Taurine postponed the replicative senescence of rat bonemarrow-derived multipotent stromal cells in vitro

HuiJiao Ji • GuiYun Zhao • JingFeng Luo •

XiaoLi Zhao • Ming Zhang

Received: 8 September 2011 / Accepted: 3 April 2012 / Published online: 25 April 2012

� Springer Science+Business Media, LLC. 2012

Abstract The aging of many mammalian tissues is

associated with replicative decline in somatic stem cells.

Postponing this decline is a direct way of anti-aging. Bone

marrow-derived multipotent stromal cells (BMSCs) hold

promise for an increasing list of therapeutic uses due to

their multilineage potential. Clinical application of BMSCs

requires abundant cells that can be overcome by ex vivo

expansion of cells, but often facing the replicative senes-

cence problem. We demonstrated that taurine exhibited

anti-replicative senescence effect on rat BMSCs by pro-

moting colony forming unit-fibroblast formation and cell

proliferation, shortening cell population doubling time,

enormously inhibiting senescence-associated beta-galacto-

sidase activity and slowing the loss of differentiation

potential, while having no significant effect on the maxi-

mum passage number and total culture time, and slight

influences on the cell surface CD molecules expressions.

Taurine is a quite safe antioxidant and nutrient extensively

used in food addition and clinical treatment. These sug-

gested that taurine is a promising anti-replicative senes-

cence additive for ex vivo expansion of BMSCs in

experimental and clinical cell therapies.

Keywords Bone marrow stromal cells � Taurine �Proliferation � Osteogenic differentiation �Replicative senescence

Introduction

The regenerative potential of our body decreases upon

aging. There is a general agreement that the phenomenon

of in vitro replicative senescence can recapitulate the

organism’s aging, and for this reason, many studies have

tried to understand the causes of cellular senescence and

the changes of cells undergoing senescence in vitro [1, 2].

In accordance with the multiple roles of bone marrow-

derived multipotent stromal cells (BMSCs) in the physi-

ology of an organism, senescence of these cells can have

profound consequences on the body physiology. Clinically,

BMSCs have been applied in the treatment of fracture

nonunion, and would be applied in many other cell thera-

pies because of their ease of isolation, expansion, and

multi-lineage differentiation potential. BMSCs represent a

rare population in tissues. Therefore, it is essential to grow

BMSCs in vitro before putting them into therapeutic use.

This is compromised by replicative senescence, expending

the proliferation activity and differentiation potential of

BMSCs. To obtain more qualified BMSCs and maximize

their clinical potential, we are trying to find a direct and

effective way of postponing the in vitro replicative senes-

cence of BMSCs.

Taurine (2-aminoethanesulfonic acid) is a simple sulfur-

containing amino acid present in virtually all cells

throughout the animal kingdom, and required for the

development and survival of mammalian cells, being the

most abundant single amino acid in leukocytes [3–5]. As a

cellular redox-controlling molecule, taurine protect the

molecular constituents of cells against reactive species

(SP)-induced damages [6]. For example, mitochondrial and

nuclear DNA are continuously and chemically damaged by

both endogenous and exogenous RS, which contributes to

degenerative processes such as aging and cancer [7].

H. Ji � G. Zhao � J. Luo � X. Zhao � M. Zhang (&)

College of Life Science, ZheJiang University, ZiJinGang

Campus, Room 325, Hangzhou 310058, China

e-mail: zhangming201201@126.com

123

Mol Cell Biochem (2012) 366:259–267

DOI 10.1007/s11010-012-1304-0

Taurine also protects the lung from ozone, bleomycin,

nitrogen dioxide, and amiodarone induced injury [8–11]. In

the central nervous system, taurine is implicated in two

major phenomena: cell volume regulation [12] and inhib-

itory neuromodulation or neurotransmission [13, 14].

Taurine and its derivatives have been tested as potential

pharmaceutical agents in many pathological states [15].

Although the properties of taurine are not totally explored

so far, its bio-safety is affirmatory. Most cells in vertebrate

species contain high amounts of taurine often in 100 mg/l

concentrations. In human plasma the concentration of

taurine is 5–20 mg/l. The addition of 100–2,000 mg/l

taurine afforded virtually complete protection, in terms of

both cell viability and of cell swelling [16]. Another study

showed that the maximal effect of taurine on neural pro-

genitor cell proliferation was at 1,000 mg/l, though a sig-

nificant increase was observed already at 100 mg/l [17].

Therefore, 100 mg/l concentrations were chose to be the

observing scope. In this study, we have assessed the role of

taurine in postponing the in vitro replicative senescence of

BMSCs by investigating its effect on CFU-F formation,

proliferation and markers expressions of senescence,

stemness, and differentiation potential of rat BMSCs.

Materials and methods

Cell culture

The BMSCs were obtained from adult male rats (8 weeks

old). In brief, the rats were anesthetized by Ether. Tibia and

femur were dissected and cut off by both ends. Bone marrow

rinsed out from tibia and femur were centrifuged at 900 g for

10 min. Cells collected were incubated at a density of

5 9 105 nucleated cells/cm2 in a-MEM (Sigma, St. Louis,

Missouri) supplemented with 15 % fetal bovine serum (FBS,

SiJiQing, HangZhou, China) and penicillin/streptomycin

(200 U/ml, Sangon, China) at 37 �C in a 5 % CO2 humidi-

fied incubator. Culture medium was replaced every 3 days.

When grown to 80 % confluence, cells were harvested by

incubating with 0.05 % trypsin and 0.02 % EDTA (Gibco,

Karlsruhe, Germany) for 3 min, and counted to record the

growth status of rat BMSCs. Then, cells were seeded on petri

dishes at a density of 1 9 104/cm2 under the same culture

condition for expansion. To compare the growth features of

cells treated with or without taurine, BMSCs of three donors

were examined under the same condition by certain operator.

Assessment of CFU-F formation and proliferation

of BMSCs

To determine whether taurine (Sangon, China) can affect

the CFU-F formation, BMSCs were treated with 0, 50, 100

or 200 mg/l taurine since primary seeding. After cultured

for 7 days, the numbers of CFU-F were statistic under

microscope. By definition, a colony must have a minimum

of 50 cells to be enumerated. Then, cells were harvested

and counted with CBC board.

For the assessment of cell proliferation, BMSCs of early

passage were seeded into 96-well plates at a density of

6 9 103/cm2 and treated with 0, 50, 100 or 200 mg/l tau-

rine. Three days later, medium were removed, and MTT

dye solution (20 ll, 5 g/l, Sangon, China) was added to

each well. After 4 h incubation, the supernatant was

removed and 100 ll DMSO was added into each well for

fully solution. The optical density of each well was mea-

sured on a microplate spectrophotometer (TECAN, Swit-

zerland) at a wavelength of 570 nm. Each control or

experimental group was set up in 5 replicates.

To determine the cell population doubling time, BMSCs

were treated with 100 mg/l taurine since primary culture.

At time (t1), 3 9 104 cells were plated in a 60 mm dish.

This was the initial number of cells (N1). Then at time (t2)

we counted the cells (N2) and determined the Td by using

the formula:

Td ¼ t2 � t1ð Þ � log 2ð Þlog n2=n1ð Þ :

Senescence-associated beta-galactosidase (SA-b-Gal)

staining and quantification

In brief, BMSCs were treated with 100 mg/l taurine since

primary culture. Cells were washed in PBS, fixed in 0.5 %

glutaraldehyde for 10 min, and then incubated in b-gal

stain solution (Senescence b-galactosidase Staining Kit,

Beyotime) overnight. Representative images were taken

with inverted microscope and analyzed using Image Pro

Plus software (Medium Cybernetics Inc., MD).

Flow cytometry analysis

In the cytometric analysis, cells were prepared as follow-

ing: (1) Passage 3 in regular medium, (2) Passage 10 in

regular medium, (3) Passage 10 in 100 mg/l Taurine-added

medium. For the determination of cell surface cluster of

differentiation (CD) molecules, the cell suspension was

pre-incubated in PBS/1 % BSA for 30 min on ice with

regular mixing for blocking. After being washed twice,

cells were labeled respectively with antibodies of CD31,

CD44, CD45, CD73, CD90, and CD105 (CD31, CD44,

CD45, CD90: FITC-conjugated mouse anti-rat monoclonal

antibody, respectively clone 3A12, OX-50O, X1 and OX7,

Antigenix America; CD73: mouse anti-rat monoclonal

antibody, clone 5F/B9, BD Pharmingen; CD105: mouse

anti-human monoclonal antibody, clone P3D1, Millipore)

260 Mol Cell Biochem (2012) 366:259–267

123

and suspended in desired volumes. These cell suspensions

were used for flow cytometry analysis. Expression of

markers was assessed by using a flow cytometer system

(Cytometics FC 500, Beckman Counter).

Alkaline phosphatase (ALP) staining

In 24-well plate, cells were washed with PBS and fixed

with 10 % formalin for 5 min and washed with deionized

water, then incubated with fresh equipped 400 ll reagent

(ALP staining Kit, Sigma) per well for 30 min in 37 �C

incubator. After washed with deionized water, the cells

were observed using reverse phase contrast microscopy and

photographed.

Von Kassa staining

To assess the mineral deposition level, cells were fixed as

previous description, then incubated with 300 ll of 5 %

silver nitrate (Sigma, St. Louis, Missouri) under sunlight

illumination. 30 min later, the silver nitrate was removed,

and 300 ll of 5 % sodium thiophosphate (Sigma, St. Louis,

Missouri) was added for 5 min. The cells were photo-

graphed for image analysis using Image Pro Plus software

(Medium Cybernetics Inc., MD).

RNA purification and real-time RT-PCR

Total RNA was extracted from P10 BMSCs treated with

100 mg/l taurine since primary culture and osteogenic

induction for 2 weeks, using TRIzol reagent (Sigma)

according to the single step acid-phenol guanidinium

extraction method. Aliquots of the extracted RNA samples

were reversely transcribed for first strand cDNA synthesis

by AMV reverse transcriptase (Invitrogen, Carlsbad, CA).

Real-time quantitative PCR was performed (29TaqMan

Universal PCR Master Mix, 209TaqMan Gene Expres-

sion Kits, ABI) and analyzed with 7000 SDS v1.0 soft-

ware. Primer sequences of the genes to be detected were

listed in Table 1. The enthesis of the baseline was finely

adjusted according to the conditions. b-actin was ampli-

fied to serve as an internal control to normalize the PCR

efficiency.

Statistical analysis

Statistical analysis was performed using SPSS 12.0 soft-

ware. Statistical differences between controls and treated

samples were determined with the Chi-square (v2) test.

p values less than 0.05 were considered significant.

Result

Taurine promoted CFU-F formation and proliferation

of BMSCs

In the primary culture of BMSCs, a selected part of the raw

unpurified bone marrow cells adhered in a colony mor-

phology. These adherent cells were heterogeneous groups

and their homogeneity would reach 95 % and 98 %,

respectively, in passage 1 and 2. Taurine treatment increased

the CFU-F forming efficiency significantly in a dose

dependant manner (Fig. 1a). A coincident remarkable

increase was found in the amount of total adherent cells

under the same conditions (Fig. 1b). The average cell

amount per clone was not significantly changed (Fig. 1c),

Suggesting that the main effect of taurine on primary BMSCs

was promoting monocyte adherence and CFU-F formation.

The proliferation activity of passage cells assayed by

MTT test was increased by taurine treatment too (Fig. 1d).

In 50 mg/l group, the proliferation activity was increased

slightly with no statistical difference. In 100 and 200 mg/l

groups, the cell proliferation activities were significantly

increased. During in vitro passage, the doubling time (DT)

of BMSCs population progressively increased (Fig. 2a). P3

BMSCs had a short DT (1.80 ± 0.29 days). Subsequently,

they were 2.95 ± 0.39 days in P9 and 4.75 ± 0.97 days in

P15. Taurine treatment reduced the doubling time through-

out the culture process and had a significant effect in P9. On

the other hand, although 100 mg/l taurine treatment brought

a higher absolute population of BMSCs of the same donor

(donor rat 2) at any time (Fig. 2b), the maximum passage

numbers (Fig. 2c) and culture times until senescence

responsible proliferation stop (Fig. 2d) of BMSCs of three

donors had no statistical difference. These suggested that

taurine could enhance the proliferation efficiency of passage

BMSCs, but extending the life span of them.

Table 1 Real time RT-PCR primers

Primers Forward (50–30) Reverse (50–30)

ALP ACCTCATCAGCATTTGGAAGAGCT GAACAGGGGTGCGTAGGGGGAACAG

Col I CCCACCCCAGCCGCAAAGAGT TTGGGTCCCTCGACTCCTACA

OC CAGACCTAGCAGACACCATGAG CGTCCATACTTTCGAGGCAG

b-actin CCAACCGTGAAAAGATGACC CAGGAGCAATGATCTTG

Mol Cell Biochem (2012) 366:259–267 261

123

Fig. 1 Effect of taurine on the

CFU-F formation in primary

culture and proliferation of

BMSCs. a Taurine increased the

CFU-F formation of primary

BMSCs in a dose dependant

manner. b Taurine improved the

efficiency of adhesion of

primary BMSCs in a dose

dependant manner. c The CFU-

F size was determined by

dividing adherent cell amount

by CFU-F amount. 100 mg/l

taurine seemed increased the

CFU-F sizes a bit, but statistics

showed that there was no

significance. d Taurine

treatment increased the

proliferation of passage 3

BMSCs determined by MTT

assay. n = 5, *p \ 0.05,

**p \0.01

Fig. 2 Effect of taurine on the cell doubling time (DT), absolute cell

population, maximum passage and total culture time of BMSCs. a DT

of BMSCs of different passages. Passage 3, 9 and 15 respectively

represent the early, middle, and late stages of rat BMSCs. The DT of

BMSCs gradually lengthened along of passage. 100 mg/l taurine

treatment since primary culture generally shortened the DT of

BMSCs, significantly at passage 9. n = 4, *p \ 0.05. b 100 mg/l

taurine treatment brought a higher absolute population of BMSCs of

donor rat 2. The initial time was the first passage. In the early 30 days,

taurine increased the total cell population. In the later 40 days, its

effect was not clear. c and d The maximum passage numbers and

culture times until senescence responsible proliferation stop were not

significantly different between taurine-treated and control groups.

n = 3, *p \ 0.05

262 Mol Cell Biochem (2012) 366:259–267

123

Taurine reduced the senescence-associated

beta-galactosidase activity of BMSCs

The activity of SA-b-Gal is a typical marker of cell repli-

cative senescence, which progressively increased along

with passage in regular BMSCs (Fig. 3a, P15 BMSCs). As

shown in statistics (Fig. 3b), the percentage of SA-b-Gal

positive cells was about 18 % in P3, increased to 47 % in

P9, and reached 80 % in P15. In taurine-treated group, the

percentage of SA-b-Gal positive cells was about 10 % in

P3 though not significantly different to control. In P9 and

P15, the increases of SA-b-Gal positive cell percentages

were enormously inhibited by taurine treatment, both

remaining around 20 %.

Taurine has slight influence on CD molecules

expressions of BMSCs

Among the six cell surface CD molecules, BMSCs did not

present labeling for the hematopoietic lines CD31 and

CD45 and were positive for the following essential BMSCs

surface adhesion molecules: CD 44, 73, 90, and 105

(Fig. 4). From P3 to P10, CD90 and CD105 expressions

decreased respectively from about 98 % to 85 % and from

about 90 % to 82 %, and there were no difference between

P10 taurine-treated and control groups. The percentage of

CD44-positive BMSCs was 61 % in P3, and then it

decreased slightly to 58 % in regular P10 cells. While in

taurine-treated P10 cells, it maintained at 62 %. CD73 was

87 %-positive in P3 BMSCs, and 62 %-positive in P10.

While in taurine-treated P10 BMSCs its expression was

lower to 51 %. Overall, as stemness markers of BMSCs,

the expressions of cell surface CD molecules were only

slightly influenced by taurine treatment.

Taurine postponed the decline of differentiation

potential of BMSCs

To assess the differentiation capability of BMSCs with

long-term taurine treatment, we utilized ALP staining, Von

Kassa staining and real time quantitative RT-PCR of

osteogenic markers ALP, collagen I (Col I) and osteocalcin

(OC). ALP was a typical early stage osteogenic differen-

tiation marker, which’s activity and mRNA expression in

P10 BMSCs were increased significantly by taurine treat-

ment (Fig. 5a–c). In un-inducting condition, there was no

difference between ALP expressions of taurine and control

groups. Meanwhile, it is of note that the distribution of

ALP staining was more uneven (Fig. 5a).

As shown in Fig. 5d and e, long-term taurine treatment

greatly increased mRNA expressions of the other two

osteogenic markers Col I and OC in inducing condition.

While in un-inducing condition, Col I expressions were

both low but a little higher in taurine group than control.

OC, a late stage differentiation marker, barely expressed in

control group, and had a normal basal expression in taurine

group.

Mineral deposition was a mature stage marker of oste-

ogenic differentiation, which was shown by Von Kassa

staining in Fig. 5b. In osteogenic inducing condition, it was

found to be undetectable in non-taurine group and intensive

in taurine group. These suggested that long-term taurine

treatment help maintaining the differentiation potential of

BMSCs.

Discussion

In this study, we evaluated the effect of taurine on the

replicative senescence of BMSCs during in vitro expansion.

Results showed that taurine could not only promote the

monocyte adherence, CFU-F formation in primary culture

and cell proliferation in subculture, but also postpone the

gradual SA-b-gal expression increase and loss of differen-

tiation potential of BMSCs. Besides, taurine had seldom

influence on the maximum passage number and culture time

Fig. 3 Taurine inhibited senescence associated b-galactosidase (SA-

b-Gal) expressions of BMSCs of different passages. a Representative

micrographs of passage 15 BMSCs show positive cells stained with

SA-b-Gal treated with taurine (100 mg/l) or without. Scale barrepresents 50 lm. b Percentages of BMSCs with positive SA-b-Gal

staining increased along with cell passages under normal condition.

Taurine treatment significantly decreased the SA-b-Gal expression

of BMSCs especially in the later passages. n = 4, *p \ 0.05,

**p \ 0.01

Mol Cell Biochem (2012) 366:259–267 263

123

since the first passage to senescence. The surface CD

molecules expressions were only slightly influenced.

The efficiency of monocyte adherence in primary

BMSCs culture is a key factor of BMSCs isolation, insuring

cell population in the premise of cell quality assurance and

bone marrow volume limitation. Since taurine addition

enhanced the proliferation efficiency, larger cell quantity

could be obtained in limited period of time. Taking that into

account, taurine addition in the isolation and expansion of

BMSCs is of great meaning in lowering the threshold of

BMSCs-based clinical application.

Along of serial passage, BMSCs underwent progressive

replicative senescence. This is typically reflected by the

expression of SA-b-gal [18], which was significantly

decreased by taurine treatment. Cell population doubling

time is also a common indicator of cell senescence. It was

decreased throughout the serial passage and significantly in

P9.

There have been a lot of reports proposing different

views about how many passages BMSCs of each species

could pass for. BMSCs from three male rats of eight weeks

age were utilized in this study. Their maximum passage

number ranged widely from 16 to 28, suggesting a great

individual difference of donors. The growth and differen-

tiation states are influenced by multiple factors, such as

donor weights, operating practices, and culture conditions.

The pace of senescence was also affected by these factors

[18]. Under stable experimental condition, though the

opinion of the maximum passage number differs, the effect

of taurine was reliable. P9 rat BMSCs in our operation

system might be considered to be ‘‘middle-aged’’ which

had begun getting senescent.

The total in vitro culture time and passage number of

BMSCs were not significantly altered. It seems not coin-

cide with the senescence-inhibition effect of taurine in a

sense. But there is some phenomenon worth noticing. First,

the effect of taurine was weaker and not statistically sig-

nificant on BMSCs begun getting senescent. And the

exponential curves of absolute cell populations in the late

stage were parallel. Furthermore, the final status of senes-

cent BMSCs was not just stay still and adhered to petri-

dish. Cells would float and die. These gave a hint that

taurine treatment might just enhanced the cell potential and

did not alter the substantial factors causing in vitro repli-

cative senescence of BMSCs.

BMSCs are a heterogeneous group. The percents of cell

surface CD molecules are rulers of cell stemness, which

lower along of series passage of BMSCs. After subcultur-

ing with taurine treatment from P3 to P10, CD90 and

CD105 expressions were the same to control, while CD44

expression was maintained at the similar level of P3, and

CD73 expression was slightly much lower than control.

CD44 is a cell-surface glycoprotein involved in cell–cell

interactions, cell adhesion and migration [19]. It is reported

to have a fundamental role in promoting cell survival and

the loss of CD44 expression is an important factor in the

death program, not only because of its role in cell adhesion

but to a direct contribution of survival-sustaining signals

[20]. CD44 is also a receptor for hyaluronic acid and can

also interact with other ligands, such as osteopontin, col-

lagens, and matrix metalloproteinases, which are related to

osteogenic differentiation of BMSCs [21]. It is proposed

that the participation of CD73/ecto-50-nucleotidase per se

as a proliferative factor, was involved in the control of cell

Fig. 4 Flow cytometry analysis of BMSCs for cell surface CD

molecules: CD 31, 44, 45, 73, 90, and 105. BMSCs did not present

labeling for the hematopoietic lines CD 31 and 45, and were positive

for CD 44, 73, 90, and 105. From passage 3 to 10, the percentages of

CD90-positive and CD105-positive BMSCs decreased, and there

were no difference between taurine-treated and control groups. The

CD44 expression level was retained by long-term treatment of

taurine, while the CD73 expression level in taurine-treated BMSCs

was lower than control group

264 Mol Cell Biochem (2012) 366:259–267

123

growth, differentiation, invasion, migration and metastasis

processes [22]. CD73 regulates the extracellular adenosine

and adenosine 50-monophosphate (AMP) levels. Although

this enzyme has been extensively characterized, few data

are available concerning a possible hormonal regulation of

enzymatic activity [23].

Osteogenic differentiation is a major lineage of BMSCs,

generally thought to be the most promising and valuable

differentiation direction for BMSCs-based cell therapy and

tissue engineering. The basal expressions of differentia-

tion-related markers were lowered and even eliminated

along of BMSCs passage. The middle-aged BMSCs treated

with long term taurine addition exhibited better preserved

differentiation capability. OC is a late stage marker,

which’s expression would increase in extracellular matrix

(ECM) maturation stage of osteogenic differentiation and

facilitate the extracellular mineral deposition. Taurine

treatment enormously increased OC expression in osteo-

genic inducing condition, and preserved its basal expres-

sions in regular culture condition, which is preserving

the intactness of osteogenic differentiation potential of

BMSCs. Taking into account that taurine preserved the

mineral depotion capability of P10 BMSCs in inducing

condition, these suggested a stemness maintaining effect of

taurine on BMSCs. However, for early osteogenic markers,

ALP’s basal expression was not changed by taurine treat-

ment. While Col I’s basal expression was increased. In the

late period of osteogenic differentiation of BMSCs, ALP

expression would fall back, while Col I would be contin-

uously expressed to facilitate ECM maturation. It is rea-

sonable to speculate that, in regular culture condition,

taurine play the role of preserving differentiation potential

of BMSCs by maintaining the expression levels of late

stage-related genes.

The mechanisms of cellular replicative senescence and

reduction of differentiation potential of BMSCs were not

clear till now. The effects of taurine in mammals are

numerous and varied. Taurine is a powerful agent in

regulating and reducing the intracellular calcium levels.

Two specific targets of taurine action are reported to be

Fig. 5 Effect of taurine on the osteogenic differentiation potential of

passage 10 BMSCs. a and c The ALP expression was substantially

increased by taurine treatment in osteogenic inducing condition. In

both inducing and un-inducing groups, the distributions of ALP

staining were more uneven. b Mineral deposition was only detected in

taurine-treated inducing group. d The mRNA expression of early

marker Col I was substantially increased by taurine treatment in

osteogenic inducing condition and was slightly increased in regular

condition. e In taurine group, late marker OC had a normal basal

expression and highly expression in osteogenic inducing condition.

While in non-taurine group, OC hardly expressed in both inducing

and un-inducing conditions. n = 4, *p \ 0.05, **p \ 0.01,

***p \ 0.001

Mol Cell Biochem (2012) 366:259–267 265

123

Na?–Ca2? exchangers and metabotropic receptors mediat-

ing phospholipase-C (PLC) in central nervous system [24].

PLC could cleave Phosphatidylinositol 4, 5-bisphosphate

(PIP2) into diacyl glycerol (DAG) and inositol 1, 4, 5-tris-

phosphate (IP3). IP3 binds to IP3 receptors, particular cal-

cium channels in the endoplasmic reticulum, which causes

the increase of calcium concentration, causing a cascade of

intracellular changes and activity [25]. In addition, calcium

works with DAG to activate protein kinase C (PKC). PKC is

a family of serine threonine kinases which are believed to

play important roles in the regulation of mammalian

growth, differentiation and apoptosis. PKC signaling may

activate the transcription of specific genes, including CD73

[26]. Activated PKC can phosphorylate and activate PKD,

leading to the activity of ERK-dependent proliferative

pathways [27].

The above signal transductions were part of the non-

canonical Wnt signaling pathway. Wnt signaling pathway

and their functional cross-talk with other growth factor

signaling pathways, such as Transforming growth factor b(TGF-b) signaling, bone morphogenetic protein (BMP)

signaling, and Notch signaling were widely reported to be

precise controllers of cell fate decisions of BMSCs

including in the self-renewal and differentiations [28–30].

Besides, switches between canonical and non-canonical

Wnt signaling pathways were presumed to be associated

with the commitment of MSCs to the osteogenic lineage

[31]. Non-canonical Wnt signaling was generally thought

having an inhibitory effect of MSCs self-renewal [32]. It is

reasonable to speculate that the effects of taurine inhibiting

non-canonical Wnt signaling by reducing the intracellular

Calcium concentration and PKC activity were at least

partially mediating the replicative senescence process and

differentiation potential of BMSCs.

Taurine is an antioxidant, radioprotectant, detoxificant,

and nutrient for general all purpose and is a conditionally

essential nonproteinogenic amino acid that is required for

many aspects of mammalian metabolism [33]. From the

moment in vitro culture begins, MSCs enter senescence

and start to lose their stem cell characteristics almost un-

detectably [34]. In this study, taurine was proved having

the proliferation promoting and anti-replicative senescence

effect on rat BMSCs, providing a new view angle to

understand the protecting and nourishing effect of taurine.

Meanwhile, its application in the isolation and expansion of

BMSCs might help optimizing experimental condition and

reducing the material requirement for cell transplantation

strategies.

Acknowledgments We thank Bo Tao for technical support.

Conflict of interest The authors declare that they have no conflicts

of interest concerning this article.

References

1. Wagner W, Bork S, Horn P et al (2009) Aging and replicative

senescence have related effects on human stem and progenitor

cells. PLoS One 4:e5846

2. Galderisi U, Helmbold H, Squillaro T et al (2009) In vitro

senescence of rat mesenchymal stem cells is accompanied by

downregulation of stemness-related and DNA damage repair

genes. Stem Cells Dev 18:1033–1042

3. Sturman JA (1993) Taurine in development. Physiol Rev 73:

119–147

4. Hayes KC, Carey RE, Schmidt SY (1975) Retinal degeneration

associated with taurine deficiency in the cat. Science 188:

949–951

5. Green T, Fellman JH, Eicher AL et al (1991) Antioxidant role

and subcellular location of hypotaurine and taurine in human

neutrophils. Biochim Biophys Acta 1073:91–97

6. Rosado JO, Salvador M, Bonatto D (2007) Importance of the

trans-sulfuration pathway in cancer prevention and promotion.

Mol Cell Biochem 301:1–12

7. Letavayova L, Markova E, Hermanska K (2006) Relative contri-

bution of homologous recombination and non-homologous end-

joining to DNA double-strand break repair after oxidative stress in

Saccharomyces cerevisiae. DNA Repair (Amst) 5:602–610

8. Schuller-Levis G, Gordon RE, Park E et al (1995) Taurine pro-

tects rat bronchioles from acute ozone-induced lung inflammation

and hyperplasia. Exp Lung Res 21:877–888

9. Wang QJ, Giri SN, Hyde DM et al (1989) Effects of taurine on

bleomycin-induced lung fibrosis in hamsters. Proc Soc Exp Biol

Med 190:330–338

10. Gordon RE, Shaked AA, Solano DF (1986) Taurine protects

hamster bronchioles from acute NO2-induced alterations. A his-

tologic, ultrastructural, and freeze-fracture study. Am J Pathol

125:585–600

11. Wang Q, Hollinger MA, Giri SN (1992) Attenuation of amio-

darone-induced lung fibrosis and phospholipidosis in hamsters

by taurine and/or niacin treatment. J Pharmacol Exp Ther 262:

127–132

12. Pasantes-Morales H, Franco R (2002) Influence of protein

tyrosine kinases on cell volume changeinduced taurine release.

Cerebellum 1:103–109

13. Frosini M, Sesti C, Saponara S et al (2003) A specific taurine

recognition site in the rabbit brain is responsible for taurine

effects on thermoregulation. Br J Pharmacol 139:487–494

14. El Idrissi A, Trenkner E (2004) Taurine as a modulator of

excitatory and inhibitory neurotransmission. Neurochem Res

29:189–197

15. Oja SS, Saransaari P (2007) Pharmacology of Taurine. Proc West

Pharmacol Soc 50:8–15

16. Lewis DA (1984) Endogenous anti-inflammatory factors. Bio-

chem Pharmacol 33:1705–1714

17. Hernandez-Benıtez R, Pasantes-Morales H, Torres Saldana I,

Ramos-Mandujano G (2010) Taurine dtimulates proliferation of

mice embryonic cultured neural progenitor cells. J Neurosci Res

88:1673–1681

18. Wagner W, Horn P, Castoldi M et al (2008) Replicative senes-

cence of mesenchymal stem cells-a continuous and organized

process. PLoS One 5:e2213

19. Ibrahim EM, Stewart RL, Corke K et al (2006) Upregulation of

CD44 expression by interleukins 1, 4, and 13, transforming

growth factor-beta1, estrogen, and progestogen in human cervical

adenocarcinoma cell lines. Int J Gynecol Cancer 16:1631–1642

20. Bates RC, Edwards NS, Burns GF (2001) A CD44 survival path-

way triggers chemoresistance via lyn kinase and phosphoinositide

3-kinase/Akt in colon carcinoma cells. Cancer Res 61:5275

266 Mol Cell Biochem (2012) 366:259–267

123

21. Huebener P, Abou-Khamis T, Zymek P et al (2008) CD44 is

critically involved in infarct healing by regulating the inflam-

matory and fibrotic response. J Immunol 180:2625–2633

22. Bavaresco L, Bernardi A, Braganhol E et al (2008) The role of

ecto-50-nucleotidase/CD73 in glioma cell line Proliferation. Mol

Cell Biochem 319:61–68

23. Bavaresco L, Bernardi A, Braganhol E et al (2007) Dexametha-

sone inhibits proliferation and stimulates ecto-50-nucleotidase/

CD73 activity in C6 rat glioma cell line. J Neurooncol 84:1–8

24. Foos TM, Wu JY (2002) The role of taurine in the central nervous

system and the modulation of intracellular calcium homeostasis.

Neurochem Res 27:21–26

25. Alberts B, Lewis J, Raff M et al (2002) Molecular biology of the

cell, 4th edn. Garland Science, New York

26. Node K, Kitakaze M, Minamino T et al (1997) Activation of

ecto-50-nucleotidase by protein kinase C and its role in ischaemic

tolerance in the canine heart. Br J Pharmacol 120:273–281

27. New DC, Wong YH (2007) Molecular mechanisms mediating the

G protein-coupled receptor regulation of cell cycle progression.

J Mol Signal 2:2

28. Ito K, Lim AC, Salto-Tellez M et al (2008) RUNX3 attenuates

beta-catenin/T cell factors in intestinal tumorigenesis. Cancer

Cell 14:226–237

29. Westendorf JJ, Kahler RA, Schroeder TM (2004) Wnt signaling

in osteoblasts and bone diseases. Gene 341:19–39

30. Conboy IM, Conboy MJ, Smythe GM et al (2003) Notch-medi-

ated restoration of regenerative potential to aged muscle. Science

302:1575–1577

31. Baksh D, Boland GM, Tuan RS (2007) Cross-talk between Wnt

signaling pathways in human mesenchymal stem cells leads to

functional antagonism during osteogenic differentiation. J Cell

Biochem 101:1109–1124

32. Ling L, Nurcombe V, Cool SM (2009) Wnt signaling controls the

fate of mesenchymal stem cells. Gene 433:1–7

33. Park E, Park SY, Wang C et al (2002) Cloning of murine cysteine

sulphonic acid decarboxylase and its mRNA expression in murine

tissues. Biochim Biophys Acta 1574:403–406

34. Bonab MM, Alimoghaddam K, Talebian F et al (2006) Aging of

mesenchymal stem cell in vitro. BMC Cell Biol 7:14

Mol Cell Biochem (2012) 366:259–267 267

123