Suppression of endogenous PPARγ increases vulnerability to methamphetamine-induced injury in mouse...

ORIGINAL INVESTIGATION

Suppression of endogenous PPARγ increases vulnerabilityto methamphetamine-induced injury in mouse nigrostriataldopaminergic pathway

Seong-Jin Yu & Mikko Airavaara & Hui Shen &

Jenny Chou & Brandon K. Harvey & Yun Wang

Received: 2 March 2011 /Accepted: 16 November 2011 /Published online: 13 December 2011# Springer-Verlag (outside the USA) 2011

AbstractRationale Methamphetamine is a commonly abused drugand dopaminergic neurotoxin. Repeated administration ofhigh doses of methamphetamine induces programmed celldeath, suppression of dopamine release, and reduction inlocomotor activity. Previous studies have shown thatpretreatment with peroxisome proliferator-activated receptorgamma (PPARγ) agonist reduced methamphetamine-inducedneurodegeneration.Objectives The purpose of this study was to examine therole of endogenous PPARγ in protecting against metham-phetamine toxicity.Methods Adeno-associated virus (AAV) encoding the Crerecombinase gene was unilaterally injected into the leftsubstantia nigra of loxP-PPARγ or control wild-type mice.Animals were treated with high doses of methamphetamine1 month after viral injection. Behavioral tests were examinedusing rotarod and rotometer. In vivo voltammetry was used toexamine dopamine release/clearance and at 2 months aftermethamphetamine injection.Results Administration of AAV-Cre selectively removedPPARγ in left nigra in loxP-PPARγ mice but not in thewild-type mice. The loxP-PPARγ/AAV-Cre mice that re-ceived methamphetamine showed a significant reduction intime on the rotarod and exhibited increased ipsilateral rota-tion using a rotometer. The peak of dopamine release in-duced by local application of KCl and the rate of dopamineclearance were significantly attenuated in the left striatum of

loxP-PPARγ/AAV-Cre animals. Tyrosine hydroxylase im-munoreactivity was reduced in the left, compared to right,nigra, and dorsal striatum in loxP-PPARγ/AAV-Cre micereceiving high doses of methamphetamine.Conclusion A deficiency in PPARγ increases vulnerabilityto high doses of methamphetamine. Endogenous PPARγmay play an important role in reducing methamphetaminetoxicity in vivo.

Keywords Methamphetamine . Dopamine .

Neurodegeneration . Virus . Striatum

AbbreviationsAAV Adeno-associated virusDAPI 4′,6-diamidino-2-phenylindoleDA DopamineETime Endurance timesGFP Green fluorescent proteinGFP/Cre GFP-Cre fusion proteinKO KnockoutMA MethamphetaminePPARγ Peroxisome proliferator-activated

receptor gammaPPRE PPAR response elementRXR Retinoic X receptorTH Tyrosine hydroxylaseWT Wild type

Introduction

Peroxisome proliferator-activated receptor gamma (PPARγ)is a nuclear receptor that forms a complex with the retinoicX receptor and binds to the PPAR response element (PPRE)

S.-J. Yu :M. Airavaara :H. Shen : J. Chou : B. K. Harvey :Y. Wang (*)National Institute on Drug Abuse, IRP,Neural Protection and Regeneration Section,251 Bayview Boulevard, 06-721A,Baltimore, MD 21224, USAe-mail: [email protected]

Psychopharmacology (2012) 221:479–492DOI 10.1007/s00213-011-2595-7

in the promoter region of specific genes, such as interleukin-1β, IL-6, tumor necrosis factor alpha, catalase, and super-oxide dismutase to regulate their expression. PPARγ is alsopresent in cytosol in neuronal cells (Isaac et al. 2006; Xu et al.2010) and can be translocated to nuclei after injury (Xu et al.2010). PPARγ is involved in attenuating neurodegenerationin several neurological diseases, including Parkinson’s dis-ease (Dehmer et al. 2004; Schintu et al. 2009), Alzheimer’sdisease (Jiang et al. 2008), and stroke (Shimazu et al. 2005;Tureyen et al. 2007; Victor et al. 2006; Zhao et al. 2005) aswell as methamphetamine (MA)-induced psychomotorsensitization (Maeda et al. 2007).

MA is a commonly abused drug and dopaminergic neu-rotoxin. Repeated administration of high doses of MA indu-ces programmed cell death, suppression of dopamine (DA)release, and reduction in tyrosine hydroxylase (TH) immu-noreactivity. Some of these presynaptic changes are revers-ible. Using an in vivo electrochemical measurement, it hasbeen shown that potassium-evoked DA overflow in striatumwas reduced 1 week after high-dose MA administration inadult Fisher rats. The evoked DA overflow partially recov-ered after 1 month and fully recovered by 6 months (Cassand Manning 1999). These data suggest that high doses ofMA can induce a reversible electrochemical dysfunction indopaminergic neurons.

Recent studies have indicated that PPARγ agonists canmodify neurodegeneration in dopaminergic neurons. Chron-ic treatment with the PPARγ agonists rosiglitazone or pilo-glitazone attenuated MPTP-mediated motor deficits and lossof TH(+) cells in substantia nigra compacta in mice (Quinnet al. 2008; Schintu et al. 2009). Administration of rosigli-tazone reduced microglial activation and partially restoreddopamine content in MPTP-lesioned animals (Schintu et al.2009). Pretreatment with the PPARγ agonist 15d-PG J2 oribuprofen reduced the high-dose MA-mediated loss of DATimmunoreactivity and the accumulation of microglial cellsin the striatum 3 days after repeated MA injection (Tsuji etal. 2009). Taken together, these data suggest that activationof PPARγ reduces neurodegeneration induced by MA orother dopaminergic toxins. The endogenous protective roleof PPARγ pathway against dopaminergic toxins, i.e., in theabsence of pharmacological agonists, is still not fully clarified,particularly since the agonists used may have actions at othersites.

The purpose of this study was to examine the protectiveroles of endogenous PPARγ in MA-mediated neurodegen-eration using PPARγ-deficient animals. The conventionalelimination of PPARγ in knockout mice results in earlylethality by embryonic days 10–11 due to placental dysfunc-tion (Barak et al. 1999). The Cre/loxP system can be used toproduce a cell-specific or conditional knockout by de-leting a gene of choice in a specific cell type. In this study, weselectively removed PPARγ in the substantia nigra unilaterally

by stereotaxic injection of an adeno-associated virus (AAV)encoding the gene for Cre recombinase, which resulted inexcision of the PPARγ gene coding sequence flanked by loxPsites (Kaspar et al. 2002; Scammell et al. 2003). We foundthat a deficiency of PPARγ in the substantia nigra increasesvulnerability to high doses of MA.

Methods

AAV vectors The generation of the control vector, AAV-green fluorescent protein (GFP), has been described (Loweryet al. 2009). The construction of AAV-GFP/Cre (Cre-GFPfusion protein, referred to as “AAV-Cre” in the currentmanuscript) has also been described previously (Kaspar etal. 2002). Viral stocks were prepared using a triple transfec-tion method (Howard et al. 2008; Xiao et al. 1998). Bothvectors were packaged using pAAV7, the rep/cap plasmidfor generating serotype 7 (Gao et al. 2002). Plasmids usedfor packaging AAV were generously provided by Dr. XiaoXiao (UNC, Chapel Hill, NC, USA). Both vectors werepurified by CsCl gradient and titered by quantitative PCRusing GFP as the target sequence. Viral titers are recorded asviral genome per milliliter.

Animals Homozygous loxP-PPARγ mice (strain name,B6.129-Ppargtm2Rev/J; stock number, 004584) were pur-chased from Jackson Laboratories and were bred in theanimal facility at the NIDA IRP. Control wild-type (WT)mice (C57/BL6) were purchased from CRL laboratories. Allprotocols and animal care procedures were in accordancewith the National Institute of Health Guide for the Care andUse of Laboratory Animals (NIH Publications no. 80-23,revised 1996). The use of these animals for this study wasapproved by the Animal Care and Use Committee, NIDA.All animals were genotyped by PCR before viral injectionaccording to previously described methods (He et al. 2003).

Unilateral AAV injection into substantia nigral region Adultmale loxP-PPARγ andWTmice were anesthetized with chlo-ral hydrate (400 mg/kg, i.p.). The animals were placed in astereotaxic frame (Stoelting), where a 10 μl Hamilton syringewith a 30-gauge needle was used to stereotactically deliverAAV-Cre (2 μl of 5×109 viral genomes/μl) at a speed of0.5 μl/min into left substantia nigral region (coordinates:AP, −3.3 mm; ML, +1.2 mm to bregma and DV 4.2 mmfrom skull surface according to Paxinos and Franklin’s “theMouse Brain”). The needle remained in the brain for 2 minafter the injection then slowly removed. After recovery fromanesthesia, animals were housed in their home cages.

Injection of MA or saline At 1 month after viral injection,animals were treated with (+) MA (10 mg/kg, ×4 doses,

480 Psychopharmacology (2012) 221:479–492

each dose 2 h apart) or saline (every 2 h, 4 doses, s.c.). Thishigh dose of MA is required to induce neural toxicity inrodents (Grace et al. 2010; Jayanthi et al. 2005; Zhu et al.2006) and has been used to examine protection againstMA-mediated neural degeneration in mice (Chou et al. 2008;Wang et al. 2001). Core body temperature was monitored bya mouse rectal probe (YSI, Yellow Springs, OH, USA).

Rotarod treadmill test Animals received 3 days of training(twice daily) before MA or saline administration. Eachanimal was placed in the respective lane on treadmill,13.75 in above the testing platform. For training, the rodwas rotated at 5 rpm initially and then accelerated to 10 rpm.The test was performed again at 10 rpm on days 3, 10, and42 after MA or saline injection. Cutoff time for each test was360 s. Each animal was tested five times per day. The twolongest endurance times (ETime) on the rotating rod in fivetrials were averaged and used for analysis.

Rotation At 45 days after MA or saline injection, animalswere tested for rotational behavior in response to subcuta-neous (+) MA injections (2.5 mg/kg, s.c.) in an automatedrotometer (Accuscan Instruments, Columbus, OH, USA).Each animal was placed in a cylindrical test chamber for90 min. The highest consecutive clockwise and counter-clockwise rotations over 60 min were used for analysis.

Western blot analysis The frozen striatal tissues were homog-enized in radioimmunoprecipitation assay buffer containing50mMTris–HCl, pH 7.4, 1%NP40, 0.25% deoxycholic acid,150 mM sodium chloride, 1 mM EDTA, and1% proteaseinhibitor (Roche, Germany). Lysates were cleared by centri-fugation (14,000×g at 4°C for 5 min), and the total proteinconcentration in each sample was determined by DCA assayusing bovine serum albumin (BSA) as a standard curve.Lysates were separated by NuPAGE® Novex Bis-Tris gels4–12% gel from Invitrogen, and the proteins were trans-ferred to Immobilon-FL membranes (Millipore, Billerica,MA, USA). After preblocking in Odyssey blocking bufferfrom Li-Cor for overnight at 4°C, the membranes wereincubated with the primary antibody rabbit anti-actin(1:2,500, Sigma, St. Louis, MO, USA) and mouse anti-tyrosine hydroxylase (TH) (1:5,000, Millipore) at roomtemperature for 2 h, then incubated for 90 min in goatanti-rabbit IR-700 nm, goat-anti-mouse IR-800 nm sec-ondary antibodies (1:2,500, Li-Cor, Lincoln, NE, USA).The membranes were scanned using an Odyssey infraredimager (Li-Cor, Lincoln, NE, USA). Immunoblots were quan-tified with ImageJ.

In vivo voltammetry KCl-evoked DA release in striatumwas measured at >2 months after MA or saline injection.Animals were anesthetized using urethane (1.25 g/kg, i.p.).

In vivo chronoamperometric measurements of extracellulardopamine (DA) concentration were performed as previouslydescribed (Zhou et al. 1996). The recordings were taken atrates of 10 Hz continuously using Nafion-coated carbonfiber working electrodes (tip030 μm; SF1A, Quanteon,Lexington, Kentucky) and a microcomputer-controlled ap-paratus (FAST system, Quanteon). The release of DA wasmeasured by changes of extracellular DA concentrationafter microinjection of KCl into the striatal parenchyma.KCl (70 mM) in osmolarity-balanced saline (79 mM NaCland 2 mM CaCl2) was locally applied through a micropi-pette at 100–200 nl range. The concentration and volume ofKCl solution in the pipette have been previously reported toinduce depolarization and release of dopamine at dopami-nergic nerve terminals in vivo (Hoffman et al. 1998; Wanget al. 2003). The working electrode and the micropipettewere mounted together with sticky wax; tips were separatedby 150 μm. The electrode/pipette assembly was loweredinto striatum (AP, 0–0.5 mm, M/L 2.0 mm relative to breg-ma and 1.5–3.5 mm below the dura). Local application ofKCl from the micropipette was performed by pressure ejec-tion using a pneumatic pump (BH2, Medical System). Theejected volume was monitored by recording the change inthe fluid meniscus in the pipette before and after ejectionusing a dissection microscope.

Immunohistochemistry Mice were perfused transcardiallywith saline followed by 4% paraformaldehyde in 0.1 Mphosphate-buffered (PB) saline. Brains were stored in 18%sucrose and sectioned coronally (25 μm) using a Leicacryostat. Free-floating brain sections were rinsed three timeswith PB for 10 min and incubated for 1 h with blockingsolution (4% BSA and 0.3% Triton X-100 in PB). Brainssections (25 μm in thickness) were immunolabeled usingprimary anti-TH polyclonal antibody (Millipore, Temecula,CA, USA; 1:500) for 2 days or rabbit anti-PPARγ (SantaCruz biotechnology, Santa Cruz, CA, USA; 1:50) antibodyovernight at 4°C. For immunofluorescence, molecularprobes Alexa 568 secondary antibodies (Invitrogen, Carls-bad, CA, USA; 1:500) were included for 3 days for TH orovernight at 4°C for PPARγ. Nuclei were counterstainedwith 4′,6-diamidino-2-phenylindole (DAPI; MolecularProbes, 1:1,000). Control sections were incubated withoutprimary antibody. Confocal analysis was performed using aNikon D-ECLIPSE 80i microscope and EZ-C1 3.90 software.

Quantification of TH immunoreactivity in striatum Thebound primary antibody primary anti-tyrosine hydroxylase(TH) polyclonal antibody (Millipore, Temecula, CA, USA;1:500) was visualized using the infrared-labeled secondaryantibody (goat anti-rabbit IRDye800, Rockland Immuno-chemicals Inc.) 1:500 in 4% BSA and 0.3% Triton X-100in PB for 1 h. Sections were rinsed three times with PB and

Psychopharmacology (2012) 221:479–492 481

mounted on gelatin ⁄chrome-alum coated slides and cover-slipped. TH immunoreactivity in brain sections were scannedand quantified by a Li-Cor Odyssey scanner. TH signal fromcerebral cortex was used as a background and subtracted fromstriatum TH signal. Densitometry was carried out in sectionswith an identified anterior commissure (between AP, +1.10and 0.14mm to bregma), and signals were averaged.

TH cell count in midbrain An ABC method was used andsections were incubated in biotinylated horse anti-rabbit IgG(1:200; Vector Laboratories, Burlingame, CA, USA) for 1 h,followed by incubation for 1 h with avidin–biotin–horseradishperoxidase complex as described previously (Chou et al.2008). Staining was developed with 2,3′-diaminobenzidinetetrahydrochloride (0.5 mg/mL). Sections were then mountedon gelatin ⁄chrome-alum coated slides and coverslipped. ForTH-positive cell counts histological images were acquiredusing an Infinity 3 camera, NIKON 80i microscope andQCapture Pro 5.0 software, and TH-positive cell counts weredone with NIS elements software (Nikon) and personnelblinded as to treatment. TH-positive cells were averaged fromsections between AP, −3.16 and −3.64 mm to bregma asdescribed previously (Chou et al. 2008).

RNA isolation and standard PCR for detection ofrecombination Approximately 2 weeks after injection, ani-mals were euthanized and brains removed. Using a cryostat,brains were coronally sectioned from posterior to anteriorfrom 1 mm posterior to the site of injection, and a 2-mmdiameter tissue punch (∼2 mm depth) was made from eachhemisphere and combined. Total RNAwas isolated from thecombined hemispheres using Rneasy Lipid Extraction Kit(Qiagen) and reverse transcribed using iScript cDNA syn-thesis kit (Biorad). Using established reaction conditionsand primers (Zhao et al. 2009), PCR was performed todetect wild-type (700 bp) and recombinant PPARγ (300and 400 bp).

Quantitative PCR Using cDNA prepared as describedabove, PPARγ and ubiquitin-conjugating enzyme E2I(Ube2i, reference gene) mRNA levels were measured byreal-time quantitative PCR (TaqManTM chemistry, Roche)and analyzed with a CFX96 thermal cycler (Bio-Rad).PPARγ and UBE2i primers and probes were designed usingReal Time Design (Bioresearch Technologies, Novato, CA,USA). UBE2i was used as a housekeeping gene based onprevious work (Kobayashi et al. 2004). Real-time PCRresults were calculated using the 2−ΔΔCT method (Schmittgenand Livak 2008). Briefly, the threshold cycle (Ct) of PPARγwas normalized to the Ct of the reference gene Ube2i foreach sample, which was used to determine fold changes inPPARγ mRNA expression compared to wild-type animalsinjected with AAV-GFP.

Primer and probe sequences are as follows:

PPARγ: 5′GCCCTTTACCACAGTTGATTTCTC 3′(fwd)5′FAM- TTCTGCTCCACACTATGAAGACATTCCA -BH1 3′ (probe)5′ GCAACCATTGGGTCAGCTCTT 3′ (rev)Ube2i: 5′GCCACCACTGTTTCATCCAAA3′ (fwd)5′FAM-CGTGTATCCTTCTGGCACAGTGTGC-BH13′ (probe)5′GCCGCCAGTCCTTGTCTTC3′ (rev)

Results

AAV-Cre and recombination of loxP-PPARγ

A total of 12 loxP-PPARγ and 12 wild-type mice receivedintranigral administration of AAV-Cre (serotype 7) or AAV-GFP. Recombination by AAV-Cre was confirmed by standardPCR of cDNA prepared from tissue punches of midbrain at2 weeks after viral delivery. Only loxP-PPARγ animalsthat received AAV-Cre were positive for recombination(Fig. 1a). Quantitative PCR analysis of the cDNA from themidbrain showed a 50% reduction [p00.0019, F(3, 23)0

7.123, one-way ANOVA+Newman–Keuls test] in PPARγmRNA levels for loxP-PPARγ animals receiving AAV-Cre,compared to all other groups (Fig. 1b). The efficiency ofAAV serotype 7 transduction was examined 2 weeks afterlocal administration of AAV-Cre in three WT mice. AAVtransduced about 56±4% of TH cells in the nigra based oncolocalization of TH immunoreactivity and GFP fluores-cence (Fig. 1c–e). Overall, these results demonstrate thatAAV-GFP/Cre successfully transduced dopaminergic neuronsand caused a reduction in PPARγ expression in the nigraregion.

At 1 month after AAV injection, the GFP fluorescencefrom the GFP/Cre fusion of AAV-Cre was expressed in THand non-TH cells in the left nigra region (Fig. 2). Usingconfocal microscopy, we found that GFP fluorescence colo-calized with the nuclear marker DAPI in the TH neurons(Fig. 2d). No GFP fluorescence was found in the striatum orin the contralateral hemisphere. These data suggest that Cre-GFP fusion protein was produced in the dopaminergic andnon-dopaminergic cells at the site of injection and localizedto the nucleus. Immunolabeling cells in the substantia nigrafor PPARγ showed a decrease of PPARγ-immunoreactivityin GFP/Cre-positive cells of loxP-PPAR, but not wild-type,animals (Fig. 3).

TH immunoreactivity in striatum

WT and loxP-PPARγ mice were treated with AAV-Creunilaterally in the left nigra area. Striatal tissue in the left


hemisphere was collected for Western analysis at 2 daysafter MA or saline administration. MA treatment, comparedto saline treatment, significantly reduced striatal TH/actinimmunoreactivity in loxP-PPARγ/AAV-Cre and WT/AAV-Cre mice (p<0.05, F1, 33022.349, two-way ANOVA+posthoc Newman–Keuls test, Fig. 4a and b). Our data suggestthat high doses of MA can acutely induce neurodegenerationin striatum. No difference was found in striatal TH activitybetween loxP-PPARg/AAV-Cre and WT/AAV-Cre mice re-ceiving MA. These data suggest that MA induces a similarneurodegeneration in these mice at 2 days after MA treatment.

Rotarod

A total of 34 mice (15 loxP-PPARγ and 19 WT mice) weretreated with AAV-Cre unilaterally in the left nigra area.Animals received 3 days of training before MA or salineadministration. One WT mouse was removed from thisbehavioral study during the training period. One month afterviral injection, animals were treated with MA (n015) orsaline (n018). Rotorod tests, at 10 rpm, were taken ondays 3, 10, and 42 after injection of MA or saline. Salineinjection did not alter the endurance time (ETime) in loxP-

PPARγ/AAV-Cre and WT/AAV-Cre mice (Fig. 5). In con-trast, high doses of MA significantly reduced ETime up to42 days after injection (F1, 840102.337, p<0.001, three-wayANOVA). There is a statistically significant interaction be-tween the administration of MA and treatment of AAV-Crein loxP-PPARγ animals (F1, 8405.286, p00.024, three-wayANOVA, Fig. 5), suggesting that unilaterally deletingPPARγ potentiates MA-mediated behavioral deficits. Posthoc Newman–Keuls analysis indicates a significant reduc-tion of rotarod performance in loxP-PPARγ mice treatedwith AAV-Cre and MA, compared to WT mice treated withAAV-Cre and MA (p00.012).

Rotation

A two-way ANOVAwas used to analyze rotational behaviorin 34 mice at 45 days after receiving saline or MA (10 mg/kg×4, s.c.). Rotation was recorded every 2 min for 90 minafter administration of a low dose of MA (2.5 mg/kg, s.c.).Animals developed both ipsilateral and contralateral rotationafter injection. No difference was found in the contralateralrotation between loxP-PPARγ/AAV-Cre and WT/AAV-Cremice (F1, 2900.002, p00.963, Fig. 6b) or treatment with

Fig. 1 AAV-Cre delivery to midbrain of loxP-PPARγ mice causesrecombination with the PPARγ gene and a 50% reduction in PPARγmRNA expression. a Recombination of PPARγ was only detected inloxP-PPARγ mice that received AAV-Cre. Male C57/Bl6 (wild-type)or PPARγ mice were bilaterally injected into midbrain with eitherAAV-GFP or AAV-Cre virus (1×1010 vg/site). Recombination wasonly detected in cDNA from loxP-PPARγ animals using a qualitativePCR assay that yields either wild-type (700 bp) and recombinantPPARγ (300 and 400 bp, representing splice variants) on an

ethidium-stained agarose gel. Each lane represents one animal. bReal-time PCR of cDNA revealed that only loxP-PPARγ animalsreceiving AAV-Cre showed a significant reduction in PPARγ(∼50%). Data were normalized to reference gene, Ube2i. *p<0.05,**p<0.01, One-way ANOVA, Newman–Keuls post hoc analysis com-pared to WT/AAV-GFP group. c–e Tyrosine hydroxylase immunore-activity (c), GFP fluorescence (d), and merged image (e) at 2 weeksafter local administration of AAV-GFP/Cre injection in nigra region.GFP was detected in both TH-positive and TH-negative cells


saline or high-doseMA (F1, 2900.002, p00.963). In contrast,there is a significant difference in ipsilateral rotationbetween loxP-PPARγ/AAV-Cre and WT/AAV-Cre mice(F1, 29012.366, p00.01). There is also a significant interac-tion between use of MA and treatment with AAV-Crein loxP-PPARγ mice (F1, 2905.288, p00.029). Post hocNewman–Keuls test indicates that treatment with high doseof MA significantly increased ipsilateral rotation in loxP-

PPARγ/AAV-Cre animals, as compared to WT/AAV-Crecontrols (p<0.05, Fig. 6a).

KCl-induced DA release in striatum

KCl-evoked DA release in striatum was examined using invivo voltammetry in eight loxP-PPARγ/AAV-Cre and eightWT/AAV-Cre mice at 2 months after high dose of MA

Fig. 2 The GFP/Cre fusion pro-tein of AAV-Cre is expressedin dopaminergic and non-dopaminergic cells in nigraat 1 month after AAV-Creinjection. TH immunoreactivity(A1 and A2, low and highmagnification) and GFPfluorescence (B1 and B2) werefound in the nigra area at the siteof injection. GFP fluorescencewas co-expressed in TH(B1 and B2) and non-TH cellsin nigra (C1 and C2, merged).Confocal photomicrographsindicate that GFP/Cre is presentin the nuclei of TH-containingcells in substantia nigra parscompacta (SNpc), ipsilateralto AAV-Cre injection (D).No GFP fluorescence wasobserved in the TH cells in thecontralateral SNpc (E). Scalebars: A1, B1, C1 100 μm; A2,B2, C2, D, E 20 μm


injection. KCl-evoked DA release was recorded in 150striatal sites between 1.5 and 3.5 mm below the brainsurface. Of these, 80 sites were taken from the striatum

ipsilateral (L) to the AAV-Cre injection, while 70 sites wererecorded in the contralateral (R) striatum. Average dose ofKCl ejected from micropipette was 176.9±7.5 nl per site.Local application of KCl resulted in the release of dopaminein all striatal sites contralateral to AAV-Cre injection in bothWT/AAV-Cre and loxP-PPARγ/AAV-Cre mice. Typical ex-tracellular dopamine tracings from left and right striatum areshown in Fig. 7a and B.

Previous voltammetric studies have shown a dose–re-sponse relationship between the peak of extracellular DAlevel and log dose of applied DA through micropipette in ratstriatum (Sabeti et al. 2002a, b). In this study, the amplitudeof DA release was thus normalized by comparing to the logvolume (in nanoliters) of KCl used. A similar approach hasbeen used in our previous papers (Wang et al. 2003). We

Fig. 4 Acute MA treatment reduces TH immunoreactivity in lox-PPPARγ/AAV-Cre or WT/AAV-Cre mice. WT and loxP-PPARγ micewere treated with AAV-Cre unilaterally in left nigra area. Striatal tissuein the left hemisphere was collected for Western analysis at 2 days afteradministration of MA or saline. a MA treatment significantly reducedstriatal TH/actin immunoreactivity in loxP-PPARγ/AAV-Cre and WT/AAV-Cre mice. *p<0.05, two-way ANOVA. b An example of TH andactin Western blotting from mice receiving MA or saline

Fig. 5 Methamphetamine pretreatment-reduced endurance times (ETime)on the rotarod in loxP-PPARγ/AAV-Cre mice. Fifteen loxP-PPARγ/AAV-Cre and 18 WT/AAV-Cre mice were treated with MA (10 mg/kg×4) or saline on day 0. Rotorod tests were taken on days 3, 10, and42 after injection. Pretreatment with MA significantly reduced ETime.There is a further reduction ofETime in loxP-PPARγ/AAV-Cre, comparedto WT/AAV-Cre, mice. *p<0.05, three-way ANOVA+Newman–Keulstest

Fig. 3 Injection of AAV-Crereduces PPARγ expression inthe nigra region in floxedPPARγ mice. a Both PPARγ(red) and GFP (green) wereexpressed in the same cells(arrows) in nigra area at2 months after injection ofAAV-Cre to a wild-type mouse.b PPARγ immunoreactivity wassuppressed in cells expressedGFP (arrows) after injection ofAAV-Cre to a floxed PPARγmouse. Scale bar050 μm


first examined the averaged KCl-evoked DA release in L orR striatum from all WT/AAV-Cre and loxP-PPARγ/AAV-Cre mice pretreated with high-dose MA. There was a sig-nificant reduction in KCl-evoked DA release in the L stria-tum in the KO, as compared to R striatum in KO, L or Rstriatum in WT/AAV-Cre mice (Fig. 8a, p<0.001, F3, 1460

7.713; p<0.001, post hoc Newman–Keuls test). No differ-ence was found between the R and the L striata in WT/AAV-Cre mice. Previous studies have shown that KCl-evoked DApartially recovered after 1 month and fully recovered by6 months after high doses of MA administration in adultFisher rats (Cass and Manning 1999). Similarly, no differ-ence was found in the contralateral striatum between theanimals treated with saline or MA at 2 months after injec-tion. The rate of DA clearance (nanomolars per second) afterKCl application was calculated between T20 and T60 as

described previously (Cass and Manning 1999). There was asignificant reduction of DA clearance in the striatum ipsi-lateral to the AAV-Cre injection in loxP-PPARγ mice afterMA treatment (F3, 13703.826, p00.011, one-way ANOVA,Fig. 8b).

KCl-evoked DA release and clearance were further ana-lyzed topographically, every 0.5 mm, from 1.5 to 3.5 mmbelow the brain surface (Fig. 9). The release of dopamine,elicited by KCl in the L striatum of loxP-PPARγ/AAV-Cremice, was significantly reduced compared to the L striatum inWT/AAV-Cre mice (p<0.05, Two-way ANOVA+Newman–Keuls test, Fig. 9a). Most of these differences are found indorsal striatum (Fig. 9a). No difference was found in the Rstriatum between WT/AAV-Cre and loxP-PPARγ/AAV-Cremice (Fig. 9b). These data suggest that deficiency in PPARγexpression attenuates KCl-induced release of dopamine inthe striatum. The reduction of DA clearance was mainlymanifested in the left dorsal striatum in loxP-PPARγ/AAV-Cre (Fig. 9c, p<0.05, two-way ANOVA). No difference wasfound in the right striatum between WT/AAV-Cre and loxP-PPARγ/AAV-Cre mice (Fig. 9d).

TH immmunoreactivity

Mice receiving unilateral AAV-Cre were killed after voltam-metric recording or 2 months after MA or saline injection.AAV-Cre administration did not alter TH fiber or cell den-sity in striatum or nigra in ipsilateral, compared to thecontralateral, hemisphere in three WT/AAV-Cre or in threeloxP-PPARγ/AAV-Cre mice receiving saline injection. Highdose of MA treatment did not alter striatal TH immunore-activity in WT/AAV-Cre mice (Fig. 10a); however, reducedTH immunoreactivity, mainly in the dorsal region, in loxP-PPARγ/AAV-Cre mice (Fig. 10b) was found. Striatal THimmunoreactivity of brain slices with an identified anteriorcommissure was further quantified using ImageJ. TH fiberdensity in left striatum, normalized to the TH activity in WTmice treated with saline, was significantly reduced in loxP-PPARγ/AAV-Cre (n05), compared to WT/AAV-Cre (n06),mice after MA injection (Fig. 10g, p00.044, t test). In themidbrain area, administration of MA or saline did not affectTH immunoreactivity in the left nigra in WT/AAV-Cre mice(Figs. 10c and e). In contrast, treatment with MA (Fig. 10d),but not saline (Fig. 10f), induced a prominent reduction inTH cell density in the left nigra area in loxP-PPARγ/AAV-Cremice. The density of TH cells in midbrain slice between −3.16and −3.64 mm from bregma was counted. TH cell count,ipsilateral to the AAV-Cre injection side (left), was normalizedto that on the contralateral side (right) in each brainslice. A significantly reduction in TH cell count in theleft nigra (Fig. 10h, p00.001, t test), but not in the leftVTA (Fig. 10i, p00.980, t test), was found in loxP-PPARγ/AAV-Cre (n07), compared to WT/AAV-Cre (n05), mice

Fig. 6 a Increase in ipsilateral rotation in loxP-PPARγ/AAV-Cre micepreviously exposed to high dose of MA (10 mg/kg×4). At 45 daysafter receiving saline or high dose of MA, animals were challengedwith a low-dose MA (2.5 mg/kg, s.c.) to induce rotation. There is asignificant increase in ipsilateral rotation in the loxP-PPARγ/AAV-Cremice that previously received high-dose MA (p<0.05, two-wayANOVA). b No difference was found in the contralateral rotationbetween loxP-PPARγ/AAV-Cre and WT/AAV-Cre mice receivingtreatment with saline or with high dose of MA (p00.963, two-wayANOVA)


receiving MA injection. No significant reduction in DAPIactivity was found in left or right nigra region in these mice(p00.185, F3, 1601.815, one-way ANOVA).

Discussion

In this study, we show that the GFP/Cre fusion protein ispresent in nigra, both in TH and non-TH cells 1 month afterAAV-Cre injection. We found that administration of AAV-Cre caused reduction in PPARγ expression, detected byqRT-PCR, in nigra of loxP-PPARγ, but not WT/AAV-Cre,mice. Expression of GFP/Cre fusion protein using AAVserotype 7 in the midbrain was not limited to TH cells butdid transduce approximately 56% of TH-immunoreactivecells in substantia nigra pars compacta. PCR analysis con-firmed that recombination of the PPARγ gene occurred andcaused a 50% reduction in PPARγ expression in the midbrain.Using immunostaining, we found a decrease in PPARγ im-munoreactivity in GFP/Cre-positive cells of loxP-PPAR butnot wild-type animals after AAV-Cre infection. These datasuggest that administration of AAV-Cre provides a long-termreduction in PPARγ expression in the substantia nigra of adultfloxed animals. Our data support other reports that AAVserotype 7 transduces rodent neurons (Howard et al. 2008;Taymans et al. 2007). Taken together, these data suggest thatlocal injection with AAV-Cre can deliver Cre recombinase,promote recombination, and cause a reduction of PPARγexpression in the TH neurons in nigra in the loxP-PPARγmice.

It has been shown that activation of PPARγ by theexogenous agonist rosiglitazone prevents MPTP-mediatedmotor impairment and neurodegeneration in nigrostriataldopaminergic neurons (Schintu et al. 2009). In this study,

we examined the protective roles of endogenous PPARγagainst dopaminergic toxicity induced by high doses ofMA. We suppressed the endogenous PPARγ unilaterally innigra by injection of AAV-Cre to loxP-PPARγ mice to elicitrotational behavior, similar to that in the unilaterally 6-OHDA-lesion rodent model of Parkinson’s disease. The im-balance in dopaminergic innervation after unilateral lesioningcan be identified by rotation after injection of apomorphine oramphetamine (Ungerstedt and Arbuthnott 1970) as well byrotarod without drug challenge (Fang et al. 2010; Monvilleet al. 2006; Rozas and Labandeira Garcia 1997).

We found that administration of saline did not alter rotarodor rotational activity in WT/AAV-Cre or loxP-PPARγ/AAV-Cre mice. Similarly, KCl-evoked DA release or DA clearancein striatum was not altered in these animals (data not shown).These data suggest that the selective unilateral depletion ofPPARγ alone does not alter DA release and clearance instriatum or locomotor function in the animals.

Both in vivo and in vitro studies have shown that highdoses of MA acutely induces dysfunction in dopaminergicneurons, i.e., increasing apopototic markers, reducing tyro-sine hydroxylase or DAT expression, and suppressing DArelease (Chou et al. 2008; Shen et al. 2011). We also foundthat MA reduced TH immunoreactivity in striatum in bothloxP-PPARγ and wild-type mice receiving AAV-Cre. Ourdata suggest that high doses of MA can acutely induceneurodegeneration in striatum. Similar to rotarod behavioralresponses on day 3 after MA administration, no differencein striatal TH activity was found between lox-P PPARγ/AAV-Cre and WT/AAV-Cre mice receiving MA. These datasuggest that MA induces a similar neurodegeneration inthese mice acutely after MA treatment.

A recent study has indicated that pretreatment with ibu-profen or the selective PPARγ agonist 15d-PG attenuates

Fig. 7 Typical voltammetric tracings of extracellular DA concentra-tion in dorsal striatum in animals previously exposed to high doses ofMA. KCl-evoked dopamine release was obtained from striatum at2 mm below brain surface ipsilateral (a) or contralateral (b) to AAV-Cre injection. KCl was delivered locally through a micropipette next toDA sensor at time 0. a KCl-mediated DA release was greatly

suppressed in the left striatum in loxP-PPARγ/AAV-Cre mouse (redtracing from mouse 67660), compared to WT/AAV-Cre mouse (blacktracing from mouse 43). b No difference in DA release was found inthe right striatum between WT/AAV-Cre (black tracing from mouse43) and loxP-PPARγ/AAV-Cre (red tracing from mouse 67660) mice


the reduction of striatal DAT expression after repeated MAinjection (4 mg/kg×4) in mice (Tsuji et al. 2009), suggestingthat activation of PPARγ by exogenous ligands attenuatesMA toxicity. In this study, we found that unilaterally reducingPPARγ expression potentiated the MA-induced reduction inrotorod retention time, increased ipsilateral rotation after low-dose MA injection, and lowered KCl-evoked DA release andclearance in the knockout side striatum at 1–2 months afterMA injection. Taken together, our data suggest that suppres-sion of PPARγ potentiates MA-mediated toxicity in dopami-nergic neurons.

Administration of amphetamine analogs causes ipsilateralrotation in unilaterally 6-OHDA-lesioned rats due to differen-tial increase of dopaminergic activity on the intact side. Thereis a correlation between amphetamine-induced ipsilateral ro-tation and the depletion of dopamine in the nigra (Hudson etal. 1993). Unlike 6-OHDA-lesioned rats, which producecontinuously and consistently ipsilateral rotation after am-phetamine administration, the floxed PPARγ and WT miceused in current study developed both ipsilateral and contra-lateral rotations after administration of a low dose of MA.Such a difference may be due to the following: (a) mice withC57/B6 background are more active in response to drugstimulation, and/or (b) pretreatment with high doses ofMA did not induce a near-complete lesioning in striatumcompared to 6-OHDA lesioning. Although these animalsdeveloped contra and ipsilateral rotation based on differen-tial DA innervation between ipsilateral and contra-lateralhemispheres, there was still a bias on direction of rotation.For example, no difference was found in contralateral rotationbetween WT/AAV-Cre and loxP-PPARγ/AAV-Cre mice, pre-treated with either saline or high-dose MA. A significantincrease in ipsilateral rotation was noted only in loxP-PPARγ/AAV-Cre pretreated with high dose of MA. The in-crease in ipsilateral rotation suggests that high-doseMA enhan-ces degeneration of DA neurons unilaterally in loxP-PPARγ/AAV-Cre mice.

The deficiency in DA function in loxP-PPARγ/AAV-Cremice at 2 months after MA treatment is further supported byin vivo electrochemical data. We used high-speed chro-noamperometry to examine the time course of KCl-evokedDA release and clearance in striatum. The dose of KCl appliedlocally was between 7 and 14×10–11 mol (70 mM×100–200 nl) per site. The dose, concentration, and volume ofthe KCl solution have been previously reported to inducedepolarization and release of dopamine at dopaminergicnerve terminals in vivo (Hoffman et al. 1998; Wang et al.2003). We found that local administration of KCl inducedDA release equally in L and R striatum of WT/AAV-Cremice and in the non-viral injected striatum of loxP-PPARγ/AAV-Cre mice. Previous studies have demonstrated that thesuppression of KCl-mediated DA release is reversible in 1–6 months after high doses of MA administration in adultFisher rats (Cass and Manning 1999), suggesting a sponta-neous recovery of DA release function. We also found nodifference in DA release between MA and saline-treatedWT/AAV-Cre mice at 2 months after injection. In contrastto saline injection, KCl-evoked DA release and the rate ofDA clearance were significantly attenuated in the L striatumin loxP-PPARγ/AAV-Cre at 2 months after MA treatment.These electrochemical data suggest that deficiency inPPARγ expression in nigra potentiates or prolongsMA-mediated neurodegeneration in striatum. In agreementwith changes in distribution of TH immunoreactivity, the

Fig. 8 Averaged DA release (a) and rate of DA clearance (b) weresignificantly reduced in the left (L) striatum in loxP-PPARγ/AAV-Cremice pretreated with high-dose MA. a The peak amplitude of the DAsignal, induced by local KCl administration, was averaged in L or Rstriatum of WT/AAV-Cre and loxP-PPARγ/AAV-Cre mice. There is asignificant reduction of KCl-evoked DA release in the L striatum inKO, as compared to R striatum in KO, and to L or R striata in WT/AAV-Cre mice (p<0.001). b The rate of DA clearance (nM/s) after KClapplication was calculated between T20 and T60. There is a significantreduction in DA clearance in the striatum ipsilateral to the AAV-Creinjection in loxP-PPARγ mice after MA treatment (p00.011, one-wayANOVA)


suppression of KCl-evoked DA release and clearance in theloxP-PPARγ/AAV-Cre mice was mainly seen in the dorsalstriatum. Less difference between loxP-PPARγ/AAV-Cre andWT/AAV-Cre was found in the ventral striatum, which maybe attributed to its topographic innervation of dopaminergicneurons from VTA.

We have previously demonstrated that MA binge treat-ment (10 mg/kg×4) does not lead to loss of dopaminergicneurons in SNpc (Luo et al. 2010). There is a significantreduction of TH immunoreactivity in striatum at 3 days afterMA treatment (Chou et al. 2008), suggesting that MAproduced mainly DA terminal lesions. In this study, wefound that deficiency in PPARγ expression can lead to achronic reduction of TH cell bodies in ipsilateral nigra afterbinge MA treatment, suggesting that suppression PPARγexpression reduces protection in nigra after MA treatment.

Several reports have supported that PPARγ exerts pro-tective effects through anti-inflammation. PPARγ agonistsinhibited production of monocyte inflammatory cytokines(Jiang et al. 1998). Treatment with the PPARγ agonist

pioglitazone reduced MPTP-mediated microglia activationand neurotoxicity in nigral dopaminergic neurons (Dehmeret al. 2004). On the other hand, high dose of MA inducedinflammation (Asanuma et al. 2004). It is thus possible thatdeficiency in endogenous PPARγ may indirectly facilitateMA-mediated inflammatory reactions, which may result inregional neurodegeneration in mice with unilateral depletionof PPARγ. Further studies are needed to determine the roleof inflammation in MA-mediated midbrain toxicity in theseanimals.

In summary, our behavioral, histological, and electro-chemical data suggest that deficiency in endogenousPPARγ does not alter dopaminergic function in the absenceof injury, but enhances neurodegeneration after exposure tohigh-dose MA. It has been reported that endogenousPPARγ expression is suppressed in certain clinical disorders(Hindle et al. 2009; Yamamoto-Furusho et al. 2011) and canbe inhibited by various pharmacological agents. It may bethat a deficiency in endogenous PPARγ in these or otherconditions increases vulnerability to MA insults and that

Fig. 9 Topographic distributionof a, b KCl-evoked DA releaseand (c, d) clearance in the stria-tum in loxP-PPARγ/AAV-Cre(red tracing) and WT/AAV-Cre(black tracing) at 2 months afterhigh-dose MA administration. aThe release of dopamine elicitedby KCl in the L striatum ofmice was significantly reduced,compared to the L striatum inWT/AAV-Cre mice (p<0.05,two-way ANOVA+Newman–Keuls test). Most of these dif-ferences were in dorsal striatum.b No difference was foundin the R striatum betweenWT/AAV-Cre and loxP-PPARγ/AAV-Cre mice. c A reductionin DA clearance was seen inthe L striatum in loxP-PPARγ/AAV-Cre mice (p<0.05, two-way ANOVA). d No differencein clearance was found inthe contralateral striatumbetween WT/AAV-Cre andloxP-PPARγ/AAV-Cre mice


endogenous PPARγ may play an important role in reducingMA toxicity in vivo. Moreover, one recent study has indi-cated that conditionally knocking out PPARγ increases is-chemic brain damage (Zhao et al. 2009). These datasupports the idea that PPARγ is important for minimizing

brain injury and may be a target for pharmacotherapy inneurodegeneration.

Acknowledgment This study was supported by NIDA IRP. Wethank Dr. Barry Hoffer for his critical suggestions.

Fig. 10 Reduction of TH immunoreactivity in loxP-PPARγ/AAV-Cremice at 2 months after MA injection. a, c In a wild-type animal,unilateral injection AAV-Cre to the left nigra area did not alter THimmunoreactivity at 2 months after MA injection in a striatum and cnigra, ipsilateral to AAV-Cre injection. In contrast, in a loxP-PPARγmouse (b, d), MA treatment reduced TH immunoreactivity in the b leftstriatum and d left nigra region (arrow), ipsilateral to AAV-Cre injec-tion. Administration of saline did not alter TH activity in nigra regionin e WT and f loxP-PPARγ mice. Scale bar: a, b 1 mm. g TH fiber

density in left striatum at the level of anterior commissure, normalizedto striatal TH density in WT mice treated with saline, was significantlyreduced in loxP-PPARγ/AAV-Cre, compared to WT/AAV-Cre, miceafter MA injection (p00.044, t test). h, i TH cell counts, ipsilateral tothe AAV-Cre injection side (left), were normalized to that in contralat-eral side (right) in each brain slice. A significant reduction in TH cellcounts in left nigra (h, p00.001, t test), but not in left VTA (i, p00.980,t test), was found in loxP-PPARγ/AAV-Cre, compared to WT/AAV-Cre mice receiving MA injection


References

Asanuma M, Miyazaki I, Higashi Y, Tsuji T, Ogawa N (2004) Specificgene expression and possible involvement of inflammation inmethamphetamine-induced neurotoxicity. Ann N Y Acad Sci1025:69–75

Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR,Koder A, Evans RM (1999) PPAR gamma is required for placen-tal, cardiac, and adipose tissue development. Mol Cell 4:585–595

Cass WA, Manning MW (1999) Recovery of presynaptic dopaminer-gic functioning in rats treated with neurotoxic doses of metham-phetamine. J Neurosci 19:7653–7660

Chou J, Luo Y, Kuo CC, Powers K, Shen H, Harvey BK, Hoffer BJ,Wang Y (2008) Bone morphogenetic protein-7 reduces toxicityinduced by high doses of methamphetamine in rodents. Neuro-science 151:92–103

Dehmer T, Heneka MT, Sastre M, Dichgans J, Schulz JB (2004)Protection by pioglitazone in the MPTP model of Parkinson’sdisease correlates with I kappa B alpha induction and block ofNF kappa B and iNOS activation. J Neurochem 88:494–501

Fang X, Sugiyama K, Akamine S, Sun W, Namba H (2010) Thedifferent performance among motor tasks during the increasingcurrent intensity of deep brain stimulation of the subthalamicnucleus in rats with different degrees of the unilateral striatallesion. Neurosci Lett 480:64–68

Gao GP, Alvira MR, Wang L, Calcedo R, Johnston J, Wilson JM(2002) Novel adeno-associated viruses from rhesus monkeys asvectors for human gene therapy. Proc Natl Acad Sci U S A99:11854–11859

Grace CE, Schaefer TL, Herring NR, Graham DL, Skelton MR,Gudelsky GA, Williams MT, Vorhees CV (2010) Effect of aneurotoxic dose regimen of (+)-methamphetamine on behavior,plasma corticosterone, and brain monoamines in adult C57BL/6mice. Neurotoxicol Teratol 32:346–355

He W, Barak Y, Hevener A, Olson P, Liao D, Le J, Nelson M, Ong E,Olefsky JM, Evans RM (2003) Adipose-specific peroxisomeproliferator-activated receptor gamma knockout causes insulinresistance in fat and liver but not in muscle. Proc Natl Acad SciU S A 100:15712–15717

Hindle AK, Koury J, McCaffrey T, Fu SW, Brody F (2009) Dysregu-lation of gene expression within the peroxisome proliferator acti-vated receptor pathway in morbidly obese patients. Surg Endosc23:1292–1297

Hoffman AF, Lupica CR, Gerhardt GA (1998) Dopamine transporteractivity in the substantia nigra and striatum assessed by high-speed chronoamperometric recordings in brain slices. J PharmacolExp Ther 287:487–496

Howard DB, Powers K, Wang Y, Harvey BK (2008) Tropism andtoxicity of adeno-associated viral vector serotypes 1,2,5,6,7,8,9in rat neurons and glia in vitro. Virology 372:24–34

Hudson JL, van Horne CG, Stromberg I, Brock S, Clayton J, MasseranoJ, Hoffer BJ, Gerhardt GA (1993) Correlation of apomorphine- andamphetamine-induced turning with nigrostriatal dopamine contentin unilateral 6-hydroxydopamine lesioned rats. Brain Res 626:167–174

Isaac AO, Kawikova I, Bothwell AL, Daniels CK, Lai JC (2006)Manganese treatment modulates the expression of peroxisomeproliferator-activated receptors in astrocytoma and neuroblastomacells. Neurochem Res 31:1305–1316

Jayanthi S, Deng X, LadenheimB,McCoyMT, Cluster A, Cai NS, CadetJL (2005) Calcineurin/NFAT-induced up-regulation of the Fas li-gand/Fas death pathway is involved in methamphetamine-inducedneuronal apoptosis. Proc Natl Acad Sci U S A 102:868–873

Jiang C, Ting AT, Seed B (1998) PPAR-gamma agonists inhibit pro-duction of monocyte inflammatory cytokines. Nature 391:82–86

Jiang Q, Heneka M, Landreth GE (2008) The role of peroxisomeproliferator-activated receptor-gamma (PPARgamma) in Alz-heimer’s disease: therapeutic implications. CNS Drugs 22:1–14

Kaspar BK, Vissel B, Bengoechea T, Crone S, Randolph-Moore L,Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF,Heinemann SF, Gage FH (2002) Adeno-associated virus effectivelymediates conditional gene modification in the brain. Proc Natl AcadSci U S A 99:2320–2325

Kobayashi MS, Takahashi Y, Nagata T, Nishida Y, Murata A, IshikawaK, Asai S (2004) Screening for control genes in rat global cerebralischemia using high-density oligonucleotide array. J Neurosci Res76:512–518

Lowery RL, Zhang Y, Kelly EA, Lamantia CE, Harvey BK, MajewskaAK (2009) Rapid, long-term labeling of cells in the developingand adult rodent visual cortex using double-stranded adeno-associated viral vectors. Dev Neurobiol 69:674–688

Luo Y, Wang Y, Kuang SY, Chiang YH, Hoffer BJ (2010) Decreasedlevel of Nurr1 in heterozygous young adult mice leads to exacer-bated acute and long-term toxicity after repeated methamphet-amine exposure. PLoS One 5:e15193

Maeda T, Kiguchi N, Fukazawa Y, Yamamoto A, Ozaki M,Kishioka S (2007) Peroxisome proliferator-activated receptorgamma activation relieves expression of behavioral sensitization tomethamphetamine in mice. Neuropsychopharmacology 32:1133–1140

Monville C, Torres EM, Dunnett SB (2006) Comparison of incremen-tal and accelerating protocols of the rotarod test for the assessmentof motor deficits in the 6-OHDA model. J Neurosci Methods158:219–223

Quinn LP, Crook B, Hows ME, Vidgeon-Hart M, Chapman H, UptonN, Medhurst AD, Virley DJ (2008) The PPARgamma agonistpioglitazone is effective in the MPTP mouse model of Parkinson’sdisease through inhibition of monoamine oxidase B. Br J Pharmacol154:226–233

Rozas G, Labandeira Garcia JL (1997) Drug-free evaluation of ratmodels of parkinsonism and nigral grafts using a new automatedrotarod test. Brain Res 749:188–199

Sabeti J, Adams CE, Burmeister J, Gerhardt GA, Zahniser NR (2002a)Kinetic analysis of striatal clearance of exogenous dopaminerecorded by chronoamperometry in freely-moving rats. J NeurosciMethods 121:41–52

Sabeti J, Gerhardt GA, Zahniser NR (2002b) Acute cocaine differen-tially alters accumbens and striatal dopamine clearance in low andhigh cocaine locomotor responders: behavioral and electrochem-ical recordings in freely moving rats. J Pharmacol Exp Ther302:1201–1211

Scammell TE, Arrigoni E, Thompson MA, Ronan PJ, Saper CB,Greene RW (2003) Focal deletion of the adenosine A1 receptorin adult mice using an adeno-associated viral vector. J Neurosci23:5762–5770

Schintu N, Frau L, Ibba M, Caboni P, Garau A, Carboni E, Carta AR(2009) PPAR-gamma-mediated neuroprotection in a chronicmouse model of Parkinson’s disease. Eur J Neurosci 29:954–963

Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by thecomparative C(T) method. Nat Protoc 3:1101–1108

Shen H, Luo Y, Yu SJ, Wang Y (2011) Enhanced neurodegenerationafter a high dose of methamphetamine in adenosine A3 receptornull mutant mice. Neuroscience 194:170–180

Shimazu T, Inoue I, Araki N, Asano Y, Sawada M, Furuya D, NagoyaH, Greenberg JH (2005) A peroxisome proliferator-activatedreceptor-gamma agonist reduces infarct size in transient but notin permanent ischemia. Stroke 36:353–359

Taymans JM, Vandenberghe LH, Haute CV, Thiry I, Deroose CM,Mortelmans L, Wilson JM, Debyser Z, Baekelandt V (2007)Comparative analysis of adeno-associated viral vector serotypes1, 2, 5, 7, and 8 in mouse brain. Hum Gene Ther 18:195–206


Tsuji T, Asanuma M, Miyazaki I, Miyoshi K, Ogawa N (2009) Re-duction of nuclear peroxisome proliferator-activated receptorgamma expression in methamphetamine-induced neurotoxicityand neuroprotective effects of ibuprofen. Neurochem Res34:764–774

Tureyen K, Kapadia R, Bowen KK, Satriotomo I, Liang J, FeinsteinDL, Vemuganti R (2007) Peroxisome proliferator-activatedreceptor-gamma agonists induce neuroprotection following tran-sient focal ischemia in normotensive, normoglycemic as well ashypertensive and type-2 diabetic rodents. J Neurochem 101:41–56

Ungerstedt U, Arbuthnott GW (1970) Quantitative recording of rota-tional behavior in rats after 6- hydroxy-dopamine lesions of thenigrostriatal dopamine system. Brain Res 24:485–493

Victor NA, Wanderi EW, Gamboa J, Zhao X, Aronowski J, DeiningerK, Lust WD, Landreth GE, Sundararajan S (2006) Altered PPAR-gamma expression and activation after transient focal ischemia inrats. Eur J Neurosci 24:1653–1663

Wang Y, Hayashi T, Chang CF, Chiang YH, Tsao LI, Su TP, BorlonganCV, Lin SZ (2001) Methamphetamine potentiates ischemia/reper-fusion insults after transient middle cerebral artery ligation. Stroke32:775–782

Wang Y, Chang CF, Morales M, Chiang YH, Harvey BK, Su TP,Tsao LI, Chen SY, Thiemermann C (2003) Diadenosine tet-raphosphate protects against injuries induced by ischemia and6-hydroxydopamine in rat brain. J Neurosci 23:7958–7965

Xiao X, Li J, Samulski RJ (1998) Production of high-titer recombinantadeno-associated virus vectors in the absence of helper adenovirus. JVirol 72:2224–2232

Xu YW, Sun L, Liang H, Sun GM, Cheng Y (2010) 12/15-Lipoxyge-nase inhibitor baicalein suppresses PPAR gamma expression andnuclear translocation induced by cerebral ischemia/reperfusion.Brain Res 1307:149–157

Yamamoto-Furusho JK, Penaloza-Coronel A, Sanchez-Munoz F,Barreto-Zuniga R, Dominguez-Lopez A (2011) Peroxisomeproliferator-activated receptor-gamma (PPAR-gamma) expressionis downregulated in patients with active ulcerative colitis.Inflamm Bowel Dis 17:680–681

Zhao Y, Patzer A, Gohlke P, Herdegen T, Culman J (2005) Theintracerebral application of the PPARgamma-ligand pioglitazoneconfers neuroprotection against focal ischaemia in the rat brain.Eur J Neurosci 22:278–282

Zhao X, Strong R, Zhang J, Sun G, Tsien JZ, Cui Z, Grotta JC,Aronowski J (2009) Neuronal PPARgamma deficiency increasessusceptibility to brain damage after cerebral ischemia. J Neurosci29:6186–6195

Zhou FC, Chiang YH, Wang Y (1996) Constructing a new nigrostriatalpathway in the Parkinsonian model with bridged neural transplan-tation in substantia nigra. J Neurosci 16:6965–6974

Zhu JP, XuW, Angulo N, Angulo JA (2006) Methamphetamine-inducedstriatal apoptosis in the mouse brain: comparison of a binge to anacute bolus drug administration. Neurotoxicology 27:131–136


Suppression of endogenous PPARγ increases vulnerability to methamphetamine-induced injury in mouse...

Documents

Transcript of Suppression of endogenous PPARγ increases vulnerability to methamphetamine-induced injury in mouse...