADHC was assembled in vitro by mixing together recom-

binant E1a, E1b, E2 and E3 proteins at 55 �C for 0–1 h.

Molar ratios to enzyme E2 varied from 0.5 to 6.0 (E1a2b2)

and 0.01–1.0 (E3a2). Each assembled complex was assayed

for overall complex activity as described below.

SDS-PAGE

Analysis of protein purity and determination of polypeptide

Mr values were carried out by SDS ⁄PAGE in a resolving

gel containing 10% (w ⁄ v) acrylamide [30].

Enzyme assays

E1 enzymic activity was assayed spectrophotometrically by

following the 2-oxoacid-dependent reduction of 2,6-dichlo-

rophenolindophenol (DCPIP) at 595 nm [31]. Assays were

carried out at 55 �C in 20 mm potassium phosphate

(pH 7.0), 2 mm MgCl2 and 0.2 mm TPP. Buffer and recom-

binant E1a2b2 enzyme were pre-incubated at 55 �C for

10 min; 50 lm DCPIP was then added and the assay

started by the addition of the 2-oxoacid substrate (pyru-

vate, 2-oxoglutarate, 4-methyl-2-oxopentanoate, 3-methyl-2-

oxopentanoate or 3-methyl-2-oxobutanoate).

E3 was assayed at 55 �C in 50 mm EPPS buffer (pH 8.0)

containing 0.4 mm dihydrolipoamide and 1 mm NAD+.

The reaction, in a final volume of 1 mL, was started by the

addition of enzyme, and activity was monitored by measur-

ing the production of NADH at 340 nm.

Overall complex activity was assayed at 55 �C in 50 mm

potassium phosphate buffer (pH 7.0) containing 2.5 mm

NAD+, 1 mm MgCl2, 0.2 mm TPP, 0.13 mm CoASH and

2.6 mm cysteine-HCl [32]. Buffer and assembled enzyme

complex were pre-incubated at 55 �C for 10 min to allow

binding of TPP to E1. The assay, in a final volume of

1 mL, was started by the addition of the 2-oxoacid substrate

as for the assay of E1, and OADHC activity was monitored

by measuring the production of NADH at 340 nm.

Kinetic parameters were determined by the direct linear

method of Eisenthal & Cornish-Bowden [33].

Gel filtration

Analytical gel filtration was carried out at 25 �C on the

Amersham Biosciences Akta FPLC system, using a

Superdex 200 10 ⁄ 300 GL column. Protein standards

were: b-amylase (Mr ¼ 200 000), alcohol dehydrogenase

(150 000), BSA (66 000), carbonic anhydrase (29 000) and

cytochrome c (12 400). For analysis of E3, the column was

equilibrated with 20 mm sodium phosphate (pH 7.0), 0.1 m

NaCl and 10% (v ⁄ v) glycerol; peak fractions were assayed

for E3 enzymic activity. Analysis of assembled complex was

carried out in 20 mm sodium phosphate (pH 7.0), 2 mm

MgCl2, 0.1 m NaCl and 10% (v ⁄ v) glycerol. Peak fractions

were assayed for E1, E3 and OADHC activity.

Analytical ultracentrifugation

All analytical ultracentrifugation experiments were carried

out on a Beckman XL-A analytical ultracentrifuge (Beck-

man-Coulter, CA). Sedimentation velocity experiments were

carried out at 15 000 r.p.m., and cells were scanned every

5 min at 280 nm. For sedimentation of E2, the buffer was

20 mm Tris ⁄HCl (pH 8.5), 0.4 m NaCl and 1 mm phen-

ylmethanesulfonyl fluoride; for whole complex, the buffer

was the same as that used in the analytical gel filtration



analysis, 20 mm sodium phosphate (pH 7.0), 2 mm MgCl2,

100 mm NaCl and 10% (v ⁄ v) glycerol. The set temperature

on the centrifuge was 40 �C, and the solution densities were

directly measured at this temperature using an Anton-Paar

DMA 5000 high-precision density-meter. Sedimentation

velocity distributions were obtained by the c(s) method [34]

using the program sedfit. Data were then directly fitted

using the finite element solution of the Lamm equation in

sedfit [18] to give values of the sedimentation coefficient

and of Mr.

Dynamic light scattering

All DLS measurements were performed using a Zetasizer

Nano S from Malvern Instruments Ltd. (Malvern, UK).

Prior to DLS measurements, protein solutions

(1 mgÆmL)1) in 20 mm sodium phosphate buffer, pH 7.5,

10% glycerol (v ⁄ v) and 0.1 m NaCl were filtered through

a 0.02 lm membrane filter (Whatman� Anotop 10, Fisher

Scientific, Loughborough, UK) to remove dust particles.

However, it was found necessary to filter enzyme E3

through a 0.22 lm membrane filter (Millipore, Watford,

UK). DLS measurements were carried out at 25 �C or

55 �C. Mr values were derived from the measured hydro-

dynamic radii using the Protein Utilities feature of the

dispersion technology software, version 4.10, supplied

with the instrument.

Mass spectrometry

Determination of the E2 polypeptide mass

A 100 pmol sample of recombinant E2 was injected on to

a MassPrep on-line desalting cartridge (2.1 · 10 mm)

(Waters, Milford, MA), eluted with an increasing acetoni-

trile concentration [2 vol acetonitrile + 98 vol aqueous for-

mic acid (1%, v ⁄ v) to 98 vol acetonitrile + 2 vol aqueous

formic acid (1%, v ⁄ v)] and delivered to an electrospray ion-

ization mass spectrometer (LCT, Micromass, Manchester,

UK) that had previously been calibrated using myoglobin.

An envelope of multiply charged signals was obtained and

deconvoluted using maxent1 software to give the molecular

mass of the protein.

Mapping the lipoylation of E2

Recombinant E2 (50 pmol) was dialyzed against 50 mm

ammonium bicarbonate on a VS membrane disc (Millipore)

for 30 min. Sequencing grade, modified porcine trypsin

(Promega) (60 ng) was added and the sample incubated at

37 �C for 16 h. A portion of the sample was diluted in 5%

(v ⁄ v) formic acid and the peptides separated using an Ulti-

Mate nanoLC (LC Packings, Amsterdam, the Netherlands)

equipped with a PepMap C18 trap and column. The eluant

was sprayed into a Q-Star Pulsar XL tandem mass spec-

trometer (Applied Biosystems, Foster City, CA) and ana-

lyzed in Information Dependent Acquisition mode. The

MS ⁄MS data generated were analyzed using the Mascot

search engine (Matrix Science, London, UK), with lipoyla-

tion selected as a possible lysine modification. The MS ⁄MS

spectrum corresponding to the modified peptide was also

interpreted ‘manually’ using BioAnalyst (Applied Biosys-

tems) tools.

Acknowledgements

MJD and DWH thank the US Air Force Office of Sci-

entific Research (Arlington, VA, USA) for generous

financial support. CH and MGP gratefully acknowl-

edge the receipt of Postgraduate Studentships from the

UK Biotechnology and Biological Sciences Research

Council and from the University of Bath, respectively.

We thank Dr Jean van den Elsen (University of Bath,

UK) for allowing us to use the DLS Zetasizer Nano S,

and Dr Catherine Botting, BMS Mass Spectrometry

and Proteomics Facility, University of St Andrews,

UK, for carrying out the MS analyses.

References

1 Perham RN (1991) Domains, motifs, and linkers in

2-oxo acid dehydrogenase multienzyme complexes – a

paradigm in the design of a multifunctional protein.

Biochemistry 30, 8501–8512.

2 Perham RN (2000) Swinging arms and swinging

domains in multifunctional enzymes: catalytic machines

for multistep reactions. Ann Rev Biochem 69, 961–1004.

3 Perham RN, Jones DD, Chauhan HJ & Howard MJ

(2002) Substrate channelling in 2-oxo acid dehydrogenase

multienzyme complexes. Biochem Soc Trans 30, 47–51.

4 Izard T, Ævarsson A, Allen MD, Westphal AH, Per-

ham RN, de Kok A & Hol WGJ (1999) Principles of

quasi-equivalence and Euclidean geometry govern the

assembly of cubic and dodecahedral cores of pyruvate

dehydrogenase complexes. Proc Natl Acad Sci USA 96,

1240–1245.

5 Danson MJ, Lamble HJ & Hough DW (2007) Central

metabolism. In Archaea: Molecular and Cell Biology

(Cavicchioli R, ed.). Chapter 12, pp. 260–287. ASM

Press, Washington, DC.

6 Kerscher L & Oesterhelt D (1982) Pyruvate – ferredoxin

oxidoreductase: new findings on an ancient enzyme.

Trends Biochem Sci 7, 371–374.

7 Schut GJ, Menon AL & Adams MWW (2001) 2-Keto

acid oxidoreductases from Pyrococcus furiosus and

Thermococcus litoralis. Methods Enzymol 331, 144–158.

8 Ragsdale SW (2003) Pyruvate ferredoxin oxidoreductase

and its radical intermediate. Chem Rev 103, 2333–2346.



9 Plaga W, Lottspeich F & Oesterhelt D (1992) Improved

purification, crystallization and primary structure of

pyruvate: ferredoxin oxidoreductase from Halobacterium

halobium. Eur J Biochem 205, 391–397.

10 Danson MJ, Eisenthal R, Hall S, Kessell SR &

Williams DL (1984) Dihydrolipoamide dehydrogenase

from halophilic archaebacteria. Biochem J 218, 811–818.

11 Smith LD, Bungard SJ, Danson MJ & Hough DW

(1987) Dihydrolipoamide dehydrogenase from the ther-

moacidophilic archaebacterium Thermoplasma acidophi-

lum. Biochem Soc Trans 15, 1097–1097.

12 Pratt KJ, Carles C, Carne TJ, Danson MJ & Stevenson

KJ (1989) Detection of bacterial lipoic acid: a modified

gas chromatographic – mass spectrometric procedure.

Biochem J 258, 749–754.

13 Jolley KA, Maddocks DG, Gyles SL, Mullan Z,

Tang S-L, Dyall-Smith ML, Hough DW & Danson MJ

(2000) 2-Oxoacid dehydrogenase multienzyme complexes

in the halophilic Archaea? Gene sequences and protein

structural predictions. Microbiology 146, 1061–1069.

14 Heath C, Jeffries AC, Hough DW & Danson MJ (2004)

Discovery of the catalytic function of a putative 2-oxo-

acid dehydrogenase multienzyme complex in the ther-

mophilic archaeon Thermoplasma acidophilum. FEBS

Lett 577, 523–527.

15 Massey V (1960) Identity of diaphorase and lipoyl dehy-

drogenase. Biochim Biophys Acta 37, 314–322.

16 Mann S, Melero CP, Hawksley D & Leeper FJ (2004)

Inhibition of thiamin diphosphate dependent enzymes

by 3-deazathiamin diphosphate. Org Biomol Chem 2,

1732–1741.

17 Chauhan HJ, Domingo GJ, Jung HI & Perham RN

(2000) Sites of limited proteolysis in the pyruvate decar-

boxylase component of the pyruvate dehydrogenase

multienzyme complex of Bacillus stearothermophilus and

their role in catalysis. Eur J Biochem 267, 7158–7169.

18 Schuck P (1998) Sedimentation analysis of non-interact-

ing and self-associating solutes using numerical solu-

tions to the Lamm equation. Biophys J 75, 1503–1512.

19 Danson MJ, Hale G, Johnson P, Perham RN, Smith J

& Spragg P (1979) Molecular weight and symmetry of

the pyruvate dehydrogenase multienzyme complex of

Escherichia coli. J Mol Biol 129, 603–617.

20 Al-Mailem DM, Hough DW & Danson MJ (2007) The

2-oxoacid dehydrogenase complex from Haloferax vol-

canii. Extremophiles, doi: 10.1007/s00792-007-0091-0.

21 Miller JR, Busby RW, Jordan SW, Cheek J,

Henshaw TF, Ashley GW, Broderick JB, Cronan JE &

Marletta MA (2000) Escherichia coli LipA is a lipoyl

synthase: in vitro biosynthesis of lipoylated pyruvate

dehydrogenase complex from octanoyl-acyl carrier

protein. Biochemistry 39, 15166–15178.

22 Morris T, Reed K & Cronan J Jr (1995) Lipoic acid

metabolism in Escherichia coli: the lplA and lipB genes

define redundant pathways for ligation of lipoyl groups

to apoprotein. J Bacteriol 177, 1–10.

23 Wallis NG & Perham RN (1994) Structural dependence

of post-translational modification and reductive acetyla-

tion of the lipoyl domain of the pyruvate dehydrogenase

multienzyme complex. J Mol Biol 236, 209–216.

24 Ævarsson A, Seger K, Turley S, Sokatch JR & Hol WGJ

(1999) Crystal structure of 2-oxoisovalerate dehydroge-

nase and the architecture of 2-oxo acid dehydrogenase

multienzyme complexes. Nature Struct Biol 6, 785–792.

25 Pettit FH, Yeaman SJ & Reed LJ (1978) Purification

and characterisation of branched-chain a-ketoacid dehy-

drogenase complex of bovine kidney. Proc Natl Acad

Sci USA 75, 4881–4885.

26 Bates DL, Danson MJ, Hale G, Hooper EA &

Perham RN (1977) Self-assembly and catalytic activity

of the pyruvate dehydrogenase multienzyme complex of

Escherichia coli. Nature 268, 313–316.

27 Jolley KA, Rapaport E, Hough DW, Danson MJ,

Woods WG, Dyal I & Smith ML (1996) Dihydrolipoa-

mide dehydrogenase from the halophilic archaeon Halo-

ferax volcanii: homologous overexpression of the cloned

gene. J Bacteriol 178, 3044–3048.

28 Wanner C & Soppa J (2002) Functional role for a

2-oxo acid dehydrogenase in the halophilic archaeon

Haloferax volcanii. J Bacteriol 184, 3114–3121.

29 Sambrook J & Russell DW (2001) Molecular Cloning: A

Laboratory Manual, 3rd edn. Cold Spring. Harbour

Laboratory Press, Cold Spring Harbour, NY.

30 Laemmli UK (1970) Cleavage of structural proteins dur-

ing the assembly of the head of bacteriophage T4. Nat-

ure 227, 680–685.

31 Lessard IAD & Perham RN (1994) Expression in Esc-

herichia coli of genes encoding the E1a and E1b subun-

its of the pyruvate-dehydrogenase complex of Bacillus

stearothermophilus and assembly of a functional E1

Component (a2b2) in-vitro. J Biol Chem 269, 10378–

10383.

32 Domingo GJ, Chauhan HJ, Lessard IAD, Fuller C &

Perham RN (1999) Self-assembly and catalytic activity

of the pyruvate dehydrogenase multienzyme complex

from Bacillus stearothermophilus. Eur J Biochem 266,

1136–1146.

33 Eisenthal R & Cornish-Bowden A (1974) The direct

linear plot. A new graphical procedure for estimating

enzyme kinetic parameters. Biochem J 139, 715–720.

34 Schuck P (2000) Size distribution analysis of macromole-

cules by sedimentation velocity ultracentrifugation and

Lamm equation modeling. Biophys J 78, 1606–1619.



The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma...

Documents

Transcript of The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma...