Supplementary Materials for · Yan-dan Yao, Tian-meng Sun, Song-yin Huang, Shuang Dou, Ling Lin,...

www.sciencetranslationalmedicine.org/cgi/content/full/4/130/130ra48/DC1

Supplementary Materials for

Targeted Delivery of PLK1-siRNA by ScFv Suppresses Her2+ Breast Cancer Growth and Metastasis

Yan-dan Yao, Tian-meng Sun, Song-yin Huang, Shuang Dou, Ling Lin, Jia-ning Chen, Jian-bin Ruan, Cheng-qiong Mao, Feng-yan Yu, Mu-sheng Zeng, Jian-ye Zang, Qiang

Liu, Feng-xi Su, Peter Zhang, Judy Lieberman,* Jun Wang,* Erwei Song*

*To whom correspondence should be addressed. E-mail: [email protected] (E.S.); [email protected] ( J.W.); [email protected] ( J.L.)

Published 18 April 2012, Sci. Transl. Med. 4, 130ra48 (2012)

DOI: 10.1126/scitranslmed.3003601

The PDF file includes:

Materials and Methods Fig. S1. Schema for pAcGP67B. Fig. S2. Nucleotide sequence of the F5-P insert in the pAcGP67B vector. Fig. S3. Expression and purification of F5-P fusion protein. Fig. S4. F5-P delivers siRNA only into Her2+ breast cancer cell lines or Her2+ primary breast cancer cells. Fig. S5. PLK1-siRNA directed against an alternative oligonucleotide sequence (PLK1-siRNAa) delivered by F5-P reduces PLK1 expression and inhibits proliferation of Her2+ breast cancer cells. Fig. S6. PLK1-siRNA delivered by F5-P induces apoptosis in Her2+ breast cancer cells. Fig. S7. Expression of siRNA-insensitive PLK1 confers resistance to PLK1-siRNA. Fig. S8. PLK1-siRNA complexed with F5-P inhibits proliferation and increases apoptosis of cancer cells by reducing PLK1 expression in Her2+ breast cancer tumors. Fig. S9. PLK1-siRNA delivered by F5-P inhibits proliferation and increases apoptosis of cancer cells by reducing PLK1 expression in Her2+ primary breast cancer tumors. Fig. S10. Intravenous injection of F5-P/PLK1-siRNA complexes suppresses Her2+ breast tumor growth in nude mice. Fig. S11. Administration of F5-P/PLK1-siRNA complexes suppresses Her2+ breast cancer metastasis in nude mice. Fig. S12. F5-P–mediated siRNA delivery does not induce IFN responses in vitro and in vivo.

Fig. S13. A cocktail of siRNAs targeting PLK1, CCND1, and AKT delivered by F5-P has enhanced antitumor effects in vitro and in vivo. Table S1. Sequences of siRNAs. Table S2. Primers and probes for qRT-PCR and in situ hybridization (ISH). Table S3. Incidence of tumors from BT474 and MDA-MB-231 cells inoculated in BALB/c nude mice. Table S4. Incidence of tumors from Her2+ and Her2− primary breast tumor cells inoculated in BALB/c nude mice. Table S5. Cardiac, liver, and kidney function in BALB/c nude mice bearing BT474 tumors injected with F5-P/PLK1-siRNA. Table S6. Cardiac, liver, and kidney function of BALB/c nude mice bearing MDA-MB-231 tumors injected with F5-P/PLK1-siRNA.

SUPPLEMENTARY MATERIAL Materials and Methods Primary breast tumor specimens Primary breast tumor specimens were obtained from 7 female patients with biopsy-diagnosed ductal carcinomas of the breast with informed consent following a protocol approved by the Ethics Committee of the Sun-Yat-Sen Memorial Hospital. Her2 overexpression was identified in 5 cases as determined by both immunohistochemistry and in situ hybridization. The average tumor diameter was 7.4±1.8 cm, and axillary lymph node metastasis was identified in all 7 cases. Surgical specimens were obtained at the time of resection, and all specimens were received in the laboratory within 20 minutes. The tumor specimens were then divided for primary cultures and tissue implantation. For primary cultures, breast tumors were disaggregated mechanically and digested with collagenase. Single cell suspensions were obtained by filtration through a 70 µm cell strainer (BD Biosciences). Her2+ primary breast cancer cells were enriched by magnetic antibody cell separation (MACS) (MiltenyiBiotec). For implantation, tumor specimens were aseptically cut into ~2 mm3 pieces and implanted into the mammary fat pad (MFP) of mice. Tumor formation was obtained in ∼20% of the mice implanted, and treatment was initiated in the mice when the xenografts were palpable (∼0.5 cm in diameter). Cell cultures Human breast cancer cell lines SKBR3, BT474 and MDA-MB-231 and a human embryonic kidney cell line HEK-293T were purchased from the American Type Culture Collection. The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Invitrogen, USA). Breast cancer cells that stably express eGFP were generated by infection with pBabe-puro-EGFP following a published protocol (34) and sorted by FACS for GFP+ cells (35). Primary cultures of breast cancer cells isolated from primary tumor specimens were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 20% FBS (Invitrogen). siRNAs All siRNA duplexes were obtained from GenePharma Co., Ltd. (oligonucleotide sequences provided in tab. S1). To enhance stability, the sense strand of all siRNAs was modified by 2’-O-methylation of all U and C residues. For control transfections, siRNAs were transfected in vitro using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Following incubation overnight, the medium was replaced with DMEM containing 10% or 20% FBS prior to further study. Dual marker-labeled siRNAs For pharmacokinetics experiments, PLK1-siRNAs were custom synthesized by Ribo Life Science Co., dually labeled at the 5’-end of the sense strand with biotin for ELISA capture and at the 5’-end of the antisense strand with dinitrophenol (DNP) for detection, with the following sequences 5′-biotin-UmGmAAGAAGAUCmAmCCmCUCCUUmA-3′ (sense) and

1

5′-DNP-UAmAGGAGGGUGAUCUfUCUfUCfA-3′ (antisense). To enhance siRNA stability, the sense and antisense strands were modified by 2’-O-methylation (m) or 2′-fluoro-2′-deoxynucleoside (f) at residues marked with ‘m’ or ‘f’ in the upper right. ELISA assay An enzyme-linked immunosorbent assay (ELISA) was used to quantify dually labeled siRNAs in serum. PLK1-siRNAs, serially diluted in phosphate-buffered saline (PBS)/0.1% diethyl pyrocarbonate (DEPC), human or mouse serum, were incubated in 96-well streptavidin-coated plates for 3 hours at 37°C, and washed three times with PBS/0.1% DEPC and 0.1% Tween-20 (DEPC-PBST). Monoclonal anti-DNP mouse IgG (Santa Cruz) was added to each well and incubated for 1 hour at 37°C. After washing three times with DEPC-PBST, horseradish peroxidase-conjugated goat anti-mouse IgG (Santa Cruz) was added and the plate was incubated for 1 hour at 37°C. After five washes with DEPC-PBST, the 1-step Turbo TMB-ELISATM (Pierce) reagent (100 μL) was added to each well, and the reaction was stopped after 10 minutes at room temperature by adding 100 μL 1N H2SO4. Absorbance at 450 nm was read with a microplate reader (Bio-Tek). Every sample was measured using the data in the absence of any added siRNA as background. ELISA assay of siRNAs in blood Animal experiments were performed according to a protocol approved by the Sun Yat Sen University Laboratory Animal Care and Use Committee. Six week-old female Balb/c-nude or Balb/c mice were injected via tail vein with 2 mg/kg dually labeled PLK1-siRNA. In some mice, 40 μg of dually labeled PLK1-siRNA was complexed with 20 μg of F5-P in 200 μL of PBS before injection. Blood was collected at indicated times and 30 μL was diluted to 250 μL with heparinized DEPC-PBS buffer and added to streptavidin-coated 96-microwell plates and assayed as described above. Isothermal titration calorimetry (ITC) assay. F5-P (4 μM) and PLK1-siRNA (150 μM) samples in 500 mM NaCl, 50 mM Tris-HCl (pH 7.4) were filtered and degassed before titration. F5-P was loaded into the cell and PLK1-siRNA samples were loaded into the syringe and added with a stirring speed of 1000 r.p.m. (Microcal VP-ITC calorimeter). Data were collected in the high feedback mode with a filter period of 5 s. The calorimetric data were processed and fitted into the single set of identical sites model using Microcal Origin (version 6.0) and analyzed by the software supplied with the instrument. Titration of F5-P binding to siRNA To evaluate the capacity of F5-P to bind siRNA, 200 pmol FAM-siRNA was added to a mixture of F5-P and protein G beads (Pierce) coupled with anti-protamine antibody (Santa Cruz) at various protein:siRNA ratios. After overnight incubation at 4°C, the absorbance at 488 nm of the washed beads was determined and plotted against a standard curve as described previously (10). Background binding to beads in the absence of F5-P was negligible.

2

Gel retardation assay Indicated amounts of PLK1-siRNA were mixed with F5-P in equal volumes and incubated at 4°C for 30 minutes. The mixture was then resolved on 1% (w/v) agarose gels and visualized after ethidium bromide staining by UV illuminator. Confocal laser scanning microscopy (CLSM) Cellular uptake of FAM-siRNA or Cy3-siRNA was evaluated using a Zeiss LSM 710 confocal microscope. The cytoplasm was counterstained with Lyso-Tracker (red, Invitrogen), F-actin with Alexa-Fluor 488 labeled Phalloidin (green, Invitrogen), and nuclei with Hoechst or DAPI (blue, Sigma) prior to fixation with 4% formaldehyde. Cell proliferation [3H]-thymidine (1 μCi) was added to 2×104 cells in octuplicate microtiter wells for 6 hours prior to harvesting and analysis by scintillation counting using a Beckman LS 1701 liquid scintillation system (Beckman Coulter, Inc.). MTT assay To assay cell growth, BT474 cells were incubated for 4 hours with 0.5 mg/mL MTT (Sigma), and resuspended in 100 μL dimethylsulfoxide (DMSO) (Sigma). Absorbance (A) was recorded at 570 nm using an Easy Reader 340 AT (SLT-Lab instruments). Cell viability was expressed as the percentage of untreated control. Soft agar assay To determine anchorage-independent growth, cells (1×104 cells/well) were resuspended in DMEM supplemented with agar at a final concentration of 0.35%, and then layered with DMEM supplemented with 0.6% agar and cultured for 14 days. The percentage of cells that formed colonies was determined by staining with crystal violet and counting using phase-contrast microscopy. Apoptosis analysis To assess apoptosis, cells were incubated with Annexin V and PI solution (BD Biosciences) at room temperature for 15 minutes according to the manufacturer’s protocol. Stained cells were analyzed by flow cytometry using a FACSCalibur flow cytometer (BD Biosciences) with WinMDI 2.9 software. Quantitative RT-PCR Real-time reverse transcription PCR was performed using an ABI Prism 7000 Sequence Detection System (Perkin-Elmer Applied Biosystems). SYBR green (Molecular Probes) was used to detect PCR products. All reactions were performed in a 20 μL reaction volume in triplicate. Primers for human PLK1, human GAPDH, human HPRT, mouse 18S rRNA, human 18S rRNA, human INFβ, human STAT1, human OAS1 (tab. S2) were obtained from TaKaRa (Takara Biotechnology). PCR amplification consisted of an initial denaturation step at 95°C for 5 minutes, followed by 40 cycles of PCR at 95°C for 20 seconds, 60°C for 30 seconds. Standard curves were generated and the relative amount of target gene mRNA was normalized to

3

GAPDH mRNA. Specificity was verified by melt curve analysis and agarose gel electrophoresis. To quantify cancer metastasis in mouse lungs and livers, qRT-PCR analysis of human hypoxanthine-guanine-phosphoribosyltransferase (hHPRT) was performed with Trizol (Life Technologies)-isolated total RNA using described primers for human HPRT (hHPRT) and mouse 18S rRNA. Following reverse transcription for 45 min at 42°C and Taq polymerase activation for 3 min at 95°C, 40 cycles of PCR at 95°C for 12 seconds, 62°C for 30 seconds were performed. Western blot Protein extracts were resolved by SDS-PAGE, transferred to PVDF membranes, and probed with mouse monoclonal or rabbit polyclonal primary antibodies against human PLK1 (Santa Cruz), Her2 (Santa Cruz), p-AKT (Santa Cruz), Ki-67 (Santa Cruz) or β-actin (Santa Cruz), and then with peroxidase-conjugated goat anti-mouse or goat anti-rabbit Ig secondary antibodies (Santa Cruz). Blots were visualized by chemiluminescence (Pierce). Tumor xenografts Female 4-6 week old, athymic BALB/c-nu mice were used. All animal experiments were approved by the Sun Yat Sen University Laboratory Animal Care and Use Committee. BT474 cells (5×106/mouse) or MDA-MB-231 cells (2×106/mouse) were injected in PBS either subcutaneously into the mammary fat pad or intravenously in the tail vein. Beginning 24 hours later and biweekly thereafter, complexes composed of 40 μg of PLK1 siRNA and 20 μg of F5-P in 200 μl of PBS, precomplexed as described, were injected in the tail vein. Tumor volume (TV) was calculated weekly for 7 weeks according to the formula TV (mm3) = length × width2 × 0.5. Tumor xenografts and mouse lungs and livers were harvested, weighed, and snap-frozen for cryosectioning and RNA extraction later on. Cryosections (4 μm) were stained with hematoxylin and eosin (HE) and evaluated by TUNEL assay and immunohistochemistry for Her2, PLK1, and Ki-67 expression. To evaluate in-vivo metastasis, fluorescent images of whole mice or their lungs and livers were acquired using an IVIS Lumina Imaging System. Survival experiments were also performed in the tumor bearing mice treated as above, and Kaplan-Meier survival curve with log rank test was plotted. IVIS Lumina Imaging To evaluate in vivo siRNA delivery, SKBR3 (5×106), BT474 (5×106) or MDA-MB-231 cells (2×106), suspended in 100 μL of PBS, were implanted subcutaneously into the mammary fat pads of female BALB/c-nu mice as described above. When xenografts were palpable (~5 mm in diameter), 200 μL of PBS containing 40 μg of FAM-siRNA, Cy3-siRNA or Cy5-siRNA pre-complexed with 20 μg of F5-P was injected via tail vein. Whole body fluorescent images were acquired at indicated intervals using an IVIS Lumina imaging system (Xenogen) with excitation at 488 nm or 565 nm. Tumor xenografts were harvested, snap-frozen and cryosectioned for fluorescence microscopy and H＆E staining. To assess the in vivo tissue distribution of intravenously administered Cy5-labeled siRNAs, the fluorescent

4

signals in each tissue were visualized using an IVIS Lumina imaging system and the fluorescence signal in each tissue was analyzed with Living Image software ver. 3.0. Immunohistochemistry For immunohistochemistry, mouse anti-PLK1 monoclonal antibody (Abcam) or mouse anti-Ki-67 polyclonal antibody (Santa Cruz) were used as primary antibodies for overnight incubation of tissue sections at 4°C. Sections were then treated with goat anti-mouse secondary antibody, followed by further incubation with streptavidin-horseradish peroxidase complex. Diaminobenzidine (DAB; Dako) was used as a chromogen and sections were lightly counterstained with haematoxylin. The percentage of PLK1 and Ki-67 positive tumor cells was calculated by counting 1,000 tumor cells. Terminal deoxynucleotidyl transferase (TdT)–mediated dUTP (TUNEL) staining TUNEL assay was performed using an In-situ Apoptosis Detection Kit, peroxidase (POD) or alkaline phosphatase (AP) (Roche) according to the manufacturer’s instruction. Briefly, after digesting slides with Protease K (Roche), the TdT reaction mix was applied at 37°C for 60 minutes, followed by incubation with Converter-POD or Converter-AP at 37°C for 30 minutes. The reaction product was visualized using 3,3’-diaminobenzidine (DAB) Substrate or AP Substrate. Approximately 1000 tumor cells were counted (200×) in each section, and an apoptotic index (AI) was calculated as the percentage of TUNEL-positive tumor cells. In Situ Hybridization Slides were submerged in 0.2 N HCl for 5 minutes, and rinsed twice in PBS. After treatment with 40 μg/mL Proteinase K (Roche) for 20 minutes, slides were prehybridized at 49.5°C for 2 hours in hybridization buffer, and were hybridized overnight at 49.5°C with digoxigenin-labeled PLK1-siRNA probe (Exiqon, tab. S2). Digoxigenin signal was detected with anti-digoxigenin antibody (Roche), followed by subsequent incubation in staining solution and NBT/BCIP developing solution at 4°C in the dark. Nuclei were counterstained with nuclear fast red. Interferon assay BT474 cells (1×106/2 mL) were mock treated or treated with F5-P/PLK1-siRNA complexes (300 pmol) or poly (I:C) (5 µg/mL). After 24 h, RNA was isolated and analyzed by quantitative RT-PCR for induction of IFN or interferon responsive genes (tab. S2) as described below. IFNα and IL-6 protein in the serum of siRNA-treated mice were measured with a quantitative enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems) according to the manufacturer’s instructions.

Statistics

All in vitro experiments were performed either in triplicate or in pentuplicate. SPSS software 13.0 (SPSS, Chicago, IL) was used for statistical analyses. Measurement data were presented as mean ± standard deviation (SD). Statistical analysis was performed by one-way analysis of variance (ANOVA). The differences between the

5

means were tested by an independent sample t-test or Bonferroni’s multiple comparison t-test. The χ2 test was used to compare percentages. The significance level used was P < 0.05.

6

Supplemental table 1. Sequences of siRNAs

Notes:

siRNA Sequences (5′-3′) PLK1-siRNA

PLK1-siRNAa

mutPLK1-siRNA

Her2-siRNA

NC-siRNA

Sense 5′-UGAAGAAGAUCACCCUCCUUADTDT-3′

Antisense 5′-UAAGGAGGGUGAUCUUCUUCADTDT-3′

Sense 5′-CGGCUGCCCAUCCUACGGACCUGDTDT-3′

Antisense 5′-CAGGUCCGUAGGAUGGGCAGCCGDTDT-3′

Sense 5′-UGAAGAAGAUCACUCUCCUCADTDT-3′

Antisense 5′-UGAGGAGAGUGAUCUUCUUCADTDT-3′

Sense 5′-UCACAGGGGCCUCCCAGGAGDTDT-3′ ,

Antisense 5′-CCUGGGGAGGCCCCUGUGACADTDT-3′

Sense 5′-UUCUCCGAACGUGUCACGUDTDT-3′

Antisense 5′- ACGUGACACGUUCGGAGAADTDT -3′

PLK1-siRNAa: alternative PLK1 siRNA with different oligonucleotide sequences from PLK1-siRNA mutPLK1-siRNA: siRNA targeting to a mutated PLK1 gene with synonymous oligonucleotide mutation at 2 different codons of the PLK1-siRNA targeting site NC-siRNA: noncoding control siRNA

20

Supplemental table 2. Primers and probes for qRT-PCR and ISH

Notes: qRT-PCR: quantitative RT-PCR; ISH: in-situ hybridization

Gene Primer and probes (5′-3′) Human PLK1

Human GAPDH

Human HPRT

Mouse 18S rRNA

Human 18S rRNA

Human Interferon β

Human STAT1

Human OAS1

PLK1 siRNA-LNA™ detection probe

Forward, 5'-AGCCTGAGGCCCGATACTACCTAC-3'

Reverse, 5′- ATTAGGAGTCCCACACAGGGTCTTC-3′

Forward, 5′- TTCACCACCATGGAGAAGGC-3′

Reverse, 5′- GGCATGGACTGTGGTCATGA-3′

Forward, 5′- TTCCTTGGTCAGGCAGTATAATCC-3′

Reverse, 5′- AGTCTGGCTTATATCCAACACTTCG-3′

Forward, 5′- CGGCTACCACATCCAAGGAA-3′

Reverse, 5′- GCTGGAATTACCGCGGCT-3′

Forward, 5′- CGGCTACCACATCCAAGGAA-3′

Reverse, 5′- GCTGGAATTACCGCGGCT-3′

Forward,5'-CATCTAGCACTGGCTGGAATGAG -3'

Reverse, 5'- TCCAGGACTGTCTTCAGATGGTTTA -3'

Forward, 5'- TCCGTGGCACTGCATACAATC -3'

Reverse, 5'- ACCATGCCGAATTCCCAAAG -3'

Forward, 5'- AGGTAGCTCCTACCCTGTGTGTGTG -3'

Reverse, 5'- GAAGACAACCAGGTCAGCGTCA -3'

5′-UGAAGAAGAUCACCCUCCUUA-DIG-3′

21

Supplemental table 3. Incidence of tumors from BT474 and MDA-MB-231 cells

inoculated in BALB/c-nude mice

MFP Inoculation Tail Vein Inoculation

BT 474 cells MDA-MB-231 cells BT 474 cells MDA-MB-231 cells

Number of Cells Inoculated (5×106) (2×106) (5×106) (1.5×06)

Tumors Tumors Lung metastasis Liver metastasis Lung metastasis Liver metastasis

PBS 8/8 8/8 8/8 8/8 8/8 8/8

F5-P+PLK1-siRNA 2/8# 8/8 4/8

* 4/8

* 8/8 8/8

F5-P 8/8 8/8

8/8

PLK1-siRNA 8/8 8/8

8/8

F5-P+NC-siRNA 8/8 8/8 8/8

Notes: MFP: mammary fat pads; *, P<0.05; #P<0.01 vs. PBS.

22

Supplemental table 4. Incidence of tumors from Her2+ and Her2- primary breast

tumor cells inoculated in BALB/c nude mice

MFP Inoculation

Her2+ primary breast cancer blocks Her2- primary breast cancer blocks

Size of Tissues Inoculated 2 mm3 2 mm3

Tumors Tumors

PBS 6/6 6/6

F5-P+PLK1-siRNA 6/6 6/6

F5-P 6/6

PLK1-siRNA 6/6

F5-P+NC-siRNA 6/6

23

Supplemental table 5. Cardiac, livers and kidneys function in BALB/c-nude mice bearing BT474 tumors injected with F5-P/PLK1-siRNA.

Treatment CK LDH CK-MB ALT AST Total bilirubin Direct bilirubin Creatinine Urea nitrogen

(U/L) (U/L) (U/L) (U/L) (U/L) (μmol/L) (μmol/L) (μmol/L) (mmol/L)

PBS 594.9±340.6 599.1±266.4 634.7±210.3 28.6±8.9 106.8±10.7 1.00±0.36 0.59±0.33 59.0±13.5 13.4±0.7

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)

F5- P+PLK1-siRNA 644.8±82.6 561.3±118.6 609.8±100.8 25.3±4.3 93.4 ±21.8 0.98±0.17 0.54±0.26 57.6±8.7 13.1±0.6

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)

P-value vs PBS P=0.631 P=0.506 P=0.706 P=0.450 P=0.092 P=0.763 P=0.487 P=0.157 P=0.780

F5-P 654.3±275.6 575.8±195.2 495.6±106.5 32.7±6.7 106.3±11.8 0.96±0.39 0.43±0.26 66.5±9.9 12.9±2.7

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n =8)


Free PLK1-siRNA 723.3±221.2 522.0±174.9 626.1±321.7 29.1±7.3 108.0±13.4 0.93±0.31 0.56±0.36 56.8±14.4 11.6±1.6

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)


F5-P+NC-siRNA 747.3±237.7 532.5±229.7 527.1±247.7 30.3±7.2 110.4±10.3 0.98±0.28 0.68±0.31 62.5±13.7 13.5±1.3

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)


24

25

Supplemental table 6. Cardiac, liver and kidney function of BALB/c nude mice

bearing MDA-MB-231 tumors injected with F5-P/PLK1-siRNA

Treatment CK LDH CK-MB ALT AST Total bilirubin Direct bilirubin Creatinine Urea nitrogen

(U/L) (U/L) (U/L) (U/L) (U/L) (μmol/L) (μmol/L) (μmol/L) (mmol/L)

PBS 659.4±186.9 557.5±182.2 634.8±296.9 28.7±4.50 103.8±10.2 0.96±0.31 0.59±0.35 63.4±6.2 13.7±1.6

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)

F5-P+PLK1-siRNA 644.4±216.4 589.3±212.2 707.3±255.7 29.6±10.3 104.0±11.3 0.95±0.30 0.44±0.37 59.5±20.8 14.5±1.1

(n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8) (n=8)

P P value P=0.820 P=0.626 P=0.559 P=0.806 P=0.970 P=0.938 P=0.307 P=0.544 P=0.152

,

Supplementary Materials for · Yan-dan Yao, Tian-meng Sun, Song-yin Huang, Shuang Dou, Ling Lin,...

Documents

Transcript of Supplementary Materials for · Yan-dan Yao, Tian-meng Sun, Song-yin Huang, Shuang Dou, Ling Lin,...