Temperature relations of aerial and aquatic …cal changes in energy levels, thereby acting as a...

159

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051

© 2014 International Society of Zoological Sciences, Institute of Zoology/ Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd

Integrative Zoology 2015; 10: 159–170 doi: 10.1111/1749-4877.12107

ORIGINAL ARTICLE

Temperature relations of aerial and aquatic physiological performance in a mid-intertidal limpet Cellana toreuma: Adaptation to rapid changes in thermal stress during emersion

Xiongwei HUANG,1 Tifeng WANG, Ziwen YE,1 Guodong HAN1 and Yunwei DONG1,2

1State Key Laboratory of Marine Environmental Science, College of Marine and Earth Sciences, Xiamen University, Xiamen, China and 2Marine Biodiversity and Global Change Center, Xiamen University, Xiamen, China

AbstractThe physiological performance of a mid-intertidal limpet Cellana toreuma was determined to study the physi-ological adaptation of intertidal animals to rapid changes and extreme temperatures during emersion. The rela-tionship between the Arrhenius breakpoint temperature (ABT) and in situ operative body temperature was stud-ied to predict the possible impact of climate change on the species. The temperature coefficient (Q10) of emersed animals was higher than that of submersed animals and the ratio of aerial : aquatic heart rate rose with increas-ing temperature. The ABTs of submersed and emersed animals were 30.2 and 34.2°C, respectively. The heart rate and levels of molecular biomarkers (hsps, ampkα, ampkβ and sirt1 mRNA) were determined in 48 h simu-lated semi-diurnal tides. There were no obvious changes of heart rate and gene expression during the transition between emersion and submersion at room temperature, although expressions of hsp70 and hsp90 were induced significantly after thermal stress. These results indicate that C. toreuma can effectively utilize atmospheric ox-ygen, and the higher Q10 and ABT of emersed animals are adaptations to the rapid change and extreme thermal stress during emersion. However, the in situ operative body temperature frequently exceeds the aerial ABT of C. toreuma, indicating the occurrence of large-scale mortality of C. toreuma in summer, and this species should be sensitive to increasing temperature in the scenario of climate change.

Key words: climate change, intertidal, limpet, physiological adaptation, temperature

Correspondence: Yunwei Dong, State Key Laboratory of Marine Environmental Science, College of Marine and Earth Sciences, Xiamen University, Xiamen 361005, China.Email: [email protected]

INTRODUCTIONIntertidal animals have to deal with environmen-

tal conditions that range from fully submersed to fully terrestrial over vertical distances of a few meters (Mc-Mahon 1988; Helmuth et al. 2002; Harley & Helmuth 2003; Little et al. 2009). Because most intertidal mol-luscs are sessile or have limited mobility, they have to suffer the rapid changes of various environmental fac-

160

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


tors including extreme temperatures (McMahon 1988). Physiological adaptations to the highly variable abiot-ic factors play crucial roles in determining their intertid-al zonation (Wolcott 1973; Branch 1981; Garrity 1984; McMahon 1990; Little et al. 2009) and in determin-ing their future population dynamics in the scenario of climate change (Somero 2002; Pörtner & Knust 2007; Somero 2012). The aerial and aquatic thermal regimes for intertidal animals are dramatically different due to the tidal cycle. The change of temperature underwater is relatively benign; however, the change of temperature in air is rapid and extreme. Therefore, intertidal animals have to develop effective strategies to survive the differ-ent thermal regimes (Denny et al. 2011).

The ability of intertidal molluscs to utilize atmospher-ic oxygen has been studied for a long time (e.g. New-ell 1973; Bannister 1974; McMahon 1988; McMahon et al. 1991; Marshall & McQuaid 1992a). The physio-logical responses to extreme temperatures are different for intertidal molluscs inhabiting different tidal regions (Newell 1979; Little et al. 2009). Usually, the ratios of aerial and aquatic O2 consumption rates for high-inter-tidal molluscs are higher than those in mid-intertidal and low-intertidal animals, allowing them to cope with the longer air exposure in the high intertidal zone (McMahon & Russell-Hunter 1977; McMahon 1988). However, the trade-offs that intertidal molluscs make between aerobic and anaerobic metabolism during emersion and their re-lationship to desiccation stress are species-specific and not always clear (Marshall & McQuaid 1992a; Somero 2002).

Heart rate of intertidal molluscs is affected by vari-ous factors (Santini et al. 2000) and can be used to infer metabolic rate in gastropods (Santini et al. 1999). The aerial heart rate and oxygen consumption were linearly correlated for limpets Patella granularis and Siphonaria oculus (Marshall & McQuaid 1992b). The heart rates of emersed inactive animals were positively related to air temperature; however, there was no positive relationship between the heart rate of submersed limpets and wa-ter temperature (Santini et al. 2000). Extensive studies showed that the cardiac performances of intertidal gas-tropods are closely related to the animals’ vertical zona-tion (Chelazzi et al. 2001; Stenseng et al. 2005; Dong & Williams 2011).

The fine balance between stability and lability that correlated with adaptation temperatures in proteins is a strikingly consistent feature of protein evolution (Some-ro 1995). When the balance is broken, the denatured

proteins induce the upregulation of heat shock proteins (Hsps) (Parsell & Lindquist 1993; Feder & Hofmann 1999), and animals inhabiting different intertidal regions have different expression patterns of heat shock pro-tein against thermal stress (Tomanek & Somero 1999; Dong et al. 2008; Clark & Peck 2009a,b; Dong & Wil-liams 2011). The heat shock response is also an import-ant physiological limit in determining biogeographical range shifts in the scenario of climate change (Tomanek 2008; Somero 2012).

The energy allocation strategies are important for in-tertidal zonation (Marshall et al. 2011; Sokolova et al. 2012). AMP-activated protein kinase (AMPK) and his-tone/protein deacetylase Sirtuin1 (SIRT1) are fuel-sens-ing molecules (Ruderman et al. 2010). SIRT1 regulates fat and glucose metabolism in response to physiologi-cal changes in energy levels, thereby acting as a crucial regulator of the network that controls energy homeosta-sis (Cantó et al. 2009; Houtkooper et al. 2012). Because activation of AMPK and SIRT1 indicates the switching on of catabolic pathways and the switching off of ana-bolic pathways (Cantó et al. 2009), the upregulation of these 2 metabolic sensors also indicates that more ener-gy is being allocated to maintenance and less energy to growth, storage, and reproduction.

Limpets are common species of rocky intertidal communities from tropical to Polar Regions (Nakano & Ozawa 2007) and occupy different intertidal zones and microhabitats (Shotwell 1950; Haven 1973; Wol-cott 1973). Cellana toreuma is distributed widely on the coast of China from Liaoning Province to Hainan Island and occupies mid–low intertidal zones (Morton & Mor-ton 1983; Williams & Morritt 1995). The cardiac per-formance of C. toreuma is sensitive to ambient tempera-ture. In summer, when ambient temperature is always beyond the upper limit of cardiac performance, large-scale mortality of C. toreuma populations occurs (Wil-liams & Morritt 1995; Chelazzi et al. 2001; Dong & Williams 2011), especially in tidal pools (Firth & Wil-liams 2009). In the present study, the aerial and aquat-ic cardiac performances of C. toreuma were determined at different temperatures to investigate the physiologi-cal adaptations of this mid-intertidal gastropod to rap-id changes and extreme thermal stress. The cardiac per-formance and expression of biomarkers (Heat shock proteins, AMPK and SIRT1) were also determined in a simulated tidal cycle, to study the physiological adapta-tions to environmental conditions that changed from ful-ly submersed to fully terrestrial.

161

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051

limpet’s cardiac response to temperature

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051


MATERIALS AND METHODS

In situ temperature measurement

Robolimpets were used to measure the in situ body temperature of limpets (Lima & Wethey 2009). In this method, a bio-mimetic data logger consists of a mi-cro-logger inserted into the shell of a limpet from which soft tissues have been removed. In the present study, the operative body temperatures of limpets were estimat-ed using Robolimpets at a field site on Nanding Island, Fujian, China (24°09′N, 117°59′E). Three Robolimpets were deployed on a semi-wave-exposed shore in 2.0 m above chart datum (CD, the level of water that charted depths displayed on a nautical chart are measured from), in the range where C. toreuma is known to migrate ver-tically up and down the shore during a tidal cycle (Y. W. Dong and G. D. Han, unpubli. data). Operative tempera-ture recordings were made every 30 min, and the aeri-al and aquatic body temperatures were analyzed during both neap tides and spring tides (20 to 31 July 2012).

Animal sampling and maintenance

All C. toreuma were collected from Nanding Island in March 2012. After collection, the specimens were transported back to the State Key Laboratory of Ma-rine Environmental Science of Xiamen University, Xia-men. All limpets were acclimated on a ceramic tile that was used to mimic the natural rocky shore. The ceram-ic tile was scoured by seawater using a seawater pump in advance to stimulate growth of a bio-film. During the acclimation C. toreuma were sprayed using seawater (20°C) constantly and seawater was replaced daily.

Heart rate assays

The heart rate experiments were carried out by a non-invasive method that was developed by De-pledge and Andersen (1990) and modified by Chela-zzi et al. (1999). An infrared sensor was attached to the shell close to the heart of each individual with Blue-Tac (Bostik, UK). The heart rate signals were ampli-fied and transformed with Powerlab (4/30, ADInstru-ments, Dunedin, New Zealand) to a voltage waveform that could be converted into visual data with Chart (ver-sion 5.0).

The heart rate assays were carried out in 3 experi-ments to measure the heart rates of C. toreuma (body size, 1.8 ± 0.4 cm) in air, water, and a simulated tidal cy-cle, respectively. The aerial heart rate of C. toreuma was measured at 25, 30, 35 and 40°C (n = 4) as described previously (Dong & Williams 2011) with minor modi-

fications. After acclimation, animals were placed under a seawater spray (approximately 20°C, 30 psu) for 30 min to allow them to replenish mantle water lost during transfer, and then subjected to a simulated “emersion” period. Animals were placed into a beaker, which was immersed in a water bath, allowing the air temperature in the beaker to be increased from 20°C to designated temperatures in 2 h. After being maintained at the desig-nated temperature for 1 h, temperature was decreased to room temperature (18.3°C). Temperatures of the beaker and limpet body temperatures were recorded every min-ute using a thermometer (Fluke 54II, Fluke, WA, USA). Real-time heart rates were recorded every minute. The ABT, the temperature at which heart rate decreases sud-denly and which reflects the thermal limitation of C. to-reuma, was determined using regression analyses to generate the best-fit line on both sides of the putative break points (as described by Stillman & Somero 1996).

The aquatic heart rates of C. toreuma were measured at 25, 30, 35 and 40°C (n = 4) similar to the aerial heart rate measurements. After acclimation, animals were placed into beakers with aerated seawater (approximate-ly 20°C, 30 psu). The water temperature was increased to the designated temperatures over 2 h and then main-tained for 1 h. Real-time water temperatures and heart rates were recorded every minute. ABT was determined as above.

To determine the change of heart rate during a tid-al cycle, heart rates of limpets were recorded every min-ute in a simulated semi-diurnal tidal cycle for 48 h. The simulated tidal cycle system was composed of a pump, rock tile, a 1000-w lamp and a tank to control the water height and temperature. To adapt to the environmental conditions, 40 individuals were placed in the simulat-ed tidal cycle system for a week before heart rate mea-surement. In the first 24 h, a simulated semi-diurnal tid-al cycle in room temperature (17–20°C) was applied. In order to study the effect of thermal stress on physiologi-cal performance, air temperature was increased to 35°C, and then decreased to room temperature (Fig. 1). When limpets were submersed or emersed as shown in Fig. 1, 5 individuals were collected and stored at −80°C to measure gene expressions.

Heat-shock protein assay

Total RNA was isolated from approximately 50 mg of foot muscle using Trizol Reagent (Invitrogen, Carls-bad, CA, USA). The first strand of cDNA was synthe-sized using total RNA as a template. Reverse transcrip-tase (RT) reactions were performed using PrimeScript

162

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


RT reagent Kit with gDNA Eraser (TAKARA, Shiga, Japan). To obtain sequences of target genes from C. to-reuma, PCR was used to amplify partial sequences with degenerate primers (the sequences of primers used in this study are given in the supplementary material Table 1), and then the full-length cDNAs were obtained us-ing the rapid-amplification of cDNA ends (RACE) pro-tocol with a 3′-Full RACE Core Set and a 5′-Full RACE Kit (TAKARA, Shiga, Japan). A partial sequence of the β-actin gene was selected as a reference housekeeping gene to normalize the level of expression. The levels of hsp70, hsp90, ampkα, ampkβ and sirt1 expression were quantified using real-time quantitative PCR with prim-ers designed from the sequences obtained as described above (GenBank accession No. hsp70, JX69849; hsp90, JX69850; ampkα, JX69847; ampkβ, JX69848; sirt1, JX69851). PCR was carried out in an ABI 7500 Re-al-Time PCR System (Applied Biosystems, MA, USA ) in a 20-μL reaction volume containing 10 μL of 2×Fast-Start DNA Universal SYBR Green Master (Roche, Ger-many), 0.8 μL of each primer (10 nmol/μL), 1 μL of cDNA template and 7.4 μL of RNase-free water. The PCR conditions were as follows: 50°C, 2 min; 95°C, 10 min; 40 cycles of 95°C, 20 s; 59°C, 20 s; and 72°C for 40 s with a final dissociation curve step. All samples were measured in triplicate. Threshold cycle (Ct value), the intersection between an amplification curve and a threshold line, was analyzed using the ABI 7500 System Software (Applied Biosystems, MA, USA). The expres-sion of hsp70, hsp90, ampkα, ampkβ and sirt1 mRNA

for the various heat treatments was determined as the relative value of β-actin for experimental against control treatments.

Statistics

Data were analyzed using SPSS 15.0 (Chicago, USA). To compare the differences in ABTs among ae-rial and aquatic conditions, the Mann–Whitney U-test was implemented. The relationship between heart rate and temperature in the simulated tides was analyzed us-ing linear regression. To compare the differences in hsp70, hsp90, ampkα, ampkβ and sirt1 between differ-ent time points, one way ANOVA was carried out fol-lowed by Duncan’s posthoc pairwise comparisons. Dif-ferences were considered significant if P < 0.05.

Figure 1 Change of temperature and emersion/submersion in the simulated semi-diurnal tide. Arrows represent the time points for animal collections, and shaded areas show the peri-ods of being submersed.

Figure 2 (a) Continuous recording of operative body tempera-ture and (b) statistical results for Cellana toreuma. Body tem-perature was measured using Robolimpets that were deployed on the mid-intertidal shore in Nanding Island from 20 to July 30. The bars indicate the maximum and minimum tempera-tures. The lower and upper ends of the boxes represent the 25 and 75% percentiles, respectively. ‘+’ represents the mean val-ue.

163

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051


RESULTS

In situ operative body temperatures of Robolimpets

From 20 to 31 July 2012, the operative body tempera-tures of Robolimpets in the mid-intertidal zone changed dramatically in relation to the tidal cycle (Fig. 2). Com-pared to the body temperatures of submersed animals, body temperatures of emersed animals were more vari-able, and the thermal regimes in air and underwater were very different.

In water, the body temperature ranged from 24.79 to 28.19°C (mean ± SD, 26.19 ± 0.75°C), and the 25 and 75% percentiles were 25.76 and 26.73°C, respective-ly. The median was 25.76°C, and the coefficient of vari-ance (CV) was 2.86%.

In air, the body temperature ranged from 23.82 to 48.11°C (mean ± SD, 32.41 ± 6.47°C), and the 25 and

75% percentiles were 27.70 and 36.45°C, respectively. The median was 30.62°C, and CV was 19.98%.

Heart rates of limpets in air and water

The heart rates of both submersed and emersed C. to-reuma were sensitive to ambient temperature (Figs 3 and 4). In water, heart rates increased with increasing temperature from 20 to 30°C. However, heart rate de-creased when temperature was over 30°C. The ABT of heart rate in water was 30.2°C (Fig. 5). In air, heart rates also increased with increasing temperature, but the ABT of heart rate in air (34.2°C) was significantly higher than that in water (Mann–Whitney U-test, P = 0.037).

The ratios of aerial to aquatic heart rates were tem-perature-dependent, and increased with increasing tem-perature. The ratios were 1.00, 1.40 and 1.72 at 25, 30 and 35°C, respectively. The temperature coefficients (Q10) in the temperature range from 20 to 30°C were 1.56 and 2.19 in water and air, respectively.

Figure 3 The heart rates of Cellana toreuma submersed at different temperatures (mean ± SD for n = 4). The dashed line represents water temperature.

164

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


Figure 4 The heart rates of Cellana toreuma emersed at different temperatures (mean ± SD for n = 4). The dashed line represents air temperature.

Table 1 Primers used for real-time polymerase chain reaction amplification

Primer Sequence Objectives SourcesqACTINF GAAGGATGGCTGGAACAA Real-time primer for β-actin Self-designqACTINR CCGAGACATCAAGGAGAAGqAMPKαF CGATTGTAGATGTAGATGTTGT Real-time primer for ampkα Self-designqAMPKαR GCCATTCTCTGATTGTCTATqAMPKβF AATGTGAATAGTGAACCGATA Real-time primer for ampkβ Self-designqAMPKβR AGCATAACAGCAGAACTCqHSP70F AATATAAGGAAGAGGACGAGAG Real-time primer for hsp70 Self-designqHSP70R TATCAGCCAGAGCATTAGCqSIRT1F GCTGCTGATAAGGATGAG Real-time primer for sirt1 Self-designqSIRT1R TACATTGGCTGGAAGAGAqHSP90F ATGATCGGTCAGTTTGGTGT Real-time primer for hsp90 Self-designqHSP90R AGTTGGGTTGGTCAGGTGT

165

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051


Figure 5 Arrhenius breakpoint temperatures (ABT) of heart rates for representative individuals (a) submersed and (b) emersed. The ABT of heart rate of emersed animals (34.2°C) was significantly higher than those submersed (30.2°C).

Figure 6 Variations of heart rates of Cellana toreuma in sim-ulated semi-diurnal tides. Temperature was controlled at ap-proximately 20°C in the first day and increased from 20 to 35°C in 2 h and maintained at 35°C for 1 h at the second day. Solid arrows show transitions between emersed and sub-mersed. The shaded areas show the periods of being sub-mersed.

Figure 7 The relationship between temperature and (a) to-tal heart rate, (b) heart rate of submersed animals and (c) heart rate of emersed animals in the simulated tide.

Physiological adaptations of limpets in simulated tides

Animals were submersed and emersed periodically in the simulated tide, and the heart rates were relative-ly stable at room temperature. During the entire experi-mental period, heart rates closely depended on tempera-ture. When temperature increased from approximately 20 to 35°C, heart rates increased from 75 beats/min to

166

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


220 beats/min. Generally, linear relationships existed between temperature and heart rates (Fig. 7). The slopes of the regressions of total heart rate, heart rate in water and heart rate in air were 7.63 (R2 = 0.80), 4.567 (R2 = 0.301) and 7.63 (R2 = 0.807), respectively.

The levels of hsp70 and hsp90 mRNA were relative-ly stable in transitions between submersion and emer-sion (Fig. 8). However, thermal stress induced the up-regulation of hsps significantly (1-way ANOVA, F(7, 34) = 6.715; P < 0.001 for hsp70; F(7, 34) = 6.715, P = 0.032 for hsp90).

The levels of ampkα, ampkβ and sirt1 were also sta-ble in the transitions between submersion and emer-sion at all time points (Fig. 9). One-way ANOVA results showed there were not significant differences in gene

Figure 8 Expression of (a) hsp70 and (b) hsp90 of Cellana to-reuma at the time points in the transition between submersed/emersed as shown in Figure 1. Values with different letters are significantly different (P < 0.05) among different time points.

Figure 9 Expression of (a) ampkα, (b) ampkβ and (c) sirt1 of Cellana toreuma at the time points in the transition between submersed/emersed as shown in Fig. 1. There were no signifi-cant differences (P > 0.05) among different time points.

levels among different time points (F(7, 36) = 0.570; P = 0.775 for ampkα; F(7, 34) = 0.857; P = 0.552 for ampkβ; F(7, 36) = 0.927; P = 0.501 for sirt1).

167

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051


DISCUSSIONThe pattern of cardiac performance in relation to tem-

perature is an adaptive physiological response to the ambient thermal regime in the habitat. In the intertid-al zone, animals experience daily transition from sub-mersion to emersion, and then have to adapt to the dif-ferent thermal regimes in air or in water. The percent emersion time of intertidal molluscs varies in relation to zonation and the percentage of emersion time in mid-in-tertidal zone is from 14 to 86% (Newell 1979), with dif-ferences in the coastlines of different continents (Finke et al. 2007). In the present study, C. toreuma is a typical mid-intertidal species and is exposed to air twice dai-ly due to the semi-diurnal tide at the study site (Nanding Island in East China Sea). From 22 to 30 July 2012, the air exposure percentage of Robolimpets, which were de-ployed in the distribution zone of the live animals, was 41.6%. In addition to the change of emersion and sub-mersion, the thermal regimes in air and in water were dramatically different. Based on our 1-year-round ob-servation of operative body temperatures, July was the hottest season in 2012 at the study site. In air, the max-imum temperature in the mid-intertidal zone was over 48°C, and the temperature increased from approximate-ly 26 to 48°C with a rate of >4°C·h−1. However, the temperature was relatively stable in water and there was no large daily variation. Therefore, limpets experienced rapid changes and extremes of thermal stress during emersion.

The different patterns of aerial and aquatic cardiac performances in relation to temperature are adaptive re-sponses to the ambient environmental conditions. The respiratory response to emersion is related to the dura-tion of aerial exposure. In the present study, the ratio of the aerial : aquatic heart rate was 1:1 at 25°C, and the ratio was similar to the ratio of the aerial : aquatic oxy-gen consumption rate for most mid-intertidal gastropods (McMahon 1988). When temperature increased, the ra-tios of the aerial : aquatic heart rate kept increasing from 20 to 30°C resulting from the fast enhancement of aerial heart rate (aerial Q10, 2.19; aquatic Q10, 1.56). This result can also explain previous contrasting results about the oxygen consumption between emersed and submersed limpets (Santini et al. 2000) because the ratio of the ae-rial : aquatic heart rate is temperature-dependent in this intertidal limpet.

Animals emersed can tolerate higher temperatures than those submersed in the present study. The upper thermal limits in emersed and submersed limpet are dif-

ferent, and the emersed limpets showed higher ABT (34.2°C) than the submersed animals (30.2°C). When heated to 40°C, 50% of submersed animals died, and all emersed animals survived. As mentioned above, the air temperature in the mid-intertidal zone could frequently exceed 40°C and was much higher than water tempera-ture in summer. The differences in ABTs and upper lim-its should be an adaptation to the rapid changes and high air temperatures, and are crucial for the limpet against the high air temperature. This result can also partly ex-plain the high mortality of C. toreuma in tidal pools in summer observed by Firth and Williams (2009) and our personal observations.

The recovery of heart rates after thermal stress be-tween submersed and emersed limpets showed similar patterns (Figs 4 and 5). The heart rates returned to the original levels when temperature decreased to the room temperature. These results indicated that submersed and emersed limpets could efficiently use both dissolved ox-ygen and atmospheric oxygen, respectively. In air, the gastropod adaptations to emersion are reduction of the ctenidium surface area and formation of a mantle cavity lung (McMahon 1988). In the present study, there was no obvious increase of heart rate during recovery from thermal stress (Figs 3–7), indicating the absence of an-aerobic metabolism during thermal stress and repayment of oxygen debt during recovery. However, these results about oxygen debt need be confirmed in further studies.

In the simulated tidal cycle, the heart rates were rel-atively stable and temperature-dependent. However, no significant relationship between heart rate and tem-perature was found in submersed limpets, probably due to the narrow thermal range of the water (Santini et al. 2000). Limpets become active when they are sub-mersed. The change in behavior can affect the relation-ship between heart rate and temperature because active limpets have higher heart rates than those of resting an-imals (Santini et al. 2000). During the transitions be-tween emersion and submersion, there was no obvious change of heart rate at room temperature, and this fur-ther confirms that the ratio of the aerial : aquatic heart rate is approximately 1 at room temperature (approxi-mately 20°C), and that C. toreuma can effectively use atmospheric oxygen as an adaptation to the mid-intertid-al habitat.

Desiccation can induce the upregulation of hsps in various organisms (reviewed in Feder & Hofmann 1999; Sørensen et al. 2003). In the present study, however, ae-rial exposure to room temperature did not induce the up-regulation of heat shock proteins in C. toreuma during

168

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


the simulated tidal cycle except 6 h after thermal stress. The levels of ampkα, ampkβ and sirt1 during the tid-al cycle were also relatively stable, even after thermal stress. The low levels of the 3 metabolic sensors after thermal stress could be because the temperature of 35°C is beyond the thermal window of gene expression (Han et al. 2013). Overall, the patterns of molecular mark-ers indicate that there is no obvious protein damage and change of ratio of ADP/ATP during transitions from emersion and submergence at room temperature. How-ever, high temperature can lead to protein denaturation in the species, and the upregulation of hsps at time “G” in Figure 8 is similar to our previous observations (Dong et al. 2008; Dong & Williams 2011).

In summary, the mid-intertidal limpet C. toreuma has different physiological adaptive strategies to aeri-al and aquatic thermal regimes. Compared to that of the submersed animals, the higher temperature coefficient (Q10), higher ABT of emersed animals and increasing ratio of aerial : aquatic heart rates with increasing tem-perature indicate that this species can effectively utilize atmospheric oxygen, and the species is adapted to the rapid change and extreme thermal stress in air. Howev-er, the in situ operative body temperature frequently ex-ceeds the aerial ABT of C. toreuma, providing an expla-nation for the occurrence of large-scale mortality of C. toreuma in summer. In the scenario of climate change, this species will be sensitive to increasing temperature, and local extinction could possibly occur on subtropical shores.

ACKNOWLEDGMENTSThis work was supported by grants from Nature Sci-

ence funds for Distinguished Young Scholars of Fuji-an Province, China (2011J06017), National Natural Sci-ence Foundation of China (41076083, 41276126), the Fundamental Research Funds for the Central Universi-ties and the Program for New Century Excellent Talents in University of Fujian Province. We thank Dr Colin Little for constructive discussions and help with prepa-ration of the manuscript. The authors appreciated the work of Ms. Meidan Zheng in measuring heart rates.

REFERENCESBannister JV (1974). The respiration in air and in water

of the limpets Patella caerulea (L.) and Patella lu-sitanica (Gmelin). Biochemistry and Physiology Part A: Physiology 49, 407–11.

Branch GM (1981). The biology of limpets: Physi-cal factors, energy flow, and ecological interactions. Oceanography and Marine Biology: An Annual Re-view 19, 235–380.

Cantó C, Gerhart-Hines Z, Feige JN et al. (2009). AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 458, 1056–60.

Chelazzi G, Williams GA, Gray DR (1999). Field and laboratory measurement of heart rate in a tropical limpet, Cellana grata. Journal of the Marine Biologi-cal Association of the UK 79, 749–51.

Chelazzi G, De Pirro M, Williams GA (2001). Cardiac responses to abiotic factors in two tropical limpets, occurring at different levels of the shore. Marine Bi-ology 139, 1079–85.

Clark MS, Peck LS (2009a). HSP70 heat shock proteins and environmental stress in Antarctic marine organ-isms: A mini-review. Marine Genomics 2, 11–8.

Clark MS, Peck LS (2009b). Triggers of the HSP70 stress response: Environmental responses and labora-tory manipulation in an Antarctic marine invertebrate (Nacella concinna). Cell Stress and Chaperones 14, 649–60.

Denny MW, Dowd W, Bilir L, Mach KJ (2011). Spread-ing the risk: Small-scale body temperature variation among intertidal organisms and its implications for species persistence. Journal of Experimental Marine Biology and Ecology 400, 175–90.

Depledge MH, Andersen BB (1990). A computer-aid-ed physiological monitoring system for continuous, long-term recording of cardiac activity in selected in-vertebrates. Comparative Biochemistry and Physiolo-gy Part A: Physiology 96, 473–7.

Dong YW, Miller LP, Sanders JG, Somero GN (2008). Heat-shock protein 70 (Hsp70) expression in four limpets of the genus Lottia: Interspecific variation in constitutive and inducible synthesis correlates with in situ exposure to heat stress. The Biological Bulletin 215, 173–81.

Dong YW, Williams GA (2011) Variations in cardi-ac performance and heat shock protein expression to thermal stress in two differently zoned limpets on a tropical rocky shore. Marine Biology 158, 1223–31.

Feder ME, Hofmann GE (1999). Heat-shock proteins, molecular chaperones, and the stress response: evolu-tionary and ecological physiology. Annual Review of Physiology 61, 243–82.

169

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051


Finke GR, Navarrete SA, Bozinovic F (2007). Tidal re-gimes of temperate coasts and their influences on ae-rial exposure for intertidal organisms. Marine Ecolo-gy Progress Series 343, 57–62.

Firth LB, Williams GA (2009). The influence of multi-ple environmental stressors on the limpet Cellana to-reuma during the summer monsoon season in Hong Kong. Journal of Experimental Marine Biology and Ecology 375, 70–5.

Garrity SD (1984). Some adaptations of gastropods to physical stress on a tropical rocky shore. Ecology 65, 559–74.

Han GD, Zhang S, Marshall DJ, Ke CH, Dong YW (2013). Metabolic energy sensors (AMPK and SIRT1), protein carbonylation and cardiac failure as biomarkers of thermal stress in an intertidal limpet: Linking energetic allocation with environmental tem-perature during aerial emersion. The Journal of Ex-perimental Biology 216, 3273–82.

Harley CD, Helmuth BS (2003). Local-and region-al-scale effects of wave exposure, thermal stress, and absolute versus effective shore level on patterns of intertidal zonation. Limnology and Oceanography 48, 1498–508.

Haven SB (1973). Competition for food between the in-tertidal gastropods Acmaea scabra and Acmaea digi-talis. Ecology 54, 143–51.

Helmuth B, Harley CDG, Halpin PM, O’Donnell M, Hofmann GE, Blanchette CA (2002). Climate change and latitudinal patterns of intertidal thermal stress. Science 298, 1015–7.

Houtkooper RH, Pirinen E, Auwerx J (2012). Sirtuins as regulators of metabolism and healthspan. Nature Re-views Molecular Cell Biology 13, 225–38.

Lima FP, Wethey DS (2009). Robolimpets: measur-ing intertidal body temperatures using biomimetic loggers. Limnology and Oceanography: Methods 7, 347–53.

Little C, Williams GA, Trowbridge CD (2009). The Bi-ology of Rocky Shore (Biology of Habitats). Oxford University Press, NY.

Marshall DJ, Dong YW, McQuaid CD, Williams GA (2011). Thermal adaptation in the intertidal snail Echinolittorina malaccana contradicts current theory by revealing the crucial roles of resting metabolism. Journal of Experimental Biology 214, 3649–57.

Marshall DJ, McQuaid CD (1992a). Comparative aerial metabolism and water relations of the intertidal lim-

pets Patella granularis L. (Mollusca: Prosobranchia) and Siphonaria oculus Kr. (Mollusca: Pulmonata). Physiological Zoology 65, 1040–56.

Marshall DJ, McQuaid CD (1992b). Relationship be-tween heart rate and oxygen consumption in the in-tertidal limpets Patella granularis and Siphonaria oc-ulus. Comparative Biochemistry and Physiology Part A: Physiology 103, 297–300.

McMahon BR, Burggren WW, Pinder AW, Wheatly MG (1991). Air exposure and physiological compensation in a tropical intertidal chiton, Chiton stokesii (Mol-lusca: Polyplacophora). Physiological Zoology 64, 728–47.

McMahon RF (1988). Respiratory response to periodic emergence in intertidal molluscs. American Zoologist 28, 97–114.

McMahon RF (1990). Thermal tolerance, evaporative water loss, air-water oxygen consumption and zona-tion of intertidal prosobranchs: A new synthesis. Hy-drobiologia 193, 241–60.

McMahon RF, Russell-Hunter WD (1977). Temperature relations of aerial and aquatic respiration in six litto-ral snails in relation to their vertical zonation. The Bi-ological Bulletin 152, 182–98.

Morton BS, Morton JE (1983). The Seashore Ecology of Hong Kong. Hong Kong University Press, HK.

Nakano T, Ozawa T (2007). Worldwide phylogeography of limpets of the order Patellogastropoda: Molecular, morphological and palaeontological evidence. Jour-nal of Molluscan Studies 73, 79–99.

Newell RC (1973). Factors affecting the respiration of intertidal invertebrates. American Zoologist 13, 513–28.

Newell RC (1979). Biology of Intertidal Animals, 3rd edn. Marine Ecological Surveys, Faversham.

Parsell DA, Lindquist S (1993). The function of heat-shock proteins in stress tolerance: Degradation and reactivation of damaged proteins. Annual Review of Genetics 27, 437–96.

Pörtner HO, Knust R (2007). Climate change affects marine fishes through the oxygen limitation of ther-mal tolerance. Science 315, 95–7.

Ruderman NB, Julia Xu X, Nelson L et al. (2010). AMPK and SIRT1: A long-standing partnership? American Journal of Physiology, Endocrinology and Metabolism 298, 751–60.

Santini G, Pirro MD, Chelazzi G (1999). In situ and lab-oratory assessment of heart rate in a Mediterranean

170

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051

X. Huang et al.

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051


limpet using a noninvasive technique. Physiological and Biochemical Zoology 72, 198–204.

Santini G, Williams GA, Chelazzi G (2000). Assess-ment of factors affecting heart rate of the limpet Pa-tella vulgata on the natural shore. Marine Biology 137, 291–6.

Shotwell JA (1950). The vertical zonation of Acmaea, the limpet. Ecology 31, 647–9.

Sokolova IM, Frederich M, Bagwe R, Lannig G, Sukho-tin AA (2012). Energy homeostasis as an integrative tool for assessing limits of environmental stress toler-ance in aquatic invertebrates. Marine Environmental Research 79, 1–15.

Somero GN (1995). Proteins and temperature. Annual Review of Physiology 57, 43–68.

Somero GN (2002). Thermal physiology and vertical zonation of intertidal animals: Optima, limits, and costs of living. Integrative and Comparative Biology 42, 780–9.

Somero GN (2012). The physiology of global change: Linking patterns to mechanisms. Annual Review of Marine Science 4, 39–61.

Stenseng E, Braby CE, Somero GN (2005). Evolution-ary and acclimation-induced variation in the thermal limits of heart function in congeneric marine snails (Genus Tegula): Implications for vertical zonation. The Biological Bulletin 208, 138–44.

Stillman JH, Somero GN (1996). Adaptation to tem-perature stress and aerial exposure in congeneric spe-cies of intertidal porcelain crabs (genus Petrolisthes): Correlation of physiology, biochemistry and mor-phology with vertical distribution. The Journal of Ex-perimental Biology 199, 1845–55.

Sørensen JG, Kristensen TN, Loeschcke V (2003). The evolutionary and ecological role of heat shock pro-teins. Ecology Letters 6, 1025–37.

Tomanek L (2008). The importance of physiological limits in determining biogeographical range shifts due to global climate change: The heat-shock re-sponse. Physiological and Biochemical Zoology 81, 709–17.

Tomanek L, Somero GN (1999). Evolutionary and accli-mation-induced variation in the heat-shock respons-es of congeneric marine snails (genus Tegula) from different thermal habitats: Implications for limits of thermotolerance and biogeography. Journal of Exper-imental Biology 202, 2925–36.

Williams GA, Morritt D (1995). Habitat partitioning and thermal tolerance in a tropical limpet, Cellana grata. Marine Ecology Progress Series 124, 89–103.

Wolcott TG (1973). Physiological ecology and intertidal zonation in limpets (Acmaea): A critical look at “lim-iting factors.” The Biological Bulletin 145, 389–422.

Huang X, Wang T, Ye Z, Han G, Dong Y (2015). Temperature relations of aerial and aquatic physiological perfor-mance in a mid-intertidal limpet Cellana toreuma: Adaptation to rapid changes in thermal stress during emer-sion. Integrative Zoology 10, 159–70.

Cite this article as:

Temperature relations of aerial and aquatic …cal changes in energy levels, thereby acting as a...

Documents

Transcript of Temperature relations of aerial and aquatic …cal changes in energy levels, thereby acting as a...