TARGETED LOCUS AMPLIFICATION & NEXT GENERATION … EH… · Targeted Locus Amplification (TLA) [de...
1
.... ............................................................................................................................................................................ BLLC1 CERGENTIS B.V. PADUALAAN 8 3584 CH UTRECHT THE NETHERLANDS 0031 - (0)30 - 760 16 36 [email protected] WWW.CERGENTIS.COM Erik Splinter 1 , Max van Min 1 , Zeljko Antic 2 , Simon van Reijmersdal 2 , Marieke Simonis 1 , Jiangyan Yu 2 , Edwin Sonneveld 3 , Blanca Scheijen 4 , Judith Boer 5 , Aurelie Boeree 5 , Mehmet Yilmaz 1 , Peter M. Hoogerbrugge 6 , Frank N. van Leeuwen 4 , Monique L. den Boer 5 , Roland P. Kuiper 2 1 Cergentis BV, Utrecht, Netherlands, 2 Department of Human Genetics, Radboud university medical center, Nijmegen, Netherlands, 3 Dutch Childhood Oncology Group, The Hague, Netherlands, 4 Laboratory of Pediatric Oncology, Radboud university medical center, Nijmegen, Netherlands, 5 Department of Pediatric Oncology/Hematology, Erasmus MC - Sophia Children's Hospital, Rotterdam, Netherlands, 6 Prinsess Máxima Center for Pediatric Oncology, De Bilt, Netherlands Whole Genome Coverage Profile and coverage profile of paired-end reads mapping to the RUNX1 gene. The arrow highlights the identified fusion. Whole Genome Coverage Plot generated on a patient sample with a multiplex amplification of the RUNX1, TCF3, MLL, JAK2, IKZF1, ABL1 & PDGFR genes. IKZF1 IKZF1-del TAGGTCTTAGAAACGTAGAGTTTCAGAGGATCAGCATTACCCCCGGCCTAAAGAGAGTGTGTGTAAGTGCCGAGAGAGTGTA Image of a detected IKZF1 deletion of exons 2 and 3 and resulting breakpoint sequence. Whole Genome Coverage Plot generated on a patient sample with a multiplex amplification of the RUNX1, TCF3, MLL, JAK2, IKZF1, ABL1 & PDGFR genes. First, genomic DNA is crosslinked. Crosslinking preferentially occurs between sequences in extreme physical proximity. Crosslinking therefore results in the crosslinking of sequences from the same locus (depicted in red). This results in TLA Template; long stretches of DNA consisting of religated DNA fragments originating from the same locus. The crosslinked DNA is fragmented, religated with a ligase enzyme and then decrosslinked. This template is fragmented and circularised. Stochastic variation in the folding, crosslinking & religation of DNA fragments in individual copies of a locus results in a repertoire of DNA circles that are composed of unique combinations of DNA fragments from that locus. Circular fragments originating from the locus of interest are amplified with inverse primers complimentary to a short locus-specific sequence. As a result, the complete locus is amplified and can be sequenced using Next Generation Sequencing technologies. In this manner the TLA Technology enables targeted hypothesis-neutral sequencing. It detects all sequence and structural variants in loci of interest, also in heterogeneous samples such as tumours. The TLA Technology permits multiplexing. Multiple loci can be amplified in multiplex and/or multiple individual amplifications. TARGETED LOCUS AMPLIFICATION & NEXT GENERATION SEQUENCING FOR THE DETECTION OF RECURRENT AND NOVEL GENE FUSIONS FOR IMPROVED TREATMENT DECISIONS IN PEDIATRIC ACUTE LYMPHOBLASTIC LEUKEMIA INTRODUCTION Despite developments in targeted and whole genome gene sequencing, the robust detection of all genetic variation, including structural variants, in and around genes of interest and in an allele-specific manner remains a challenge. Targeted Locus Amplification (TLA) [de Vree et al., Nature Biotechnology 2014;32:1019-25] is a strategy to selectively amplify and sequence entire genes on the basis of the crosslinking of physically proximal sequences. Unlike other targeted re-sequencing methods, TLA works without detailed prior locus information, as one or a few primer pairs are sufficient for sequencing tens to hundreds of kilobases of surrounding DNA. TLA enables robust detection of all single nucleotide variants, structural variants and gene fusions in genes of interest. In addition, TLA enables the haplotyping of sequenced regions. We describe the use of TLA and NGS to detect fusion genes and sequence mutations relevant for stratification of B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Genomic profiling of BCP-ALL in the last few years has substantially extended the number of risk factors that can be used for risk stratification. However, conventional tests provide incomplete sequence information and can therefore miss clinically relevant information. In addition the opportunities TLA presents in the detection of breakpoint sequences promise to em- power breakpoint specific minimal residual disease tests. TLA TECHNOLOGY EXPERIMENTAL SET-UP A total of 31 primer sets targeting 19 recurrently affected genes were designed and multiplexed, including the ‘classical’ players MLL, RUNX1, TCF3, and IKZF1, the tyrosine kinase genes ABL1, ABL2, PDGFRB, CSF1R, JAK1, JAK2, JAK3, FLT3, and TYK2, and the cytokine signaling genes CRLF2, EPOR, IL7R, TSLP, SH2B3, and IL2RB. Primer sets were chosen such that the most relevant regions were sufficiently covered. Viable cells from 47 selected BCP-ALL samples were analysed. TLA prep was performed, TLA amplicons were library prepped using Nextera and sequenced on an Illumina NextSeq (23 patient samples were analysed per High Output PE150 NextSeq Run). Paired end or long read based sequencing enables the haplotyping of all DNA fragments that occur in the same amplicon: the fact that DNA fragments occur in the same read means they originate from the same locus. In a multiplex analysis reads from amplicons originating from different genes can be mapped separately and the presence or absence of gene-fusions can be assessed for each individual gene. RESULTS All 20rearrangements known to be present in these samples were detected by TLA, including rearrangements in ETV6-RUNX1 (n=5), MLL (n=2), TCF3-PBX1 (n=3), CRLF2 (n=3), EBF1-PDGFRB (n=2), BCR-ABL1 (n=1), RCSD1-ABL2 (n=1), SSBP2-CSF1R (n=1) and iAMP21 (n=2). For 14 of the fusions sequencing depth was sufficient to extract breakpoint-spanning sequences directly. For two cases with known JAK2 fusions with an unknown partner, the fusion gene was identified (TERF2 and BCR), as was the case for an unknown ABL1 fusion (FOXP1). New fusions were identified in 8 cases, including previously described IGH@-EPOR, TCF3-ZNF384, MLL, and CRLF2 fusions, and novel gene fusion of TCF3-CD163L1 and HDAC9-FLT3. In addition we identified deletion breakpoint fusions in IKZF1, and sequence mutations in JAK2. CONCLUSION We conclude that TLA is an effective method for the reliable detection of sequence mutations and structural variations that are relevant for disease prognosis and/or could be targeted by approved kinase inhibiton. For Research Use Only. Not for use in diagnostics procedures. Whole Genome Coverage Profile and coverage profile of paired-end reads mapping to the TCF3 gene. The arrow highlights the identified fusion. IGV coverage profile across the ZNF384 half of an identified TCF3-ZNF384 gene fusion and identified breakpoint sequence. TCF3 RUNX1 JAK2 IKZF1 MLL ABL1 PDGFRB/CSF1R Chr1 Chrx RUNX1 ETV6 RUNX1 / ETV6 Chr1 Chrx TCF3 RUNX1 IKZF1 MLL ABL1 Chr1 Chrx PDGFRB/CSF1R JAK2 TCF3 / PBX1 Chr1 Chrx PBX1 TCF3 TCF3-ZNF384 TGGAGGCCTGTGGGGTCCCTCGGCTTGGGCCCCTCACCACCCATCCCCCCACCCTGCAGCAGAGTAAGATAGAAGACC ACCTAATTTTTTGTATTTTAGTAGAGATGGGATTTCACCATGTTGCCCAGGCTGGTCTTGAACTCCTAAGCTCAGGCAGTCCAC ABL1 Gene To be detected alterations BCR-ABL1, other ABL1 fusions MLL All MLL fusions RUNX1 ETV6-RUNX1, iAMP21 TCF3 TCF3-PBX1 IKZF1 IKZF1 mutations, Δ4-7, Δ2-7, Δ2-3, Δ4-8 “Classical” Gene Set ABL2 Gene To be detected alterations ABL2 fusions PDGFRB e.g. EBF1-PDGFRB CSF1R gene fusions EPOR IGH/IGK gene fusions TYK2 gene fusions + mutations TSLP gene fusions + mutations IL2RB gene fusions CRLF2 P2RY8-CRLF2, IGH-CRLF2 JAK2 gene fusions + mutations IL7R mutations FLT3 mutations SH2B3 mutations JAK1 JAK3 mutations mutations BA-like Gene Set Overview of targeted genes and to be identified sequence variants.
Transcript of TARGETED LOCUS AMPLIFICATION & NEXT GENERATION … EH… · Targeted Locus Amplification (TLA) [de...
![Page 1: TARGETED LOCUS AMPLIFICATION & NEXT GENERATION … EH… · Targeted Locus Amplification (TLA) [de Vree et al., Nature Biotechnology 2014;32:1019-25] is a strategy to selectively](https://reader035.fdocuments.us/reader035/viewer/2022070921/5fba1f2ce487fe2e874763f2/html5/thumbnails/1.jpg)
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
BLLC1
CERGENTIS B.V. PADUALAAN 8 3584 CH UTRECHT THE NETHERLANDS 0031 - (0)30 - 760 16 36 [email protected] WWW.CERGENTIS.COM
Erik Splinter1, Max van Min1, Zeljko Antic2, Simon van Reijmersdal2, Marieke Simonis1, Jiangyan Yu2, Edwin Sonneveld3, Blanca Scheijen4, Judith Boer5, Aurelie Boeree5, Mehmet Yilmaz1, Peter M. Hoogerbrugge6,Frank N. van Leeuwen4, Monique L. den Boer5, Roland P. Kuiper2
1Cergentis BV, Utrecht, Netherlands, 2Department of Human Genetics, Radboud university medical center, Nijmegen, Netherlands, 3Dutch Childhood Oncology Group, The Hague, Netherlands, 4Laboratory of Pediatric Oncology, Radboud university medical center, Nijmegen, Netherlands, 5Department of Pediatric Oncology/Hematology, Erasmus MC - Sophia Children's Hospital, Rotterdam, Netherlands,
6Prinsess Máxima Center for Pediatric Oncology, De Bilt, Netherlands
Whole Genome Coverage Profile and coverage profile of paired-end reads mapping to the RUNX1 gene.The arrow highlights the identified fusion.
Whole Genome Coverage Plot generated on a patient sample with a multiplex amplification of the RUNX1, TCF3, MLL, JAK2, IKZF1, ABL1 & PDGFR genes.
IKZF1
IKZF1-del
TAGGTCTTAGAAACGTAGAGTTTCAGAGGATCAGCATTACCCCCGGCCTAAAGAGAGTGTGTGTAAGTGCCGAGAGAGTGTA
Image of a detected IKZF1 deletion of exons 2 and 3 and resulting breakpoint sequence.
Whole Genome Coverage Plot generated on a patient sample with a multiplex amplification of the RUNX1, TCF3, MLL, JAK2, IKZF1, ABL1 & PDGFR genes.
First, genomic DNA is crosslinked. Crosslinking preferentially occurs between
sequences in extreme physical proximity.
Crosslinking therefore results in the
crosslinking of sequences from the same locus
(depicted in red).
This results in TLA Template; long stretches of
DNA consisting of religated DNA fragments
originating from the same locus.
The crosslinked DNA is fragmented, religated
with a ligase enzyme and then decrosslinked.
This template is fragmented and circularised.
Stochastic variation in the folding, crosslinking
& religation of DNA fragments in individual
copies of a locus results in a repertoire of DNA
circles that are composed of unique combinations
of DNA fragments from that locus.
Circular fragments originating from the locus
of interest are amplified with inverse primers
complimentary to a short locus-specific
sequence.
As a result, the complete locus is amplified and
can be sequenced using Next Generation
Sequencing technologies.
In this manner the TLA Technology enables
targeted hypothesis-neutral sequencing.
It detects all sequence and structural variants
in loci of interest, also in heterogeneous
samples such as tumours.
The TLA Technology permits multiplexing.
Multiple loci can be amplified in multiplex
and/or multiple individual amplifications.
TARGETED LOCUS AMPLIFICATION & NEXT GENERATION SEQUENCING FOR THE DETECTIONOF RECURRENT AND NOVEL GENE FUSIONS FOR IMPROVED TREATMENT DECISIONS IN
PEDIATRIC ACUTE LYMPHOBLASTIC LEUKEMIA
INTRODUCTIONDespite developments in targeted and whole genome gene sequencing, the robust detection of all genetic variation, including structural variants, in and around genes of interest and in an allele-specific manner remains a challenge. Targeted Locus Amplification (TLA) [de Vree et al., Nature Biotechnology 2014;32:1019-25] is a strategy to selectively amplify and sequence entire genes on the basis of the crosslinking of physically proximal sequences. Unlike other targeted re-sequencing methods, TLA works without detailed prior locus information, as one or a few primer pairs are su�cient for sequencing tens to hundreds of kilobases of surrounding DNA. TLA enables robust detection of all single nucleotide variants, structural variants and gene fusions in genes of interest. In addition, TLA enables the haplotyping of sequenced regions.
We describe the use of TLA and NGS to detect fusion genes and sequence mutations relevant for stratification of B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Genomic profiling of BCP-ALL in the last few years has substantially extended the number of risk factors that can be used for risk stratification. However, conventional tests provide incomplete sequence information and can therefore miss clinically relevant information. In addition the opportunities TLA presents in the detection of breakpoint sequences promise to em-power breakpoint specific minimal residual disease tests.
TLA TECHNOLOGY
EXPERIMENTAL SET-UPA total of 31 primer sets targeting 19 recurrently a�ected genes were designed and multiplexed, including the ‘classical’ players MLL, RUNX1, TCF3, and IKZF1, the tyrosine kinase genes ABL1, ABL2, PDGFRB, CSF1R, JAK1, JAK2, JAK3, FLT3, and TYK2, and the cytokine signaling genes CRLF2, EPOR, IL7R, TSLP, SH2B3, and IL2RB. Primer sets were chosen such that the most relevant regions were su�ciently covered.
Viable cells from 47 selected BCP-ALL samples were analysed.
TLA prep was performed, TLA amplicons were library prepped using Nextera and sequenced on an Illumina NextSeq (23 patient samples were analysed per High Output PE150 NextSeq Run).
Paired end or long read based sequencing enables the haplotyping of all DNA fragments that occur in the same amplicon: the fact that DNA fragments occur in the same read means they originate from the same locus. In a multiplex analysis reads from amplicons originating from di�erent genes can be mapped separately and the presence or absence of gene-fusions can be assessed for each individual gene.
RESULTSAll 20rearrangements known to be present in these samples were detected by TLA, including rearrangements in ETV6-RUNX1 (n=5), MLL (n=2), TCF3-PBX1 (n=3), CRLF2 (n=3), EBF1-PDGFRB (n=2), BCR-ABL1 (n=1), RCSD1-ABL2 (n=1), SSBP2-CSF1R (n=1) and iAMP21 (n=2). For 14 of the fusions sequencing depth was su�cient to extract breakpoint-spanning sequences directly. For two cases with known JAK2 fusions with an unknown partner, the fusion gene was identified (TERF2 and BCR), as was the case for an unknown ABL1 fusion (FOXP1). New fusions were identified in 8 cases, including previously described IGH@-EPOR, TCF3-ZNF384, MLL, and CRLF2 fusions, and novel gene fusion of TCF3-CD163L1 and HDAC9-FLT3. In addition we identified deletion breakpoint fusions in IKZF1, and sequence mutations in JAK2.
CONCLUSIONWe conclude that TLA is an e�ective method for the reliable detection of sequence mutations and structural variations that are relevant for disease prognosis and/or could be targeted by approved kinase inhibiton.
For Research Use Only. Not for use in diagnostics procedures.
Whole Genome Coverage Profile and coverage profile of paired-end reads mapping to the TCF3 gene.The arrow highlights the identified fusion.
IGV coverage profile across the ZNF384 half of an identified TCF3-ZNF384 gene fusionand identified breakpoint sequence.
TCF3
RUNX1
JAK2
IKZF1
MLL
ABL1
PDGFRB/CSF1R
Chr1
Chrx
RUNX1
ETV6
RUNX1 / ETV6
Chr1
Chrx
TCF3
RUNX1
IKZF1
MLL
ABL1
Chr1
Chrx
PDGFRB/CSF1R
JAK2
TCF3 / PBX1
Chr1
Chrx
PBX1
TCF3
TCF3-ZNF384TGGAGGCCTGTGGGGTCCCTCGGCTTGGGCCCCTCACCACCCATCCCCCCACCCTGCAGCAGAGTAAGATAGAAGACCACCTAATTTTTTGTATTTTAGTAGAGATGGGATTTCACCATGTTGCCCAGGCTGGTCTTGAACTCCTAAGCTCAGGCAGTCCAC
ABL1Gene To be detected alterations
BCR-ABL1, other ABL1 fusionsMLL All MLL fusionsRUNX1 ETV6-RUNX1, iAMP21TCF3 TCF3-PBX1IKZF1 IKZF1 mutations, ∆4-7, ∆2-7, ∆2-3, ∆4-8
“Classical” Gene Set
ABL2Gene To be detected alterations
ABL2 fusionsPDGFRB e.g. EBF1-PDGFRBCSF1R gene fusionsEPOR IGH/IGK gene fusionsTYK2 gene fusions + mutationsTSLP gene fusions + mutationsIL2RB gene fusionsCRLF2 P2RY8-CRLF2, IGH-CRLF2JAK2 gene fusions + mutationsIL7R mutationsFLT3 mutationsSH2B3 mutationsJAK1JAK3
mutationsmutations
BA-like Gene Set
Overview of targeted genes and tobe identified sequence variants.
