ED 106 392 UD 015 120 Chapman, Thomas H. TITLE Simulation ...
Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122...
Transcript of Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122...
![Page 1: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/1.jpg)
10.1071/AM16010_AC © CSIRO 2018 Australian Mammalogy 40, 243-253
Supplementary material
Tracking and tracing Central Queensland’s Macroderma - determining the size of the Mount Etna ghost bat population and potential threats
John AugusteynA,E, Jane HughesB, Graeme ArmstrongC, Kathryn RealB and Carlo Pacioni D AQueensland Parks and Wildlife Service, PO Box 3130 Red Hill Qld 4701, Australia BGriffith School of Environment, Griffith University, 170 Kessels Road, Nathan, Qld 4111, Australia CNSW National Parks and Wildlife Service, 183 Argent Street, Broken Hill, NSW 2880, Australia DSchool of Veterinary and Life Sciences, Murdoch University, Murdoch, WA 6150, Australia ECorresponding author. Email: [email protected]
Table S1. Caves searched in the Mount Etna area for M. gigas or recent signs of occupation
Cave visited Date Number of M. gigas seen Evidence of M. gigas
Ballroom 14/03/2012 0 No signs 13/02/2013 0 No signs
Bee 21/12/2011 0 No signs
Canyon 13/02/2013 0 No signs
Capricorn Caves 14/03/2012 0 No signs
Carn Dum 15/12/2011 0 No signs
Crystal 21/12/2011 0 No signs
Devils Mouth 13/03/2012 0 No signs 14/02/2013 0 No signs
Dragons Head 14/03/2012 0 No signs 13/02/2013 0 No signs
False Alarm 15/12/2011 0 Some semi recent scats 1 or 2 months old 12/03/2012 0 No signs 27/04/2014 10
Gigas Hall 7/12/2011 8 Lots of scats 14/12/2011 8 Lots of scats 21/12/2011 8 Lots of scats 12/03/2012 3 Lots of scats 27/04/2014 0 Recent scats 14/12/2011 0
Helms Deep 15/03/2012 0 No signs
Honey Comb 14/02/2013 0 No signs
Johansen’s* 5/12/2011 0 No signs 11/12/2011 0 No signs 13/12/2011 0 No signs 21/12/2011 30 Some recent scats in 'Trestle Cave' 3/01/2012 20 Scats 12/03/2012 0
![Page 2: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/2.jpg)
Mt Etna ghost bat population monitoring
2
15/03/2012 0 No signs 14/02/2013 1 22/03/2013
20 Lots of scats between 'E Cave' and 'Rhino' 37 scats collected
Larynx Labrynth 14/03/2012 0 No signs
Lower Johansen’s 15/03/2012 0 No signs 14/02/2013 0 No signs
Main 15/12/2011 0 No signs 15/03/2012 0 No signs
Mine Dusty 21/12/2011 0 No signs
Old timbers 11/12/2011 0 Old scats present 12/03/2012 0
14/02/2013 0 No signs
Shuffle 11/12/2011 0 Some semi recent scats 1 or 2 months old 12/03/2012 0
15/03/2012 0 No signs 22/01/2013 2 14/02/2013 0 No signs 8/01/2015 12 19 scats collected
Strong Word 7/12/2011 0 No recent scats. Old scats present
The Lair 15/12/2011 0 No signs
Walter Reid 14/12/2011 0 Old feeding signs
Winding Stairway 15/12/2011 0 No signs 13/03/2012 0 No signs
Windy Hollow 7/12/2011 0 Two old M. gigas skeletons at bottom of cave
* Several trips were made through Johansen’s Cave after the bats had departed for the evening and the mist nets
erected at the cave entrance/s had been closed.
![Page 3: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/3.jpg)
Mt Etna ghost bat population monitoring
3
Table S2. Details of loci developed from ion torrent sequencing.
Locus Primer sequence (5'-3') Repeat motif Annealing
temperature (°C)
Size range
Number of
alleles HO He
GB 018 F: GAGGTCCAACCTCCTACGCT
AC 55 106-132 4 0.38889 0.62381 R: TAAATCCTTTCCCTGCCACA
GB 020 F: CAATCATCCAGCCACTGTCA
AC 55 118-120 2 0.47368 0.51351 R: GAGAAGAGGTCCTTCCGTCC
GB 021 F: GCAGATGTGCTGCAAGAGAA
AC 55 108-132 6 0.63158 0.65861 R: TCTGTCAGAGCATGGGATCA
GB 033 F: GGTATGGACATGGGCAGGTA
AC 55 199-215 4 0.63158 0.61451 R: GCCCTCTCCTGTCACAGCTA
GB 039 F: GCAGCTAGCTTTAGCGCTCTC
AAC 55 146-160 3 0.63158 0.68137 R: TGGAAGAGCTGGAACAGAACA
GB 042 F: CCTCCTCCAGGATAGTATCAGGT
AC 55 206-219 6 0.875 0.75806 R: TGGTGAGACAAACACAGCCTT
GB 044 F: ATCGCAAAGTTTGTCAAGCA
AG 55 201-205 3 0.21429 0.2037 R: AAACCTCGTTAAATAGCGTTCA
GB 045 F: TGGCATCAGCAGATACAATCC
AC 55 178-212 4 0.5625 0.63105 R: TCCAGGGCTGACACTATTACTT
GB 046 F: TTTCCAGAGACTTCGTTTCCC
AC 55 147-191 4 0.78947 0.66714 R: CAAGGTGATGACAGATTTCTAAGGA
GB 057 F: CTCAGAAAGTGCGGCTAGGA
AT 55 155-179 7 0.55556 0.69524 R: GGCCTTGGTACAGCACTCAC
GB 081 F: TGAGCAACCTCAACACTTTCC
AG 55 186-190 2 0.42105 0.47795 R: GACAGCTCCAACCACGAATC
![Page 4: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/4.jpg)
Mt Etna ghost bat population monitoring
4
Fig. S1. Structure results showing the assignment of each individual from the Mount Etna samples
collected in 2011/2012 and Cape Hillsborough
The analysis identified two as the most likely number of clusters. Each vertical column in the bar plot represents an individual and the y-axis shows the proportion of each individual’s genetic composition that belongs to that cluster. Each cluster is colour-coded. The delta K output is included in a table below.
K Reps Mean LnP(K) Stdev LnP(K) Ln'(K) |Ln''(K)| Delta K
1 4 -1659.5 3.3 — — —
2 4 -1317.3 0.2 342.2 323.5 1459.1
3 4 -1298.7 13.2 18.7 56.7 4.3
4 4 -1336.7 24.6 -38 — —
Table generated with Structure harvester (Earl et al 2012). See Evanno et al (2005) or Structure harvester documentation for details on the headings.
Mt Etna Cape Hillsborough
![Page 5: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/5.jpg)
Mt Etna ghost bat population monitoring
5
Table S3. Genotypes for the scat samples collected in 2015.
Sample GB42 GB81 GIGAS11 GIGAS06 GIGAS01 GB20 GB33 GB39 GB18 GB46
poo2.01 206 206 186 190 120 120 179 185 156 160 120 122 207 209 145 145 110 116 poo2.05 206 208 186 190 120 120 183 185 172 172 120 122 203 209 145 158 110 132 205 205
poo2.07 206 206 190 190 179 185 156 186 122 122 203 209 145 145 110 116 205 209
poo2.13 206 210 186 186 120 134 183 185 153 156 120 122 203 252 145 158 110 116 205 205
poo2.16 212 216 186 186 120 134 179 185 156 156 120 122 209 215 145 160 110 110 205 205
poo2.17 208 210 120 134 183 185 153 156 122 122 215 215 160 160 110 110 poo2.09 120 120 179 179 156 186 120 122 209 209 145 145 116 132 poo2.14 208 210 120 134 183 183 153 156 122 122 215 215 110 110
poo2.19 120 120 179 185 156 160 120 122 209 209 poo2.11 120 134 179 185 156 156 120 122 209 215 110 110
poo2.04 120 134 179 185 156 156 120 122 209 215 106 106
![Page 6: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/6.jpg)
Mt Etna ghost bat population monitoring
6
Fig. S2. Foraging locations of the GPS collared M. gigas and the property boundaries. Successive points obtained from the same location (e.g. the bat was stationary) were removed to improve clarity on the map. Broad vegetation types and the Queensland regional ecosystem type (RE) (Queensland Herbarium 2015) have been included. Barb wire is used to fence a majority of the property boundaries across the M. gigas foraging area.
.
![Page 7: Supplementary material Tracking and tracing Central ... · poo2.04 120 134 179 185 156 156 120 122 209 215 106 106 . Mt Etna ghost bat population monitoring . 6 . Fig. S2. Foraging](https://reader034.fdocuments.us/reader034/viewer/2022042105/5e840818de21e25a9c48bd8e/html5/thumbnails/7.jpg)
Mt Etna ghost bat population monitoring
7
Fig. S3. The average monthly daily minimum temperature for each month between 1988 (when Speaking Tube Cave was destroyed) and 2012 and the difference from the long term monthly minimum average temperature. The months with below average minimum temperatures are those that are represented by the negative values.
-4
-3
-2
-1
0
1
2
3
4
5
6
6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 8 6 7 81988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012
Aver
age
mon
thly
dai
ly m
iniu
m te
mpe
ratu
re
Month and Year
Average minium daily temperature oC for each winter month presented as the difference from the long-term average monthly minium temperature