Supplementary Materials for

The mitotic kinesin KIF11 is a driver of invasion, proliferation, and self-

renewal in glioblastoma

Monica Venere, Craig Horbinski, James F. Crish, Xun Jin, Amit Vasanji,

Jennifer Major, Amy C. Burrows, Cathleen Chang, John Prokop, Quilian Wu, Peter A.

Sims, Peter Canoll, Matthew K. Summers, Steven S. Rosenfeld,* Jeremy N. Rich*

*Corresponding author. E-mail: rosenfs@ccf.org (S.S.R.); richj@ccf.org (J.N.R.)

Published 9 September 2015, Sci. Transl. Med. 7, 304ra143 (2015)

DOI: 10.1126/scitranslmed.aac6762

This PDF file includes:

Materials and Methods

Fig. S1. iPAGE gene ontology analysis of the Spearman correlation for KIF11 in

the NE and CE regions.

Fig. S2. Subtype analysis for patient-derived xenograft specimens.

Fig. S3. Synchronization of TICs and non-TICs.

Fig. S4. Stem cell frequency after KIF11 inhibition.

Fig. S5. Representative cell synchronization histograms.

Fig. S6. Weights of mice during the orthotopic preclinical study.

Table S1. Patient data correlating with the Kaplan-Meier survival curves.

Legends for movies S1 and S2

References (51–53)

Other Supplementary Material for this manuscript includes the following:

(available at

www.sciencetranslationalmedicine.org/cgi/content/full/7/304/304ra143/DC1)

Movie S1 (.mov format). Representative movie from an untreated organotypic

slice culture from a rodent glioma model.

Movie S2 (.mov format). Representative movie from an ispinesib-treated

organotypic slice culture from a rodent glioma model.

www.sciencetranslationalmedicine.org/cgi/content/full/7/304/304ra143/DC1

Supplementary Materials:

Supplemental Materials and Methods

Study design

The objective of this study was to evaluate the impact of KIF11 modulation on

proliferation and invasion of TICs and explore the in vivo potential of KIF11-directed

therapies in GBM. For in vitro studies, multiple patient-derived xenograft-maintained

GBM specimens were used, and experiments included three or more biological

replicates and at least three technical replicates. For in vivo subcutaneous studies, mice

were randomized into control or treatment groups when tumors reached approximately

0.12 cm3. Sample sizes (n = 5 per group) were sufficient to determine statistically

significant differences in tumor size between groups, and all measurements were

included. For preclinical intracranial studies, mice were randomized into control or

treatment group 7 days after injection, when luciferase signal validated initiation of

tumor burden, with a sample size of ten mice per group to determine statistically

significant differences in survival. For all studies, the experimenter was not blinded.

Full experimental details are provided below.

Bioinformatics

Radiographically localized RNA-Seq data from human GBMs were reported

previously by the authors (21) and are publically available from the Gene Expression

Omnibus under accession GSE59612. Differential expression was calculated using

DESeq2 from raw counts obtained with HTSeq (51). Differential expression was

calculated relative to fresh, non-neoplastic brain tissue specimens as described

previously (21). GBM subtype was determined by comparison to TCGA classification

data (22) as described previously (21, 51).

In vivo studies

All animal studies described were approved by the Cleveland Clinic Foundation

Institutional Animal Care and Use Committee and conducted in accordance with the

NIH Guide for the Care and Use of Laboratory Animals. For subcutaneous tumor

studies, 1 x 105 freshly dissociated GBM cells from a xenograft originally derived from a

primary GBM patient specimen (3691) were injected into the flanks of 10 six week old

female athymic nu/nu mice. Tumors were allowed to reach approximately 0.12 cm3, at

which point animals were randomized into either vehicle control (DMSO) group or

ispinesib (Selleck Chemicals; 10 mg/kg given daily for 7 consecutive days by

intraperitoneal injection). Tumors were monitored and measured daily using

perpendicular diameter measurements for 7 days. Tumor volume was calculated using

the ellipsoid formula: /6 x larger diameter x (smaller diameter)2. After the last

treatment on Day 7, tumors were removed and weighed, then processed for

immunofluorescence. For intracranial implantation studies to evaluate tumor initiation

by TICs, the cells were isolated as described below and pre-exposed to drug or vehicle

either in vitro or in vivo. For in vitro pre-exposure studies, TICs from xenograft 3691

were seeded at single cell density and treated with vehicle or ispinesib (3 nM) for 18

hours (1 x 106 cells per condition). Drug was then washed off, and 2,500 or 25,000

viable TICs were implanted into the right frontal lobes of male NSG mice (n = 10 for

vehicle, n = 7 for ispinesib). For in vivo pre-exposure studies, subcutaneous tumors

were established as described above. When tumors reached ~0.5 cm3, mice were

randomized into a vehicle (DMSO) or ispinesib (10 mg/kg given daily for 3 consecutive

days) group. 4 hours after the final treatment, TICs were isolated as described below,

and 1,000 or 10,000 viable TICs were intracranially implanted into NSG mice (10 mice

per group). Mice were monitored daily for neurological impairment, at which time they

were sacrificed and brains removed to evaluate for tumor development. For survival

studies, 10,000 luciferase-expressing TICs were injected intracranially in each of a

group of 20 NSG mice. The presence of a tumor was confirmed at day 7 after injection

by detecting a luminescence signal (IVIS Spectrum, Perkin Elmer). Mice were then

randomized into two groups of 10, with one group receiving vehicle (DMSO) and the

other ispinesib (10 mg/kg, administered every 4 days for 6 doses), both administered by

intraperitoneal injection. Mice were monitored daily for weight loss and neurological

signs indicative of brain tumor development.

The PDGF-IRES-GFP retrovirus was produced according to methods previously

described (35). P3 neonatal Sprague-Dawley rats were anesthetized by hypothermia.

Briefly, each pup was carefully wrapped in several layers of gauze and then covered

with ice. After 12 minutes, the rat pup’s head was placed in a DKI 963 Stereotaxic

Alignment Instrument (David Kopf Instruments). The bregma was identified, and a small

hole was poked into the skull with a sterile 18 gauge needle, 1 mm rostral and 2 mm to

the right of the bregma. A 27-gauge Hamilton microsyringe was then inserted to a depth

of 1.5 mm, and 2 µl of virus was injected at a rate of 0.2 µl/min.

Isolation and culture of TICs and non-TICs

Human tissues were acquired from primary human brain tumor patient

specimens in accordance with appropriate approved Institutional Review Board

protocols. Tumor grade and available cytogenetic information for each specimen has

been previously described (23-25). Tumor specimens were maintained through

subcutaneous xenografts in the flanks of athymic NU/NU or NSG mice. Tumors were

dissociated using a papain dissociation system (Worthington Biochemical). TICs were

isolated as previously described and detailed below (27).

Tissue microarray and survival analysis

Deidentified tissue microarrays (TMAs) were constructed from gliomas after

obtaining University of Kentucky Institutional Review Board Approval. Three 2-mm

diameter cores per tumor were obtained, with each core embedded in a separate TMA

block. A total of 104 cases comprised the TMAs, including 9 nonneoplastic controls

(cortical dysplasias), 9 grade II astrocytomas, 11 grade III astrocytomas, 12 anaplastic

oligodendrogliomas, 16 grade II oligodendrogliomas, and 47 grade IV glioblastomas

(GBMs). Each TMA core was semiquantified on a relative scale from 0 to 3, with 0 =

negative KIF11 signal and 3 = strongest KIF11 signal. Results from all 3 cores were

averaged together to produce a final score for a tumor. Results were plotted based on

WHO grade, and differences were calculated via one-way ANOVA with post-hoc

Tukey’s test. Survival data for each case were obtained from the Kentucky Cancer

Registry, and the degree of expression was correlated with survival via Log-rank

(Mantel-Cox) Tests.

Quantitative RT-PCR

Total RNA was isolated with the RNeasy isolation kit (Qiagen) and reverse transcribed

into cDNA using the qScript cDNA SuperMix (QuantaBiosciences). mRNA was labeled

with SYBR Green MasterMix (Applied Biosystems), and concentrations of mRNA were

measured on an Applied Biosystems 7900HT cycler. Expression values were

normalized to β-actin, GAPDH, or 18S. To construct a subtype heat map, Z-scores were

calculated with delta Ct values.

Cell synchronization and APC/C assay

TICs and non-TICs were plated adherently on Geltrex. Synchronization at G1/S

was achieved by exposing the cells to 2 mM thymidine for 18 hours, followed by washes

with PBS and a release in fresh medium for 8 hours, then a second exposure to 2 mM

thymidine, and a final wash and release in fresh medium. Validation of synchronization

was achieved via flow cytometry using propidium iodide. In vitro APC/C assays were

performed as described with modifications (52). Mitotic cells were collected by shake-off

and replated in fresh media. After 4 hours, G1 cells were collected and flash frozen in

liquid nitrogen. Thawed pellets were resuspended in 0.7 volumes of lysis buffer (20 mM

Tris-HCl, [pH 7.2], 2 mM DTT, 0.25 mM EDTA, 5 mM KCl, 5 mM MgCl2). The freeze

thaw was repeated. Extracts were then passed 10 times through a 20 g needle,

followed by 5 passes through a 27 g needle. Supernatants were divided into single-use

aliquots and flash-frozen in nitrogen. For assays, extracts on ice were supplemented

with an energy-regenerating system (30 U/ml rabbit creatine phosphokinase type I, 7.5

mM creatine phosphate, 1 mM ATP, 1 mM MgCl2, 0.1 mM EGTA) and cycloheximide in

a final volume of 20 µl and a final extract concentration of 6 mg/ml. 1 µl of in vitro

translated HA-tagged substrate was added; aliquots were made and shifted to 30°C.

Samples were quenched at the indicated times by the addition of sample buffer,

resolved by SDS-PAGE, and processed for western blotting.

Dose response and cell viability assays

The half maximal effective concentration of ispinesib for acutely dissociated and

MACS sorted matched TICs and non-TICs was determined by plating, in triplicate,

1,000 cells per well of a 96 well plate pre-coated with Geltrex in growth factor-free

Neurobasal medium (Gibco). The next day, cells were exposed to 2-fold increasing

concentrations of ispinesib spanning from 0 to 32 nM. Viability was measured at 72

hours using CellTiter-Glo ATP-based assay (Promega) read on a luminometer (Perkin-

Elmer). For long-term viability assays, 500 cells per well were plated in triplicate into 96-

well plates as above. The next day, cells were exposed to 3 nM ispinesib or vehicle

(DMSO), and viability was measured daily for 5 days using CellTiter-Glo. Day 0

readings were taken immediately after addition of drug or vehicle. SubG1 for TICs and

non-TICs was determined by flow cytometry for propidium iodide and gated as the

events below the 2N G1 peak of the resulting histogram. Analysis was performed after

treatment of 100,000 cells with vehicle or 3 nM ispinesib. Cells were fixed at Day 0-4 in

100% cold ethanol and simultaneously processed for flow analysis with 20,000 events

analyzed per condition.

Transwell assay

08-387 TICs enriched in G1 (8 hours after final thymidine release) were pre-

exposed to vehicle or ispinesib (using a range of concentrations in 2-fold dilution steps,

ranging from 200 to 0 nM) for one hour before being seeded onto 8 μm Matrigel-coated

FluoroBlok Cell Culture Inserts at 125,000 cells per insert (± vehicle or ispinesib, plated

in triplicate) with Neurobasal medium supplemented with 10% FBS in the lower

reservoir (BD Falcon). After 8 hours, membranes were processed for analysis and

nuclei stained with DAPI. Nuclei on the lower surface of the membrane within the

central field were scored using the 20X objective on a Leica DMIRB inverted

microscope.

Nascent process analysis

08-387 TICs enriched in interphase were seeded at 6,000 cells per well of a 6

well plate and allowed to adhere for 1 hour. Cells were then exposed to vehicle or 200

nM ispinesib, and images recorded over a 6-hour period using the IncuCyte ZOOM

(Essen Biosciences). Process formation was measured using CellPlayer NeuroTrack

Software Module (Essen Biosciences).

Wound assay

Interphase-enriched 08-387 TICs were seeded within two-well culture inserts

(ibidi) at 2x105 cells per ml in triplicate (final volume of 80 μl per well) onto Geltrex

coated glass bottom 6 well pates (MatTek Corp.). After 2 hours, the insert was removed

and cells were exposed to vehicle or 200 nM ispinesib. 6 hours later, cells were fixed

and processed for immunofluorescence as described below for αtubulin. 20 Z-stack

images at the wound edge were captured per condition using the 40X objective on a

Leica DMI6000 inverted microscope. Images were then exported as tif files using

Velocity software and analyzed in ImageJ. Regions of interest were drawn for the

primary cell layer at the wound edge for 3 independent scans per Z-stack representing

the top, middle, and bottom portions of the cell layer, and pixel intensity and area were

measured.

Time-lapse microscopy

At days P8, P9, and P10, PDGF-IRES-GFP injected rat pups were anesthetized

with ketamine/xylazine cocktail and decapitated. Brains were isolated and 300-µm

coronal sections were taken in the vicinity of the injection site using a McIlwain tissue

chopper. The slices were transferred onto a porous 0.4-µm culture plate insert

(Millipore) and then placed into Glass Bottom 6 well plates (P06G-0-20-F, MatTek Corp)

containing slice culture medium (MEM, 2 mM L-glutamine, 10% NaCl, 10% glucose,

insulin-transferrin-selenium (Sigma, I2521), and antibiotic-antimycotic (Gibco). Microglial

and perivascular cells of the brain sections were stained with Isolectin GS-IB4,

Alexafluor594 conjugate (Invitrogen) for 30 minutes at 37oC, washed with PBS, and

returned to a humidified atmosphere at 5% (CO2). Images of the brain slices for time-

lapse microscopy were acquired with a Perkin Elmer UltraView Spinning Disk

microscope on a Leica DMI 6000 with a 10x Plan Apo 0.4 NA objective lens. During

imaging, the brain slices were placed in a stage mounted 37oC incubator where 60%

humidity and 5% CO2 was maintained. For analysis details see below.

Tumorsphere assay

TICs were isolated from patient-derived flank xenografts of specimens by

magnetic sorting and allowed to recover overnight. The next day cells were exposed to

vehicle or 3 nM ispinesib for 18 hours. Cells were then washed and gently resuspended

to disrupt any cell aggregates and then filtered through a round-bottom FACS tube with

a cell-strainer cap (BD Falcon) to ensure that cells were in a single cell suspension.

Cell sorting was performed using a FACS Aria II Cell Sorter (BD Biosciences) to plate

the cells into 96 well plates at a final cell number per well of 1 (38 wells/plate), 5 (24

wells/plate), 10, 20, or 50 (all at 12 wells/plate). Tumorsphere formation was evaluated

10 days after sorting, and wells were scored positive or negative for the presence of at

least one tumorsphere. The estimated stem cell frequency was calculated using an

algorithm based on a Poisson distribution to calculate an estimated stem cell frequency.

(33). Only live cells were selected for using Live/Dead blue dye (Life Technologies).

qPCR primers

β-actin forward 5’-ACCTTCTACAATGAGCTGCG-3’ and reverse 5’-

CCTGGATAGCAACGTACATGG-3’; GAPDH forward 5’-GAAGGTGAAGGTCGGAGTC-

3’ and reverse 5’- GAAGATGGTGATGGGATTTC-3’; AURKA forward 5’-

CAGTACATGCTCCATCTTCCAG-3’ and reverse 5’-AAAGAACTCCAAGGCTCCAG-3’;

AURKB forward 5’-TGGAAACGTGTACTTGGCTC-3’ and reverse 5’-

AGGATGTTGGGATGGTGC-3’; BUB1B forward 5’-CTACAGTGTTGACCTTAGGGTG-

3’ and reverse 5’-GTGCTAAATCTGCTATACCAAACAG-3’; CDC20 forward 5’-

CAAGGTGGCTGAACTCAAAG-3’ and reverse 5’-AGGGTCCAACTCAAAACAGC-3’;

FZR1 forward 5’-TTCTGGAACACGCTGACAG-3’ and reverse 5’-

GGATCTGGTTCTGTGAGTAGC-3’; CDK1 forward 5’-AAACCAGGAAGCCTAGCATC-

3’ and reverse 5’-ATGATTCAGTGCCATTTTGCC-3’; MAD2L1BP forward 5’-

CCGAAAACCTTCTCCCCAG-3’ and reverse 5’-GGTACTAGTGTCCGTGCAAAG-3’;

KIF11 forward 5’-TGTAGATGCTGGTGTGGATTG-3’ and reverse 5’-

CTCTTTGTAACCAAGTGCTCTG -3’; MAD2L1 forward 5’-

GACAGATCACAGCTACGGTG-3’ and reverse 5’-GGCGGACTTCCTCAGAATTG-3’;

PLK1 forward 5’-ACAGTGTCAATGCCTCCAAG-3’ and reverse 5’-

CACAGAGCTGATACCCAAGG-3’; SNCG forward 5’-

GAGAAAGAGGAAGTGGCAGAG-3’ and reverse 5’-AGCCGCATGTCACTCAAG-3’;

TTK forward 5’-AAAGGGACCCAAAACAGAGG-3’ and reverse 5’-

ACAAGTTGGCCCAGAACATAT-3’; ; OLIG2 forward 5’-CTGGCGTCCGAGTCCAT-3’

and reverse 5’-CCTGAGGCTTTTCGGAGC-3’; CD133 forward 5’-

TTTTGGATTCATATGCCTTCTGT-3’ and reverse 5’-ACCCATTGGCATTCTCTTTG-3’;

SOX2 forward 5’-GTCATTTGCTGTGGGTGATG-3’ and reverse 5’-

AGAAAAACGAGGGAAATGGG-3’; FOXO3 forward 5’-

GGTGAATTTCCAATCATCAGC-3’ and reverse 5’- CGAGCTATAGACACCCTGAATG-

3’; GABRB2 forward 5’-GGAACAATACTACCTAAGGACAA-3’ and reverse 5’-

AGTTTGCAACTTAAATCTCAGTT-3’; MBP forward 5’-AGGTCTCGTTCCGTGCTG-3’

and reverse 5’-GCCACCATCCCTTGTGAG-3’; NES forward 5’-

GCAGCAGGAAATATGGGAAG-3’ and reverse 5’-TCTCATGGCTCTGGTTTTCC-3’;

PDGFA forward 5’-GACCGATCCTCAAGCATCTC-3’ and reverse 5’-

AAGGACAAGCGGACAAAATG-3’ GCACAAGCCACAAGTGTTCC; EGFR forward 5’-

CTCCGTTTCTTCTTTGCCCAG-3’ and reverse 5’-GCACAAGCCACAAGTGTTCC-3’;

FGFR3 forward 5’-GCGCTAACACCACCGACAAG-3’ and reverse 5’-

TGAACAGGAAGAAGCCCACC-3’; AKT2 forward 5’-

ACATCATCTCGTACATGACCAC-3’ and reverse 5’-CTCTGCAAAGAGGGCATCAG-3’ ;

CD44 forward 5’-TGACACTGTCCAAAGGTTTTC-3’ and reverse 5’-

TCACTAATAGGGCCAGCCTC-3’; YKL40 forward 5’-CCAAGGAGCCAAACATCCTA-3’

and reverse 5’-GAAGGGGAAGTAGGATAGGGG-3’; TIMP1 forward 5’-

TGGTAACTCTTTATTTCATTGTCCG-3’ and reverse 5’-

CTGAAAAGGGCTTCCAGTCC-3’; and TGFβ1 forward 5’-

GCCAGATCCTGTCCAAGCTG-3’ and reverse 5’-GGTGACCTCCTTGGCGTAGTA-3’.

TIC isolation TICs were isolated on the basis of surface expression of glycosylated CD133

enriched either by FACS (anti-CD133/2 (293C3)-APC, human) or magnetic activated

cell sorting (anti-CD133/1 (AC133), human) as per manufacturer’s recommendations

(MACS; Miltenyi Biotec) and grown as tumorspheres or adherently plated on Geltrex

(Life Technologies). All cells were cultured at 37C in an atmosphere of 5% CO2. TICs

were cultured in Neurobasal medium (Life Technologies) with B-27 (without Vitamin A;

Life Technologies), basic fibroblast growth factor (bFGF, 10 ng/ml; R&D Systems),

epidermal growth factor (EGF, 10 ng/ml; R&D Systems), L-glutamine (2 mM; Life

Technologies), and sodium pyruvate (1 mM; Life Technologies). Freshly isolated non-

TICs were grown in DMEM (Cleveland Clinic Media Productions Core) supplemented

with 10% fetal bovine serum (Life Technologies) and validated to be of tumor origin

(26). After isolation, cells were used in experiments in under 5 passages. For

comparative experiments involving TICs and non-TICs, cells were grown in the same

culture conditions of Neurobasal medium without growth factors with a 24 hour pre-

exposure for culture normalization before running the experiment. For cell counting

before each experiment, a single cell suspension was achieved using TrypLE (Life

Technologies).

Tissue microarray immunohistochemistry

For immunohistochemistry, 5 µm TMA slides were baked at 60°C for one hour,

followed by deparaffinization in xylene and stepwise hydration in alcohol to TBS-Tween.

Endogenous peroxidases were quenched with 3% hydrogen peroxide for 5 minutes,

and antigen retrieval was performed with Dako’s high pH antigen retrieval buffer by

heating to 110°C for 20 minutes in a Biocare medical decloaking chamber followed by

cooling to room temperature. Slides were blocked in 5% normal goat serum in TBST for

20 minutes and incubated in anti-KIF11 primary antibody (BD Biosciences) for 1 hour at

room temperature. After washing in TBST, rabbit secondary antibody was applied for 30

minutes at room temperature (Dako Envision+ kit) followed by TBST washes and

detection with DAB. Slides were then counterstained in Mayer’s hematoxylin for 5

minutes and blued in ammonia water before dehydrating and cover slipping.

Cell migration analysis

Fluorescent time-lapse image stacks consisting of ~80 frames (7 minute

intervals) were imported into Image-Pro Plus (v7.0, Media Cybernetics). Glioma cell

tracking for each treatment group (55 cells/group) was performed in a semi-automated

fashion using a combination of Fourier correlation and user-guided input. Cells selected

for tracking were chosen randomly from the periphery of the tumor mass in each image

stack. X and Y coordinates from each cell track were exported to Excel and translated

such that each cell's track originated from a common origin (0,0), and represented the

projection of the 3-dimensional migratory path onto the 2-dimensional plane. The

resulting data were displayed in a Wind-Rose plot for each treatment group. Mean-

square displacement for tracked cells in each group was analyzed using a persistent

random-walk model (37). Speed (μm/s) and persistence (min) were extracted using a

non-linear least-squared regression to the model equation for each track and averaged

for each treatment group.

Immunoblotting

Protein extracts were made using a 50 mM Tris pH 8.0, 120 nM NaCl, 0.5% NP-

40 lysis solution. Resulting lysates were ran on 10% SDS-PAGE gels and transferred to

Immobilon-FL PVDF (Millipore Corp.). The membranes were blocked with 5% (wt/vol)

bovine serum albumin in PBS-Tween-20 (0.2% vol/vol) and probed with primary

antibodies against KIF11 (mouse, 1:4000, BD Biosciences), OLIG2 (rabbit, 1:1000,

Abcam), GFAP (DAKO; 1:10,000), or βactin (mouse, 1:8000) as a loading control.

Secondary antibodies (LI-COR) were incubated in TBST+ 0.02% SDS and visualized

with the LI-COR Odyssey near infrared imaging system.

Immunofluorescence imaging

Subcutaneous or intracranial tumors were fixed overnight in 4% PFA at 4°C,

washed in PBS, cryoprotected in 30% sucrose, then embedded in optimal cutting

temperature compound (OCT) and stored at −80°C (Sakura Finetek USA). Sections

were cut using a Leica CM 1950 cryostat at 10 m directly onto slides (Leica

Microsystems Inc.). Sections were postfixed for 15 minutes at room temperature in 4%

PFA followed by PBS washes, then incubated in blocking solution (5% goat serum,

0.1% Triton X-100 in PBS). Primary antibodies were diluted in blocking solution and

used as follows overnight at 4°C: SOX2 (rabbit, 1:500, Abcam), αtubulin (rat, 1:1000,

AbD Serotec). Secondary was AlexaFluor488 (1:500, Invitrogen) mixed in blocking

solution and incubated for 2 hours at room temperature. DNA was stained using 4′,6-

diamidino-2-phenylindole (DAPI, 10 μg/ml, Sigma) diluted in PBS for 5 minutes at room

temperature

Statistical analysis

Statistical significance was calculated with GraphPad Prism Software using a 1-

or 2-way ANOVA with Bonferroni’s post-test, Student’s t-test, or log-rank (Mantel-Cox)

test where appropriate (GraphPad Software Inc.). Data are represented as the mean

standard deviation. Statistics for the tumorsphere assays were generated using the

eLDA software (33). For the RNA-seq data, we used FPKM expression values

computed using Cufflinks 2 to calculate the correlation of each gene with KIF11

expression (51). In each case, we used the Spearman correlation. For genome-wide

analysis, we used iPAGE (53), a mutual information-based algorithm, to assess the

statistical enrichment of specific pathways as a function of KIF11 correlation.

Supplemental Figures

Fig S1. iPAGE gene ontology analysis of the Spearman correlation for KIF11 in

the NE and CE regions. Expression across all annotated genes in the A) NE and B)

CE regions of human GBM shows an association with cell cycle control (DNA replication

and mitotic cell cycle). Additional pathways that are correlated with KIF11 expression

are consistent with actively growing and dividing cells and involve transcriptional

activity, chromatin, and protein synthesis. In the NE regions, where there is a

substantial contribution from normal neural cell types, we see anti-correlation in

neuronal ontologies including synapse, voltage-gated ion channels, neuropeptide

binding, and serotonin receptor.

Fig S2. Subtype analysis for patient-derived xenograft specimens. qPCR was performed

for the listed panel of genes on RNA isolated from non-neoplastic brain, neural progenitor cells,

and three patient-derived xenografts.

Fig S3. Synchronization of TICs and non-TICs. (A) TICs and non-TICs from

xenograft patient specimen 08-387 were harvested for flow cytometry every 2 hours for

24 hours total after synchronization at G1/S using a double-thymidine block. Results

are presented at percentage of cells gated in G1/G0, S, and G2/M based on propidium

iodide and percentage of cells gated in M based on pH3S10. (B) TICs and non-TICs

from xenograft specimen 3691 were synchronized at G1/S using a double-thymidine

block. After release, whole cell lysates were made every 2 hours over a 10-hour time

course. Asynchronous (A) lysates were also harvested. Resulting lysates were probed

for KIF11. (C) TICs and non-TICs from xenograft specimen 08-387 were synchronized

at G1/S using a double-thymidine block. After release, whole cell lysates were made

every 2 hours over a 24-hour time course. Asynchronous (A) lysates were also

harvested. Resulting lysates were probed for CDC20. βactin served as a loading

control. Molecular weight (MW) of resulting bands is given in kilodaltons (kD).

Fig S4. Stem cell frequency after KIF11 inhibition. TICs were isolated from

xenografts for patient specimens 3565, 3691, and 08-387 (3 biological replicates for

each xenograft) and plated at a range of concentrations from 50 down to 1 cell per well.

Wells were scored 10 days later for the presence of a tumorsphere. Results were then

run through an algorithm to predict the estimated stem cell frequency. Results from the

first two xenografts harvested for each specimen are shown.

Fig S5. Representative cell synchronization histograms. Schematic and

representative flow profiles of cell synchronization scheme to enrich for TICs in

interphase. Interphase enriched cells were then used in transwell assays, wound

assay, and process tracking. Enrichment permits delineation of the G2/M arrest caused

by KIF11 inhibition from an impact of KIF11 inhibition on cell motility.

Fig S6. Weights of mice during the orthotopic preclinical study. Mice were

monitored for weight loss and neurological signs indicative of brain tumor development

and/or drug toxicity.

Table S1. Patient data correlating with the Kaplan-Meier survival curves. Tissue

sample identification, diagnosis (AA, anaplastic astrocytoma; GBM, glioblastoma; O2-3,

oligodendroglioma grade II or III; AO, anaplastic oligodendroglioma; A2-3, astrocytoma

grade II or III), KIF11 level (scored as high or low based on anti-KIF11 signal), patient

age, status of radiation or temozolomide (TMZ) treatment (1 = treated, 0 = untreated,

n/a = not available), overall survival (OS, months), and DOD (date of death, 1 = known,

0 = unknown) are listed for the grade III and grade IV patients stratified by low or high

levels of KIF11 protein expression (anti-KIF11 score).

Movie S1. Representative movie from an untreated organotypic slice culture from

a rodent glioma model. Glioma cells (green) and microglia (red) within a 300 m thick

section through the tumor-bearing portion of the rat brain were captured over an 18-

hour time frame using time-lapse microscopy and formatted at 20 frames per second.

Movie S2. Representative movie from an ispinesib-treated organotypic slice

culture from a rodent glioma model. Glioma cells (green) and microglia (red) within

a 300 m thick section through the tumor-bearing portion of the rat brain were treated

with 200 nM ispinesib and captured over an 18-hour time frame using time-lapse

microscopy and formatted at 20 frames per second.