T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID
description
Transcript of T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID
![Page 1: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/1.jpg)
Francis K. Lee, M.Sc, Ph.D.Senior Service Fellow (Research Microbiologist)
Newborn Screening Translation Research Initiative, CDCEmeritus Professor of Pediatrics, Emory University School of Medicine
Newborn Screening Molecular WorkshopJune 28-30, 2011
T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID
National Center for Environmental Health · Division of Laboratory SciencesNewborn Screening and Molecular Biology Branch
![Page 2: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/2.jpg)
Severe Combined Immunodeficiency (SCID) is characterized by the absence of both humoral and cellular immunity At least 15 different genes known to cause SCID when mutated All have profound defects in T lymphocyte differentiation and function
Maternal antibodies wane during first months of life - affected infants develop infections (common / opportunistic pathogens) Recurrent infections, chronic diarrhea, sepsis, FTT Death usually before 1 year of age
Overview of SCID – the Condition
SCID has been called “Bubble Boy Disease”
Treatment and prevention of infections can prolong life but are not curative
Best hope for SCID patients is Hematopoietic Stem Cell Transplant before the onset of infections
![Page 3: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/3.jpg)
SCID classification X-linked SCID: Mutation in the γ chain common to IL-2, IL-4, IL-
7, IL-9, IL-17 & IL-21 receptors Autosomal Recessive SCID:
Adenosine Deaminase deficiency (20q13.11)Jak3 tyrosine kinase deficiency (19p13.1)RAG 1 or 2 defect (11p13)IL-7R deficiency ( chain) (5p13)
Purine Nucleoside Phosphorylase deficiency (14q13)MHC II deficiency (16p13, 1q21, 13q)CD3 and CD3 mutations (11q23)CD45 deficiencyZAP-70 deficiency- (2q12)Artemis (10p)
![Page 4: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/4.jpg)
Mutations in IL2R gamma chain
NHIGRI, NIH: Genbank accession number L19546
![Page 5: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/5.jpg)
Common Feature: ABSENT/NON-FUNCTIONAL T CELLSTRECs: Reduced in All Forms of SCID
IL2R T- B+ NK-JAK3 T- B+ NK-IL7R T- B+ NK+CD45 T- B+ NK+RAG1 T- B- NK+RAG2 T- B- NK+ARTEMIS T- B- NK+ADA T- B- NK-Reticular Dysgenesis T- B+ NK+SCID, multiple bowel atresias T- B+/- NK+SCID, congenital abnormalities T- B+/- NK+Severe DiGeorge Syndrome T- B+/- NK+CD3 Deficiency T+/- B+ NK+CD8 Deficiency T+ B+ NK+Severe Ataxia Telangiectasia T+/- B+/- NK+
Unknown geneticDefect ~5-25%
![Page 6: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/6.jpg)
Prevalence of the disease 1:100,000 or greaterSCID: 1:50,000-1:100,000
Can the disorder be detected by routine physical exam?SCID: Baby appears normal at birth.
Does the disease cause serious medical complications?SCID: 100% fatal within the first year of life
Is there a cheap, sensitive and specific screening test?SCID: Real time PCR to enumerate T cell receptor excision circles
Is there a confirmatory test?SCID: Lymphocyte subpopulation analysis
Does early detection improve outcome?SCID: Early HSCT decreases mortality from SCID
SCID Meets NBS Criteria
![Page 7: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/7.jpg)
Optimal Test to Screen for severe
T cell lymphopenia (SCID) Must detect low/absent T cells Use existing NBS screening cards Inexpensive, sensitive and specific
Low rate of false positive testsLittle need for retesting
• Real Time PCR (RT-PCR): enumeration of T cell receptor excision circles (TREC - surrogate marker for recently produced T cells) using DNA extracted from newborn blood spots collected routinely on all newborns
![Page 8: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/8.jpg)
The T cell Receptor Excision Circle (TREC) assay differs from other molecular assays used in NBS: Phenotype assay: TREC is a molecular marker for T cell production in thymus
Quantitative assay: require higher level of precision
results influence d by• DNA extraction efficiency• PCR efficiency
Overview of TREC Assay for SCID
![Page 9: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/9.jpg)
T cell receptor excision circles (TREC) are by-products of the
rearrangement of T cell receptor (TCR) genes during
thymocyte maturation in the thymus
TRECs are episomal DNA and do not replicate during mitosis
Peripheral blood TREC levels reflect T lymphocyte production
in the thymus
TREC Assay: Real Time PCR
Variations in TREC Assay procedures can be based on: Primers and Probes
DNA extraction procedures
Overview of TREC Assay for SCID (cont.)
![Page 10: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/10.jpg)
Alpha chain V segments
Delta chain V/D/J segments
Alpha chain J segments
Alpha chain constant region
TCR–Delta deletion in rearrangement of T cell receptor geneVα
1Vα2
Vαn δRecVδ1Vδ/Dδ/Jδ
Cδ
ψЈα Jα2Jα1 Jα3 Jαn Cα
↓
↓
δRec-ΨJα Coding joint
Signal joint δRec-ΨJα
TREC
≈≈≈ ≈
↓Vα–Јα–Cα
rearrangement↓TCR alpha chain transcription, translation , expression
≈≈
≈ ≈≈≈
≈
≈
Chromosomal 14TCR α/δ chain loci
Episomal DNA (δRec-ΨJα TREC)
Chromosomal 14TCR α chain locus
Chromosomal 14TCR α/δ chain loci
![Page 11: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/11.jpg)
GTGTCCTCACCCGTGAAA GTCCACGGATACGTAGTGGCAC
5’
3’
≈δRec
ΨЈα
5’ -------AAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTG-------3’
≈
Orientation of δRec and ΨЈα sequences in genomic DNA
Orientation of δRec and ΨЈα sequences in TREC DNA
Signal Joint
Forward Primer Direction → ← Reverse Primer Direction
![Page 12: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/12.jpg)
DBS DNA
Extraction
TREC sequence
Amplification
Amplicons Quantificati
on
DBS DNA Extraction
Real time PCR
DBS In SituPCR
Amplicons Quantificatio
n
DBSIn Situ Real time PCR
Classical Conventional PECDC
Technical Approaches to TREC Assays
![Page 13: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/13.jpg)
TREC Measurement: qPCR
NBS Card
Dried blood spots (DBS)
3 mm punch
96 well plate
Extract
DNA*
Enumerate
TRECs by real-time
qPCR
0
1
2
3
4
5
0 10 20 30 40 50
Fluo
resc
ence
(dR
n)
Cycles
Cord Bloods TREC Amplification Plots
![Page 14: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/14.jpg)
In Situ Real Time PCR Assay for TREC
Punch one 2.0 mm discs from DBS specimen into PCR tubes
Wash with 125 µl of DNA purification solution S1(shake for 15 minutes at room temp)
Wash with 125 µl of DNA elution solution S2(shake for 5 minutes at room temp)
![Page 15: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/15.jpg)
In Situ Real Time PCR Assay for TREC (cont.)
0.00 0.50 1.00 1.50 2.00 2.50 3.0026
28
30
32
34
36
38
f(x) = − 3.14088301371599 x + 36.606966827678R² = 0.963610371552069
TREC-HeLa DBS calibrators
log10(cell#/μl blood)
CT#
Discard S2 wash bufferAdd 15 μl of qPCR mastermix (contains complete mix of primers & probe)
Run qPCR in Stratagene MX3000p:45 deg for 5 min, 95 deg for 20 min 45 cycles of [ 95 deg x 15 sec + 60 deg x 1 min ]
0
1
2
3
4
5
0 10 20 30 40 50
Fluo
resc
ence
(dR
n)
Cycles
Cord Bloods TREC Amplification Plots
![Page 16: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID](https://reader036.fdocuments.us/reader036/viewer/2022062305/568164ae550346895dd6bae3/html5/thumbnails/16.jpg)
Quality Assurance
Use of TREC Reference Materials
National Center for Environmental HealthNewborn Screen and Molecular Biology Branch