Supplementary Materials for · 5/27/2016 · Harry E. Gruber, Michelle Hanna, Douglas J. Jolly,...
Transcript of Supplementary Materials for · 5/27/2016 · Harry E. Gruber, Michelle Hanna, Douglas J. Jolly,...
Supplementary Materials for
Phase 1 trial of vocimagene amiretrorepvec and 5-fluorocytosine for
recurrent high-grade glioma
Timothy F. Cloughesy, Joseph Landolfi, Daniel J. Hogan, Stephen Bloomfield,
Bob Carter, Clark C. Chen, J. Bradley Elder, Steven N. Kalkanis, Santosh Kesari,
Albert Lai, Ian Y. Lee, Linda M. Liau, Tom Mikkelsen, Phioanh Leia Nghiemphu,
David Piccioni, Tobias Walbert, Alice Chu, Asha Das, Oscar R. Diago, Dawn Gammon,
Harry E. Gruber, Michelle Hanna, Douglas J. Jolly, Noriyuki Kasahara, David McCarthy,
Leah Mitchell, Derek Ostertag, Joan M. Robbins, Maria Rodriguez-Aguirre,
Michael A. Vogelbaum*
*Corresponding author. Email: [email protected]
Published 1 June 2016, Sci. Transl. Med. 8, 341ra75 (2016)
DOI: 10.1126/scitranslmed.aad9784
This PDF file includes:
Materials and Methods
Fig. S1. Simplified schematic for the phase 1 trial (NCT01470794).
Fig. S2. Tumor-specific Toca 511 staining in re-resected tumors after multiple
cycles of Toca FC.
Fig. S3. Evidence of potential pseudoprogression on resected tumor after Toca
511 and Toca FC treatment.
Fig. S4. Comparison of subjects with glioblastoma at first or second recurrence
treated with Toca 511 and Toca FC to lomustine.
Fig. S5. Peripheral blood CD4+ T cell modulation after Toca 511 and Toca FC
dosing.
Fig. S6. Tracking of Toca 511 DNA and RNA signal in whole blood and plasma
over time.
Fig. S7. Molecular classification of tumor samples from study subjects based on
mRNA expression.
Fig. S8. Intratumor versus intertumor heterogeneity in RNA expression profiles.
Fig. S9. No relationship between variation in mRNA expression and confounding
technical factors.
Fig. S10. No correlation between neural subtype and prognosis in newly
diagnosed glioblastoma.
www.sciencetranslationalmedicine.org/cgi/content/full/8/341/341ra75/DC1
Fig. S11. Identification of an mRNA profile (SRNS) associated with longer
survival after Toca 511.
Fig. S12. No correlation between SRNS and prognosis in newly diagnosed
glioblastoma.
Fig. S13. Study survival–related neural subtype samples likely derive from
nonenhancing regions of tumors.
Fig. S14. Negative expression between SPOC1 expression and subject survival
time with Toca 511 and Toca FC therapy.
Fig. S15. MGMT promoter methylation.
Table S1. Toca 511 and Toca FC: Baseline demographic and clinical
characteristics.
Table S2. Additional baseline demographic and clinical characteristics.
Table S3. Dosing cohorts.
Table S4. Detection of Toca 511 in re-resected tumors.
Table S5. Best overall response in the efficacy evaluable population.
Table S6. Adverse events and serious adverse events related to Toca 511 and
Toca FC.
Table S7. Related adverse events: Toca 511 and Toca FC compared to lomustine.
Table S8. Adverse events regardless of attribution: Toca 511 and Toca FC
compared to lomustine.
Table S9. Summary of multivariate analysis for survival (TCGA neural
signature).
Table S10. Summary of multivariate analysis for survival (SRNS signature).
References (45, 46)
Other Supplementary Material for this manuscript includes the following:
(available at www.sciencetranslationalmedicine.org/cgi/content/full/8/341/341ra75/DC1)
Table S11 (Microsoft Excel format). RNA sequencing normalized results (reads
per kilobase of transcript per million mapped reads values).
Table S12 (Microsoft Excel format). SRNS gene list.
Table S13 (Microsoft Excel format). Subject summary.
Supplemental Materials and Methods
qPCR and qRT-PCR for Toca 511 DNA and RNA in human blood and plasma
DNA was extracted from previously frozen whole blood using DNA extraction kits and
following the manufacturer’s suggested protocol (Qiagen). RNA was extracted from
previously frozen plasma using RNA extraction kits and following the manufacturer’s
suggested protocol (Qiagen). qPCR and qRT-PCR protocols were previously described
(7, 8).
RNA isolation and quantification
Tumor pieces were separated from frozen bulk tumor with a scalpel on dry ice. Total
RNA was isolated either using Maxwell 16 Total RNA Purification Kit (Promega) or via
sequential purification with SurePrep RNA/DNA/Protein Purification Kit (Fisher),
followed by DNase treatment and further purification via miRneasy kit (Qiagen). RNA
was quantified on the Nanodrop 8000. RNA integrity was determined using Tapestation
(Agilent).
Library prep and sequencing
100-200 ng total RNA was depleted of ribosomal RNA (NEB) and converted into
barcoded sequencing libraries using TruSeq Stranded mRNA LT (Illumina). Libraries
were sequenced on an Illumina Hiseq machine generating ~3 x 107; 100-130 base
single-end reads per sample on average.
Alignment and post-alignment processing
These steps were performed on an Amazon Web Services instance running an Ubuntu
14 Linux environment. Raw sequencing results in the form of FASTQ files were used as
input for alignment of the sequencing data to the human ENSEMBL reference RNA
database GRCh37. ENSEMBL and human genome (hg19) annotation files were
retrieved from the Tophat website, which links to the Illumina iGenome collection.
Alignments were performed with Tophat2, which produced BAM alignment files to the
human genome (hg19) (45). Tophat BAM files were used directly as input into Cuffdiff2
to generate normalized reads per kilobase of transcript per million mapped reads
(RPKM) values (table S11).
Sequencing data analyses
Sequencing analyses focused on transcripts annotated as “protein_coding.” Gene-
centric normalized RPKM values were filtered as follows: mRNAs with average RPKM <
1 were removed, remaining mRNAs were log2 (RPKM +1) transformed, and each
mRNA was then normalized by subtracting its mean log2 (RPKM+1) value. Clustering
was performed with Cluster 3.0 using average-linkage uncentered Pearson correlation,
and results were visualized with Java Treeview. Other analyses and graphs were
produced in R.
TCGA data
Normalized Affymetrix microarray data and metadata were retrieved from TCGA data
portal. Only flash frozen recurrent tumor samples were available for RNA sequencing
analysis and therefore TCGA –related subtype assignments were not able to follow
TCGA histologic guidelines regarding the degree of necrosis and tumor cell
contamination by normal cells. This was partially controlled for by analyzing multiple
samples from each subject and comparison of RNA expression to normal brain.
Molecular classification
Updated classification gene lists were provided by Roeland Verhaak (MD Anderson),
who developed the classification system and is a member of the TCGA GBM
consortium. Samples were classified by hierarchical clustering using uncentered
Pearson correlation as the distance metric. SRNS signature gene list is provided in
table S12 and classification of samples described in this study is documented in table
S13.
Retrieval and alignment of additional GBM RNA sequencing data
SRA compressed raw sequencing data were retrieved from the GEO website
(GSE59612) (23). SRA files were converted to FASTQ files and processed following the
same protocol as performed for the study samples. Normalized RPKM values were
generated from these 94 samples as well as study samples using Cuffnorm, and the
normalized RPKM values were processed as described above. mRNAs that
systematically tracked with the experimental dataset were identified from an
unsupervised hierarchical cluster (standard deviation > 0.8) and removed. The
“proliferation signature” used in Figure S12 was obtained from Sandberg et al. (46).
Methylated DNA detection and DNA fragmentation
DNA samples were digested with AluI for 3 hours at 37°C. DNA digests were processed
with the MethylMagnet mCpG DNA Fractionation kit (MM101K RiboMed
Biotechnologies) without purification.
Methylated DNA fractionation
Methylated DNA fragments were separated from unmethylated DNA using the
MethylMagnet kit (Ribomed Biotechnologies, Inc) following the manufacturer’s protocol
with the exception that a 10x binding buffer was used to minimize the dilution of the
samples. DNA samples were incubated with magnetic beads bearing a GST-MBD2-
DNA-binding-domain protein for 1 hour at room temperature with mixing at 1000 rpm in
an Eppendorf thermomixer. The supernatant fraction containing unmethylated DNA
fragments was recovered and stored at -20°C. The beads were washed as specified in
the kit manual followed by incubation at 65°C for 10 min with mixing at 1000 rpm to
elute the methylated DNA. The eluted DNA fraction (methylated fragments) was
separated from the beads with a magnet and stored at -20°C.
Coupled abscription PCR (CAP)
End-point, hot-start PCR was performed with 0.5 units Maxima Taq, Maxima hot-start
buffer (ThermoFisher), 800 µM dNTPs, 2 mM MgCl2, and 6% DMSO. Both the
methylated and unmethylated DNA fractions were amplified with PCR primers (RiboMed
Biotechnologies) targeting the AluI fragment that maps between -110 and +149 relative
to the MGMT transcription start site (Forward: APC-DN-
GCGCACCGTTTGCGACTTGG, Reverse: UR-AGCGAGGCGACCCAGACACT). One
primer in the set contained a single-stranded inactive abortive promoter cassette at its 5’
end, which was activated for abortive transcription (Abscription) when made duplex in
the course of copying the target. PCR cycling conditions were: Step 1 94°C, 2 min, Step
2, 57°C, 3 min, Step 3, 72°C, 30 sec, Step 4, repeat Steps 1-3, 2x, Step 5 88.9°C, 5
sec, Step 6, 57.7°C, 15 sec, Step 7, 72°C, 15 sec, Step 8, repeat Steps 5-7, 25x or 27x
for 29 or 31 total cycles, respectively. PCR reaction mixes with 1 µl DNA inputs below
100 genomic copies were amplified for 31 cycles. PCR reaction mixes with 1 µl DNA
inputs between 100 and 500 genomic copies were amplified for 29 cycles. The PCR
reaction volume was 10 µl.
The amplified samples were mixed with equal volumes of Abscription master mix
(RiboMed Biotechnologies) and were incubated at 40-41°C for 15 one minute cycles in
an ABI 7000 Prism qPCR cycler. Abortive transcription of the synthetic promoters
produced short RNAs (abscripts) that annealed to a quenched fluorescein labeled
molecular beacon. Extension of an annealed abscript by the CAP-DNA polymerase
opened the beacon allowing for light emission. Fluorescein fluorescence readings were
taken every minute. The rate of fluorescence increase was proportional to the number
of genomes sampled by PCR. Fluorescence signals were expressed as the slopes of
linear curves relating fluorescence increase to abscription time. Experimental samples
were calibrated in terms of genomic copies using a parallel titration of HeLa DNA.
Percent methylation was calculated as (methylated DNA copies)/(methylated DNA
copies + unmethylated DNA copies)*100. A percentage greater than 11% was
considered positive for methylation.
Supplemental Figures
Figure S1. Simplified schematic for the phase 1 trial (NCT01470794).
This trial involved dose escalation of Toca 511, an investigational non-lytic, retroviral
replicating vector, and Toca FC (an investigational extended-release version of 5-
fluorocytosine, 5-FC). Eligible subjects enrolled in the trial underwent surgical resection
of the recurrent high grade glioma. Subsequently, Toca 511 was injected into the
resection cavity wall via multiple injections to maximize coverage area using a blunt tip
needle with a side port. Virus was allowed to spread for approximately 6 weeks, and
then subjects started repeated cycles of Toca FC.
Fig. S2. Tumor-specific Toca 511 staining in re-resected tumors after multiple
cycles of Toca FC.
IHC staining with anti-CD antibody on resected tumor sections after Toca 511 delivery
and multiple cycles of Toca FC. (A) Section of normal brain where no positive staining is
observed after Toca 511 treatment. (B) Positive staining of CD protein in a tumor
section after Toca 511 treatment. CD protein is stained brown; nuclei are in blue.
Fig. S3. Evidence of potential pseudoprogression on resected tumor after Toca
511 and Toca FC treatment.
(A) H&E stained tumor section with evidence of necrosis and a hypocellular region after
treatment with Toca 511 and Toca FC. (B) Lymphocytic infiltration observed in a
cellular section from the same tumor.
Fig. S4. Comparison of subjects with glioblastoma at first or second recurrence
treated with Toca 511 and Toca FC to lomustine.
Fig. S5. Peripheral blood CD4+ T cell modulation after Toca 511 and Toca FC
dosing.
Changes in absolute CD4+ T cell counts per mL of blood were followed over time using
the CD4+ T cell counts before surgery as baseline for each subject. A significant
increase in CD4+ T cell counts was observed after week 21 (p=0.019 using Wilcoxon
Signed Rank Test).
Fig. S6. Tracking of Toca 511 DNA and RNA signal in whole blood and plasma
over time.
DNA extracted from whole blood and RNA extracted from plasma were analyzed by
qPCR and qRT-PCR, respectively, for Toca 511 polymerase gene signal. The
percentage of subjects with quantitative (%Quant.) DNA (left panel) or RNA (right panel)
Toca 511 signal was plotted as a function of time.
Fig. S7. Molecular classification of tumor samples from study subjects based on
mRNA expression.
mRNA expression patterns of sixty five study tumor samples from twenty seven
biopsies organized by hierarchical clustering of 257 mRNAs used to classify newly
diagnosed glioblastoma samples by molecular subtype. mRNAs associated with each
subtype and samples classified in each subtype are color coded: Classical (C) is black,
Mesenchymal (M) is red, Neural (N) is green, Proneural (P) is blue. Variation in mRNA
expression extends from 0.125-fold (green) to 8-fold (red) from the mean across all
samples (−2 to +2 in log2 scale).
Fig. S8. Intratumor versus intertumor heterogeneity in RNA expression profiles.
(A) Boxplot comparing intra-tumor Pearson correlations in mRNA expression vs inter-
tumor Pearson correlations in mRNA expression. The dark line is the mean, the boxes
confine the interquartile range and the whiskers are 1.5X the interquartile range.
Samples from the same biopsy tended to have a higher correlation in mRNA expression
than samples from other subjects (p = 1e-11, one-sided t-test). (B) Strip chart showing
intra-tumor Pearson correlation(s) in red and inter-tumor correlations in black for each
subject. For instance, two samples from subject 02 were profiled and thus there is one
red dot illustrating that the Pearson correlation across all mRNAs between these two
samples was 0.5, whereas the black dots indicate pairwise Pearson correlations
between each of these two samples compared to the samples from all other subjects.
Fig. S9. No relationship between variation in mRNA expression and confounding
technical factors.
Bar plot showing the coefficient of determination (R2) comparing RNA integrity number
(RIN, black), number of reads (red), and percentage of mapped reads (gray) versus the
first five principal components of the RNA sequencing dataset. None of the correlations
were significant at p < 0.05.
Fig. S10. No correlation between neural subtype and prognosis in newly
diagnosed glioblastoma.
Kaplan-Meier plot of newly diagnosed glioblastoma subjects whose tumor RNA
expression was profiled by TCGA consortium. Patients are color-coded based on TCGA
classifications, including Classical = 130 (black), Mesenchymal = 143 (red), Proneural =
91 (dark blue), Neural = 75 (green), G-CIMP = 31 (cyan) (19). G-CIMP refers to
glioblastoma tumors that are Proneural and also have glioma-CpG island methylator
phenotype, which confers a favorable prognosis (38).
Figure S11. Identification of an mRNA profile (SRNS) associated with longer
survival after Toca 511.
(A) Supervised hierarchical cluster of mRNA expression across sixty four tumor
samples from twenty six efficacy evaluable biopsies based on the relative expression of
890 mRNAs in Cluster 5, Figure 3. Samples segregated into two main groups, which
are color-coded in the dendrogram (black, non-SRNS; magenta, SRNS). (B) Bar plot
representation of the number of samples from glioblastoma tumors with SRNS (purple)
and non-SRNS (black) in subjects that survived less than twelve months (left), greater
than twelve months (middle), or not yet determined (right). (C) Bar plot representation
of the number of samples from glioblastoma tumors with SRNS (purple) and non-SRNS
(black) grouped according to tumor molecular subtype (Figure 4).
Figure S12. No correlation between SRNS and prognosis in newly diagnosed
glioblastoma.
(A) Kaplan-Meier plot of newly diagnosed glioblastoma subjects whose tumor RNA
expression was profiled by TCGA consortium grouped by SRNS (purple - 108) and not
SRNS (black - 164); p = 0.66 log-rank test. This analysis focused on patients treated
with temozolomide who were G-CIMP negative. (B) Bar plot representation of the
number of samples from TCGA newly diagnosed glioblastoma subjects with SRNS
(purple) and non-SRNS (black) grouped according to tumor molecular subtype.
Fig. S13. Study survival–related neural subtype samples likely derive from
nonenhancing regions of tumors.
(A) Unsupervised hierarchical clustering of RNA expression profiles from study subjects,
grouped by molecular subtype, and tumor samples from a recent publication, grouped
by tumor region (23) using 3544 mRNAs with the largest variation in expression. Color
coding of samples is noted to the right of the heatmap. (B) Box plot of “proliferation
signature” mRNA measurements across study tumors, grouped by molecular subtype,
and tumor samples from a recent publication, grouped by tumor region (upper left) or
box plots showing the relative expression of SOX2, MYC, MKI67, ANXA2, and
CDKN2D, respectively.
Fig. S14. Negative correlation between SPOC1 expression and subject survival
time with Toca 511 and Toca FC therapy.
Scatterplot showing relative tumor SPOC1 mRNA expression (x-axis) and subject
survival (y-axis). The error bars are standard error of mean across different tumor
samples from the same subject. Only subjects with glioblastoma are included. The red
line is a least squares fit of mRNA expression vs log10[survival]. Pearson correlation is -
0.71.
Fig. S15. MGMT promoter methylation.
(A) MGMT methylation was determined by measuring the % MGMT promoter
methylation across two regions of the promoter. (B) Any region with >11% is
considered methylation positive. No survival benefit was seen for MGMT methylation
status when subjects underwent Toca 511 and Toca FC therapy.
.
Supplemental Tables
Table S1. Toca 511 and Toca FC: Baseline demographic and clinical characteristics.
Total (N=45)
N (%) Characteristics Age (years) Median 56 Min, Max 24, 72
Sex Male 35 (77.8) Female 10 (22.2)
Race Asian 1 (2.2) Black or African American 1 (2.2) White 43 (95.6)
Baseline Karnofsky performance score 70 4 (8.9) 80 7 (15.6) 90 26 (57.8) 100 8 (17.8)
Initial tumor histology Glioblastoma* 37 (82.2) Anaplastic astrocytoma 5 (11.1) Other glioma** 3 (6.7) Type of primary surgical procedure Gross total resection 33 (73.3) Subtotal resection 12 (26.7) Number of recurrences including current recurrence 1 23 (51.1) 2 10 (22.3) 3 or greater 12 (26.6)
*includes gliosarcoma
**anaplastic ganglioglioma (1), anaplastic oligoastrocytoma (1), anaplastic
oligodendroglioma (1)
Table S2. Additional baseline demographic and clinical characteristics.
Total (N=45)
N (%)
Months since initial diagnosis of HGG
Median 15.5
Min, Max 5.1, 118.6
Total radiation delivered (Gy)
Median 60.0
Min, Max 42.5, 95.0
Number of courses of maintenance
temozolomide
Median 6.0
Min, Max 1.0, 48.0
Prior therapy*
Investigational agent 21 (46.7)
Temozolomide 16 (35.6)
Bevacizumab 8 (17.8)
Lomustine 7 (15.6)
Novocure TTF 5 (11.1)
Gliadel wafer 4 (8.9)
Carboplatin 3 (6.7)
Dendritic cell vaccine 2 (4.4)
Etoposide 2 (4.4)
Radiation 2 (4.4)
* In 2 or more subjects
Table S3. Dosing cohorts.
φ For subjects enrolled in Cohorts 6a and 6b, an additional 6.4 mL Toca 511 was mixed with Surgifoam powder and packed in the resection cavity.
† Toca 511 dosage varies with the titer of each manufactured lot.
Table S4. Detection of Toca 511 in re-resected tumors.
Cohort Dose TU/g Tumor samples positive/total (%)
for vector DNA
Highest DNA value (copies/µg)
Tumor samples positive/ total (%)
for RNA
Highest RNA value (copies/µg)
1 9.5 x 103 10/11 (91) 3728 6/11 (55) 16,273
1 9.5 x 103 4/7 (57) <100 (BLOQ) 0 ND
3 1 x 105 3/5 (60) 479 NT NA
3 1 x 105 47/47 <100 (BLOQ) NT NA
3 1 x 105 0/1 (0) ND 0 ND
5 1 x 106 1/4 (25) <100 (BLOQ) 2/4 (50) <250 (BLOQ)
5 1 x 106 0/7 (0) ND 0 ND
5 1 x 106 5/7 (71) 259 1/7 (14) 20,500
6 3.2 x 106 2/2 (100) <100 (BLOQ) 0 ND
Toca 511 transducing units per gram of brain (TU/g), Below Limit Of Quantification for the assay (BLOQ),
Not available (NA), Not detected (ND), Not tested (NT)
Cohort # N Dosing cohort in TU Toca 511 (mL) Toca FC dose (mg/kg/day)
1 3 1.4 x 107 0.8
130 x 8 days
2 4 3.8 x 107 2.0
3 6 1.5 x 108 0.9
4 6 4.8 x 108 1.1
5a 7
1.5 x 109
3.1
5b 4 3.1 135 x 14 days
5c 3 3.1 170 x 7 days
6a 4 4.8 x 109 3.1 + 6.4 φ
6b 5 220 x 7 days
7a 3 1.2 x109† 3.6
Table S5. Best overall response in the efficacy evaluable population.
Total (N=43)
Cohorts 4-7a (N=30)
n (%) n (%)
Best overall tumor response
Complete response (CR) 2 ( 4.7) 2 ( 6.7)
Partial response (PR) 2 ( 4.7) 2 ( 6.7)
Stable disease (SD) 8 (18.6) 7 (23.3)
Progressive disease 31 (72.0) 19 (63.3)
Overall response rate (CR+PR) 4 (9.3) 4 (13.3)
Clinical benefit rate (CR+PR+SD) 12 (27.9) 11 (36.7)
Table S6. Adverse events and serious adverse events related to Toca 511 and Toca FC.
Toca 511 N=45
N (%)
Toca FC N=43
N (%)
All Grades Grade ≥ 3 All Grades Grade ≥ 3
Subjects reporting at least one adverse event 45 (100.0) 28 (62.2) Subjects reporting at least one AE 42 (97.7) 19 (44.2)
Related treatment emergent adverse events 8 (17.8) 1 (2.2) Related treatment emergent adverse events 16 (37.2) 0 (0.0)
General disorders and administration site conditions 6 (13.3) 1 (2.2) Gastrointestinal disorders 9 (20.9) 0 (0.0)
Nervous system disorders 2 (4.4) 0 (0.0) General disorders and administration site conditions 9 (20.9) 0 (0.0)
Psychiatric disorders 2 (4.4) 0 (0.0) Nervous system disorders 3 (7.0) 0 (0.0)
Eye disorders 1 (2.2) 0 (0.0) Metabolism and nutrition disorders 1 (2.3) 0 (0.0)
Gastrointestinal disorders 1 (2.2) 0 (0.0)
Related serious adverse event 2 (4.4) 0 (0.0) Related serious adverse event 0 (0.0) 0 (0.0)
General disorders and administration site conditions 1 (2.2) 0 (0.0) Adverse event resulting in Toca FC discontinuation 1 (2.2)* 0 (0.0)
Asthenia 1 (2.2) 0 (0.0)
Pyrexia 1 (2.2) 0 (0.0)
Nervous system disorders 1 (2.2) 0 (0.0)
Convulsion 1 (2.2) 0 (0.0) *Grade 2 erythematous pruritus and Grade 2 facial
swelling probably related to Toca FC
Table S7. Related adverse events: Toca 511 and Toca FC compared to lomustine.
Toca 511 & Toca FC
N=27
n(%)
Lomustine
N=84
n(%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Nonhematologic toxicity
Fatigue 2 (7.4%) 0 4 (4.8%) 0
Asthenia 0 1 (3.7%) 0 0
Decreased appetite 1 (3.7%) 0 0 0
Disorientation 1 (3.7%) 0 0 0
Dysgeusia 1 (3.7%) 0 0 0
Nausea 1 (3.7%) 0 2 (2.4%) 0
Pyrexia 1 (3.7%) 0 1 (1.2%) 0
Wound infection 1 (3.7%) 0 0 0
Alanine aminotransferase increased 0 0 1 (1.2%) 1 (1.2%)
Anal ulcer 0 0 0 1 (1.2%)
Candidiasis 0 0 1 (1.2%) 0
Cellulitis 0 0 0 1 (1.2%)
Clostridium difficile colitis 0 0 0 1 (1.2%)
Cushing's syndrome 0 0 1 (1.2%) 0
Diarrhea 0 0 1 (1.2%) 0
Dyspnea 0 0 0 1 (1.2%)
Epistaxis 0 0 1 (1.2%) 0
Febrile neutropenia 0 0 0 1 (1.2%)
Gamma-glutamyltransferase increased 0 0 0 1 (1.2%)
Herpes ophthalmic 0 0 1 (1.2%) 0
Hypoxia 0 0 0 1 (1.2%)
Localized infection 0 0 0 1 (1.2%)
Toca 511 & Toca FC
N=27
n(%)
Lomustine
N=84
n(%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Malaise 0 0 1 (1.2%) 0
Edema peripheral 0 0 2 (2.4%) 0
Pneumonia 0 0 0 1 (1.2%)
Pulmonary function test decreased 0 0 1 (1.2%) 0
Purpura 0 0 1 (1.2%) 0
Stomatitis 0 0 1 (1.2%) 0
Transaminases increased 0 0 0 1 (1.2%)
Vomiting 0 0 1 (1.2%) 0
Hematologic toxicity
Anemia 0 0 1 (1.2%) 2 (2.4%)
Hemoglobin decreased 0 0 2 (2.4%) 0
Leukopenia 0 0 3 (3.6%) 4 (4.8%)
Lymphopenia 0 0 2 (2.4%) 0
Neutropenia 0 0 4 (4.8%) 11 (13.1%)
Neutrophil count decreased 0 0 0 6 (7.1%)
Platelet count decreased 0 0 0 1 (1.2%)
Thrombocytopenia 0 0 9 (10.7%) 20 (23.8%)
White blood cell count decreased 0 0 1 (1.2%) 2 (2.4%)
Table S8. Adverse events regardless of attribution: Toca 511 and Toca FC compared to lomustine.
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Nonhematologic toxicity
Fatigue 10 (37.0%) 3 (11.1%) 7 (8.3%) 1 (1.2%)
Depression 7 (25.9%) 0 2 (2.4%) 2 (2.4%)
Hemiparesis 7 (25.9%) 4 (14.8%) 2 (2.4%) 2 (2.4%)
Hyperglycemia 7 (25.9%) 3 (11.1%) 4 (4.8%) 1 (1.2%)
Incision site pain 7 (25.9%) 0 0 0
Procedural pain 5 (18.5%) 0 1 (1.2%) 0
Anxiety 4 (14.8%) 0 1 (1.2%) 0
Cognitive disorder 4 (14.8%) 0 2 (2.4%) 1 (1.2%)
Headache 4 (14.8%) 3 (11.1%) 8 (9.5%) 3 (3.6%)
Blood glucose increased 3 (11.1%) 0 0 0
Gait disturbance 3 (11.1%) 2 (7.4%) 0 0
Memory impairment 3 (11.1%) 0 2 (2.4%) 0
Nausea 3 (11.1%) 0 4 (4.8%) 0
Aphasia 2 (7.4%) 1 (3.7%) 1 (1.2%) 1 (1.2%)
Arthralgia 2 (7.4%) 0 1 (1.2%) 1 (1.2%)
Asthenia 2 (7.4%) 2 (7.4%) 0 0
Constipation 2 (7.4%) 0 0 0
Convulsion 2 (7.4%) 0 9 (10.7%) 2 (2.4%)
Deep vein thrombosis 2 (7.4%) 1 (3.7%) 0 3 (3.6%)
Fall 2 (7.4%) 0 1 (1.2%) 1 (1.2%)
Fine motor delay 2 (7.4%) 0 0 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Hemianopia homonymous 2 (7.4%) 0 0 0
Hydrocephalus 1 (3.7%) 2 (7.4%) 0 1 (1.2%)
Hypotension 2 (7.4%) 0 0 0
Insomnia 2 (7.4%) 0 2 (2.4%) 0
Mental status changes 0 2 (7.4%) 0 1 (1.2%)
Migraine 2 (7.4%) 0 0 0
Muscular weakness 2 (7.4%) 0 3 (3.6%) 2 (2.4%)
Pulmonary embolism 0 2 (7.4%) 0 2 (2.4%)
Somnolence 2 (7.4%) 0 1 (1.2%) 0
Tremor 2 (7.4%) 0 1 (1.2%) 0
Upper respiratory tract infection 2 (7.4%) 0 2 (2.4%) 0
Urinary incontinence 2 (7.4%) 0 5 (6.0%) 1 (1.2%)
Urinary tract infection 2 (7.4%) 0 0 1 (1.2%)
VIIth nerve paralysis 2 (7.4%) 0 0 0
Vasogenic cerebral edema 2 (7.4%) 0 0 0
Vomiting 2 (7.4%) 0 4 (4.8%) 0
Abdominal pain upper 1 (3.7%) 0 1 (1.2%) 0
Abscess soft tissue 1 (3.7%) 0 0 0
Abulia 1 (3.7%) 0 0 0
Agitation 0 1 (3.7%) 0 1 (1.2%)
Alanine aminotransferase increased 1 (3.7%) 0 2 (2.4%) 1 (1.2%)
Amnesia 1 (3.7%) 0 0 1 (1.2%)
Anesthesia 1 (3.7%) 0 0 0
Ataxia 1 (3.7%) 0 0 0
Balance disorder 1 (3.7%) 0 0 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Benign prostatic hyperplasia 1 (3.7%) 0 0 0
Blindness unilateral 1 (3.7%) 0 0 0
Blood phosphorus decreased 0 1 (3.7%) 0 0
Brain edema 1 (3.7%) 1 (3.7%) 1 (1.2%) 2 (2.4%)
Candidiasis 1 (3.7%) 0 2 (2.4%) 0
Cerebral cyst 0 1 (3.7%) 0 0
Chest pain 1 (3.7%) 0 0 0
Clonus 1 (3.7%) 0 0 0
Confusional state 1 (3.7%) 0 4 (4.8%) 2 (2.4%)
Deafness bilateral 1 (3.7%) 0 0 0
Decreased appetite 1 (3.7%) 0 0 0
Dehydration 1 (3.7%) 0 0 0
Diabetes mellitus 1 (3.7%) 0 0 0
Diarrhea 1 (3.7%) 0 1 (1.2%) 0
Disorientation 1 (3.7%) 0 1 (1.2%) 0
Dysarthria 1 (3.7%) 0 0 1 (1.2%)
Dysgeusia 1 (3.7%) 0 0 0
Dyspepsia 1 (3.7%) 0 0 0
Dyspnea 0 1 (3.7%) 0 3 (3.6%)
Ecchymosis 1 (3.7%) 0 0 0
Executive dysfunction 1 (3.7%) 0 0 0
Facial paresis 1 (3.7%) 0 0 0
Flushing 1 (3.7%) 0 0 0
Gamma-glutamyltransferase increased 1 (3.7%) 1 (3.7%) 0 2 (2.4%)
Grand mal convulsion 0 1 (3.7%) 0 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Hemorrhage intracranial 1 (3.7%) 0 0 0
Hemorrhoids 1 (3.7%) 0 0 0
Hemiplegia 0 1 (3.7%) 0 0
Hemisensory neglect 1 (3.7%) 0 0 0
Hepatic enzyme increased 0 1 (3.7%) 0 0
Herpes zoster 1 (3.7%) 0 0 0
Hypertension 1 (3.7%) 0 0 0
Hypoesthesia 1 (3.7%) 0 1 (1.2%) 0
Hypocalcaemia 1 (3.7%) 0 0 0
Hypokalemia 1 (3.7%) 0 1 (1.2%) 1 (1.2%)
Hyponatremia 0 1 (3.7%) 0 0
Impulsive behavior 1 (3.7%) 0 0 0
Intracranial hypotension 0 1 (3.7%) 0 0
Lacunar infarction 1 (3.7%) 0 0 0
Lethargy 1 (3.7%) 0 0 0
Lobar pneumonia 1 (3.7%) 0 0 0
Loss of proprioception 1 (3.7%) 0 0 0
Malaise 1 (3.7%) 0 1 (1.2%) 0
Medication error 1 (3.7%) 0 0 0
Meningitis 0 1 (3.7%) 0 0
Monoplegia 0 1 (3.7%) 0 0
Musculoskeletal discomfort 1 (3.7%) 0 0 0
Myalgia 1 (3.7%) 0 0 0
Myopathy 1 (3.7%) 0 0 0
Nephrolithiasis 0 1 (3.7%) 0 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Neurologic neglect syndrome 1 (3.7%) 1 (3.7%) 0 0
Neuropathy peripheral 1 (3.7%) 0 0 0
Edema peripheral 1 (3.7%) 0 3 (3.6%) 0
Oral candidiasis 1 (3.7%) 0 0 0
Oropharyngeal candidiasis 1 (3.7%) 0 0 0
Pain 1 (3.7%) 0 0 0
Pain in extremity 1 (3.7%) 0 0 0
Pain in jaw 1 (3.7%) 0 0 0
Pain of skin 1 (3.7%) 0 1 (1.2%) 0
Parkinsonism 0 1 (3.7%) 0 0
Peroneal nerve palsy 1 (3.7%) 0 0 1 (1.2%)
Pneumocephalus 1 (3.7%) 0 0 0
Pneumonia 1 (3.7%) 1 (3.7%) 0 2 (2.4%)
Procedural headache 1 (3.7%) 0 0 0
Purulent discharge 1 (3.7%) 0 0 0
Pyrexia 1 (3.7%) 0 1 (1.2%) 0
Rash 1 (3.7%) 0 0 0
Sensation of heaviness 1 (3.7%) 0 0 0
Shunt infection 0 1 (3.7%) 0 0
Skin laceration 1 (3.7%) 0 0 0
Stomatitis 1 (3.7%) 0 1 (1.2%) 0
Subdural hematoma 1 (3.7%) 0 0 0
Subdural hygroma 1 (3.7%) 0 0 0
Tachycardia 1 (3.7%) 0 0 0
Thrombophlebitis 1 (3.7%) 0 0 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Tooth fracture 1 (3.7%) 0 0 0
Upper motor neuron lesion 1 (3.7%) 0 0 0
Urinary retention 1 (3.7%) 0 0 0
Vision blurred 1 (3.7%) 0 0 0
Visual field defect 1 (3.7%) 0 0 0
Weight decreased 1 (3.7%) 0 0 0
Wound infection 1 (3.7%) 0 1 (1.2%) 0
Wound infection staphylococcal 0 1 (3.7%) 0 0
Abdominal pain 0 0 1 (1.2%) 0
Altered visual depth perception 0 0 1 (1.2%) 0
Anal ulcer 0 0 0 1 (1.2%)
Arrhythmia supraventricular 0 0 1 (1.2%) 0
Back pain 0 0 1 (1.2%) 0
Blindness 0 0 0 1 (1.2%)
Blindness transient 0 0 1 (1.2%) 0
Bronchitis 0 0 1 (1.2%) 0
Cellulitis 0 0 0 3 (3.6%)
Clostridium difficile colitis 0 0 0 1 (1.2%)
Condition aggravated 0 0 1 (1.2%) 0
Coordination abnormal 0 0 1 (1.2%) 0
Cranial neuropathy 0 0 1 (1.2%) 0
Cushing's syndrome 0 0 1 (1.2%) 0
Diplopia 0 0 1 (1.2%) 0
Dizziness 0 0 1 (1.2%) 1 (1.2%)
Dysphagia 0 0 1 (1.2%) 0
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Dysphemia 0 0 1 (1.2%) 0
Ear pain 0 0 1 (1.2%) 0
Epilepsy 0 0 0 1 (1.2%)
Epistaxis 0 0 1 (1.2%) 0
Erysipelas 0 0 0 1 (1.2%)
Euphoric mood 0 0 1 (1.2%) 0
Eye pain 0 0 1 (1.2%) 0
Fecal incontinence 0 0 1 (1.2%) 1 (1.2%)
Febrile neutropenia 0 0 0 1 (1.2%)
Femoral neck fracture 0 0 0 1 (1.2%)
General physical health deterioration 0 0 1 (1.2%) 1 (1.2%)
Glucose tolerance impaired 0 0 0 1 (1.2%)
Hematoma 0 0 0 1 (1.2%)
Herpes ophthalmic 0 0 1 (1.2%) 0
Hiccups 0 0 1 (1.2%) 0
Hypoxia 0 0 0 1 (1.2%)
Immobile 0 0 0 1 (1.2%)
Incontinence 0 0 1 (1.2%) 0
Increased appetite 0 0 1 (1.2%) 0
Infection 0 0 1 (1.2%) 0
Intracranial venous sinus thrombosis 0 0 1 (1.2%) 0
Keratoconjunctivitis sicca 0 0 1 (1.2%) 0
Localized infection 0 0 0 1 (1.2%)
Loss of consciousness 0 0 0 1 (1.2%)
Lower respiratory tract infection 0 0 0 1 (1.2%)
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Motor dysfunction 0 0 1 (1.2%) 0
Neurological symptom 0 0 0 1 (1.2%)
Optic neuropathy 0 0 1 (1.2%) 0
Paresthesia 0 0 1 (1.2%) 0
Partial seizures 0 0 1 (1.2%) 0
Peripheral motor neuropathy 0 0 1 (1.2%) 0
Pharyngolaryngeal pain 0 0 1 (1.2%) 0
Pollakiuria 0 0 0 1 (1.2%)
Post-traumatic pain 0 0 0 1 (1.2%)
Pulmonary function test decreased 0 0 1 (1.2%) 0
Purpura 0 0 1 (1.2%) 0
Pyramidal tract syndrome 0 0 0 1 (1.2%)
Radiation injury 0 0 0 1 (1.2%)
Restrictive pulmonary disease 0 0 1 (1.2%) 0
Speech disorder 0 0 3 (3.6%) 1 (1.2%)
Tinnitus 0 0 1 (1.2%) 0
Transaminases increased 0 0 0 1 (1.2%)
Wheezing 0 0 1 (1.2%) 0
Hematologic toxicity
Lymphopenia 0 1 (3.7%) 3 (3.6%) 0
Anemia 0 0 1 (1.2%) 2 (2.4%)
Hemoglobin decreased 0 0 2 (2.4%) 0
Leukopenia 0 0 4 (4.8%) 5 (6.0%)
Neutropenia 0 0 4 (4.8%) 12 (14.3%)
Toca 511 &Toca FC
N=27
n (%)
Lomustine
N=84
n (%)
Preferred term Grade 2 Grade 3 to 4 Grade 2 Grade 3 to 4
Neutrophil count decreased 0 0 0 6 (7.1%)
Platelet count decreased 0 0 0 1 (1.2%)
Thrombocytopenia 0 0 9 (10.7%) 20 (23.8%)
White blood cell count decreased 0 0 1 (1.2%) 2 (2.4%)
Table S9. Summary of multivariate analysis for survival (TCGA neural signature).
Variable Reference
group
P-value Hazard
ratio
95% hazard ratio
confidence
limits
Subtype Neural 0.0097 0.108 0.020 0.583
Recurrences Recurrences<=2 0.0226 0.262 0.083 0.828
HGG grade Grade 3 0.0021 0.044 0.006 0.321
Table S10. Summary of multivariate analysis for survival (SRNS signature).
Variable Reference group P-value Hazard
ratio
95% hazard
ratio
confidence
limits
Subtype SRNS 0.0032 0.109 0.025 0.476
Recurrences Recurrences<=2 0.0023 0.152 0.045 0.509
HGG grade Grade 3 0.0011 0.047 0.008 0.294