1

Supplementary Information for

Directing Differentiation of Human Induced Pluripotent Stem Cells Towards Androgen Producing Leydig Cells Rather than Adrenal Cells Lu Li, Yuchang Li, Chantal Sottas, Martine Culty, Jinjiang Fan, Yiman Hu, Garett Cheung, Héctor E. Chemes, Vassilios Papadopoulos Email: vpapadop@usc.edu This PDF file includes:

Supplementary text Figs. S1 to S17

Captions for databases S1 to S7 References for SI reference citations

Other supplementary materials for this manuscript include the following:

Datasets S1 to S7

www.pnas.org/cgi/doi/10.1073/pnas.1908207116

2

Supplemental experimental procedures

Materials Antibodies

Antibody Host Company Catalogue No. Dilution Application

SF-1 Rabbit Cell Signaling 12800S 1:1000 WB

CYP11A1 Rabbit Cell Signaling 14217S 1:500 WB

HSD3B2 Rabbit Abcam ab154385 1:500,

1:100

WB, IF

CYP17A1 Rabbit Abcam ab125022 1:500 WB

HSD17B3 Rabbit ThermoFisher

Scientific

PA5-30063 1:500 WB

LHCGR Mouse Novus

Biologicals

NBP2-53276 1:300,

1:100

WB, IF

LHCGR Rabbit Proteintech 19968-1-AP 1:300 WB

STAR Rabbit Cell Signaling 8449S 1:300

1:30

WB

IP

CYP21B Rabbit Abcam ab230327 1:500 WB

GAPDH Rabbit Cell Signaling 2118L 1:1000 WB

Testosterone Mouse Abbexa Ltd abx132079 1:100 IF

Phosphoserine Mouse Abcam ab6639 1:1000 WB

Rabbit Anti-

Mouse IgG

Rabbit Abcam Ab6728 1:1000 WB

Goat Anti

Rabbit IgG

Goat LI-COR

Biosciences

926-80011 1:4000 WB

qPCR primers (IDT)

Gene Primer FW Primer RW ACTHR GACTGTCCTCGTGTGGTTTTG GGCTGCCCAGCATATCAGAT

ACTIN CCTTGCACATGCCGGAG GCACAGAGCCTCGCCTT

ARA55 TACAGCACGGTATGCAAGCC GCAACCGATCTAGCTCACAGAG

COUP-TFII TTTTCCTGCAAGCTTTCCAC CCGAGTACAGCTGCCTCAA

CREB5 CCCTGCCCAACCCTACAATG GGACCTTGCATCCCCATGAT

CYP11A1 CATCTTCAGGGTCGATGACA AGTCCACCTTCACCATGTCC

CYP11B1 GCGACAGCACTTCTGGATTC GGGTGGCCTACAGACAACAT

CYP11B2 AGCCAGCATCAGTGAACATC GGGATGTGGTAGTTCTGAAGC

CYP17A1 GTTGTTGGACGCGATGTCTA TTCGTATGGGCACCAAGACT

CYP19A1 TGGAAATGCTGAACCCGATAC AATTCCCATGCAGTAGCCAGG

CYP21B AAGGACAGGTCCGGGTAGTT CCAAGAGGACCATTGAGGAA

CYP7B1 ATGCAAGGATGGTCAGAAGTTTT TGGGTGCCGCAGAAGATAATA

EPAS1 CGGAGGTGTTCTATGAGCTGG AGCTTGTGTGTTCGCAGGAA

GNG11 CCTGCCCTTCACATCGAAGAT CTTCTTTGCGAAGCTGCTCAA

GNG12 AGCAAGCACCAACAATATAGCC AGTAGGACATGAGGTCCGCT

GNG2 AACACCGCCAGCATAGCAC CCTGTCGATATTGGCTTCCATCT

HSD17B3 CTGGCGAAGTGCGTGAGATT GAGTACGCTTTCCCAATTCCAT

HSD3B1 CACATGGCCCGCTCCATAC GTGCCGCCGTTTTTCAGATTC

HSD3B2 AGAACGGCCACGAAGAAGAG TGGGTCTTAACGCACAAGTGT

JUN TCCAAGTGCCGAAAAAGGAAG CGAGTTCTGAGCTTTCAAGGT

LHCGR CACATAACCACCATACCAGGAAA AAGTCAGTGTCGTCCCATTGA

3

MICAL2 CCACAAAGAGTATAAGCGAGGG CCAGGTAGGCAAGTTCAATGG

MIXL1 GGCGTCAGAGTGGGAAATCC GGCAGGCAGTTCACATCTACC

NANOG TTTGTGGGCCTGAAGAAAACT AGGGCTGTCCTGAATAAGCAG

OCT4 CTTGAATCCCGAATGGAAAGGG GTGTATATCCCAGGGTGATCCTC

PDE1C GATGTGGACAAGTGGTCCTTTG GGGGATCTTGAAACGGCTGA

PDE3A GAATCCCGTCACTTCGCTCAG GAAACTCGTCTCAACAAGCCA

PDE4D ACGGACCGGATAATGGAGGAG ATTTTTCCACGGAAGCATTGTG

PDE7B TTGACTTCCGCCTACTTAACAGT TAATTCCACGAAGCAGCCTTG

PPARGC1A TCTGAGTCTGTATGGAGTGACAT CCAAGTCGTTCACATCTAGTTCA

PRKAG2 TGCCCGTTATTGACCCTATCA CAGGCTTTGGCATATCAGACAT

SF-1 GCACAGGGTGTAGTCAAGCA CAGGAGTTTGTCTGCCTCAAG

SGMS2 CAAATTGCTATGCCCACTGAATC GTTGTCAAGACGAGGTTGAAAA

C

SMAD3 TGGACGCAGGTTCTCCAAAC CCGGCTCGCAGTAGGTAAC

STAR ACAGACTTCGGGAACATGC TGAGTAGCCACGTAAGTTTGG

STARD13 CGAGGAGACAGAAATGGGTCA TCCACTGCTTTCGCTGTGAAT

TBXT TATGAGCCTCGAATCCACATAGT CCTCGTTCTGATAAGCAGTCAC

TLR6 TGAATGCAAAAACCCTTCACCT CCAAGTCGTTTCTATGTGGTTGA

Plasmid- PLenti-C-mGFP (ORIGENE, #RC207577L2) and SF-1-mGFP (ORIGENE, #

PS100071) were purchased from ORIGENE.

Methods Cell Culture Human Induced Pluripotent Stem Cells (hiPSCs)- hiPSC line (GM25256*B) was purchased

from the Coriell Institute. This hiSPC line was established as previously described (1) and has

passed all tests for human pluripotent stem cells. hiPSCs were plated on Matrigel coated six-

well plates (Corning) and kept in mTeSR1 medium (Stemcell Technologies), 1% P/S (Corning)

with a daily change. hiPSCs were passed by ReLeSR (Stemcell Technologies) in a ratio of 1:6

to 1:10 every 4-7 days whenever they reached 80% confluency.

Cell Induction

Early Mesenchymal Progenitors (EMPs)- On induction day (ID) -2, hiPSCs were washed with

D-PBS (ThermoFisher Scienfitic) and incubated with ReLeSR at room temperature for 15

seconds (s). ReLeSR was discarded and cells were incubated at 37 ℃ for 5 mins. Cells were

washed with 1 ml of mTeSR1 and transferred to a 15 ml falcon tube. 2 ml of mTeSR1 were

used to wash wells and then were transferred into the tube. Cells were gently pipetted up and

down by 1ml micropipette until cell colonies were broken into single cells. Collected cells were

centrifuged at 300 × g for five mins and resuspended in mTeSR1 containing 10 μM Y-27632

(Stemcell Technologies). The cells were plated on Matrigel coated six-well plates in 2 ml

suspension medium at a density of 5 x 105 cells/well. On ID -1, medium was changed to 2 ml

of fresh mTeSR1 medium without Y-27632.

On ID 0-3, cells were cultured with 3 ml of STEMdiff™-ACF Mesenchymal Induction

Medium (Stemcell Technologies, #05241). On ID 4 and 5, cells were cultured with 2 ml of

MesenCult™-ACF Medium, which was composed of MesenCult™-ACF Basal Medium

(Stemcell Technologies, #05451), MesenCult™-ACF 5 x Supplement (Stemcell Technologies,

#05452), 2 mM L-Glutamine (ThermoScientific Fisher), and 1% P/S.

On ID 6, cells were induced into EMPs. Please note, MesenCult™-ACF Medium is no

longer unavailable. It has been replaced by MesenCult™-ACF Plus Medium, which is

4

composed of MesenCult™-ACF Plus Medium (Stemcell Technologies, #05446),

MesenCult™-ACF Plus 500 x Supplement (Stemcell Techonologies, #05447), 2 mM L-

Glutamine, and 1% P/S. Both media could induce EMPs.

In the ACF-SF1 system, we observed a fast proliferation of EMPs from ID 6 to 10 that

reached 100% confluency on ID10. Therefore, we passaged EMPs on ID 10 with a low starting

density (10,000/cm2), allowing them to grow better, and performed the transfection of SF-1

vector on ID 12. In contrast, with COLI-SF1 system we did not observe an increase in cell

proliferation from ID 6 to 10, thus we kept the cells on the original plates without passaging

and performed the transfection of SF-1 vector on ID 8. This meant that transfection occurred

two days after passaging under both culture conditions, keeping the two methods comparable.

Gene Expression Analysis

Quantitative Real-time PCR (qRT-PCR)- Total RNA was prepared using Ambion®

RiboPure™ Kit (ThermoFisher Scientific, #AM1924). RNA (200 ng to 500 ng) was reverse

transcribed into cDNA using PrimeSript™ RT Master Mix (Takara, #RR036A). 6-15 ng cDNA

were used for the detection of each gene. Due to the extremely low expression of CYP11A1,

20-50 ng cDNA were used for its detection. qRT-PCR was performed on a CFX384 Touch™

Real-Time PCR Detection System (Bio-Rad) using a SYBR™ Select Master Mix

(ThermoFisher Scientific) with 100 nM forward and reverse primers (Integrated DNA

Technologies). Data were analyzed using Bio-Rad CFX Maestro software. Relative

quantification analysis was performed following the 2-ΔΔCT method and data were normalized

to actin expression (2).

RNA Sequencing Data Analysis- In order to compare the transcriptome expression pattern of

hLLCs to that of hLCs, we analyzed the published transcriptome data from hiPSCs and hLCs

at first (3). The original RNA-seq data of hiPSCs and human Leydig cells (hLCs) in FASTQ

format were retrieved from NCBI GEO under the following accession numbers: GSE117664

for hiPSCs and GSE74896 for hLCs (https://www.ncbi.nlm.nih.gov/gds). Then, the sequences

from three replicates for hiPSCs and two replicates for hLCs were loaded onto the Galaxy

server (https://usegalaxy.org/) for further analysis. In brief, sequences were analyzed using the

next-generation sequence analysis pipeline, including sequencing mapping with Bowties, etc.

and the results were validated visually in the UCSC Genome Browser (http://genome.ucsc.edu)

with a custom track. For base pair quantitation, the *.BAM files were used as input for further

quantification analysis using SeqMonk software packages

(https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/; Babraham Bioinformatics,

Cambridge, UK). Unsupervised hierarchical clustering results and heat maps were generated

to identify transcripts that were specifically expressed in hiPSCs, or hLCs. Selected

differentially expressed transcripts (FDR < 0.05 and fold change > 5 or < -5) in the comparison

of human Leydig-like cells (hLLCs) versus hiPSCs from microarray data were cross-compared

with the highly and/or poorly expressed genes from hLCs versus hiPSC.

Immunocytochemistry 15,000 to 200,000 single hLLCs were fixed using 4% paraformaldehyde in PBS for 15 min

and washed with PBS 1 time. Fixed hLLCs were centrifuged at 800 x g for 5 min and

resuspended in 500 μl PBS. hLLC suspensions were added into the button of cytofunnels

(ThermoFisher Scientific) that were set up with slides and centrifuged in a cytospin at 2000 x

g for 10 min. Slides were dried for 30 min, fixed in 70% ethanol for 7 min, and dried for another

30 min. Cells were then permeabilized with 0.1% triton X-100 for 10 min and washed with

PBS for 5 min. Thereafter, cells were blocked with blocking solution (PBS containing 4%

5

donkey serum and 1% BSA) for 1 h and incubated with primary antibody in blocking solution

overnight at 4 ℃. Cells were washed with PBS and incubated with corresponding HRP-

conjugated secondary antibodies in blocking solution for 1 h. Cells were washed with PBS

and stained using KPL StableDAB substrate according to the manufacture’s instruction.

Fluorescent immunocytochemistry hLLCs, hALCs, or hiPSCs were fixed using 4% paraformaldehyde in PBS for 20 min and

washed with PBS 3 times. Permeabilization was performed using 0.1% Triton® X-100 for 45

min and washed with PBS 3 times. Cells were blocked with blocking solution for 1 h.

Thereafter, cells were incubated with primary antibody in blocking solution overnight at 4 ℃.

Cells were washed with PBS 3 times and incubated with corresponding secondary antibodies

(ThermoFisher Scientific) diluted 1:1000 in blocking solution for 1 h at room temperature (RT).

Cells were washed with PBS 3 times and stained using Hoechst 33259 diluted 1:5000 in PBS.

Images were obtained with a REVOLVE 4 Upright, Inverted, Brightfield, Fluorescent

Microscope (DISCOVER ECHO INC., #FJSD2001).

Immunoprecipitation and immunoblotting analyses of phosphorylated STAR hLLCs and hiPSCs were lysed in Pierce™ IP Lysis Buffer (ThermoFisher Scientific) with 2%

proteinase inhibitor and 2% phosphatase inhibitor. STAR protein were immonoprecipiated

using Pierce™ Protein A Agarose (ThermoFisher Scientific, #22811) according to the

manufacture’s instructions. 15 ug of total proteins were input with the anti-STAR antibody

overnight at 4 ℃. 100 μl of Elution Buffer were used to elute the immune complex. 10 μl of

the neutralization buffer were added to adjust eluates to physiological PH. 15 μl of eluates were

resolved on 4–20% precast polyacrylamide gels, and transferred to PVDF membranes. After

transfer, membranes were blocked with blocking solutions (PBST containing 10% BSA) for

45 min. Membranes were incubated with the anti-phosphoserine antibody in blocking solutions

for 1 h at RT, washed with PBST 3 times and incubated with corresponding secondary

antibodies for 1 h at RT. Then, antibodies were detected using a Clarity Western ECL Substrate

system (BioRad) and visualized using an Azure c600 western blot imaging system (Azure

Biosystems, #c600).

Stimulation test of dbcAMP and 22(R)-hydroxycholesterol hLLCs were washed with PBS two times and incubated with F12/DMEM (ThermoFisher

Scientific, #21041-025) with either 1 mM dbcAMP or 20 uM 22(R)-hydroxycholesterol for 3

h. Thereafter, hLLC supernatants were collected for hormone quantification.

Hormone Quantification

ELISA- hLLC and hALC supernatants were collected. Quantification of hormones was

measured using the following: pregnenolone ELISA kit (Abnova, #KA1912), DHEA ELISA

kit (Enzo Life Sciences, #ADI-901-093), androstenedione ELISA kit (Abnova, #KA1898),

progesterone ELISA kit (Cayman Chemical, #582601), testosterone ELISA kit (Cayman

Chemical, #582701), cortisol ELISA kit (Cayman Chemical, #500360), and aldosterone

ELISA kit (Cayman Chemical, #501090), according to the manufactures’ instructions.

Quantification of testosterone in collected from the dbcAMP or 22(R)-hydroxycholesterol

stimulation tests was also done using the same testosterone ELISA kit.

Mass Spectrometry- hLLC supernatants were lyophilized using FreeZone 1 Liter -50C Freeze

Dryers (Labconco, #7740021). Lyophilized samples were extracted three times in 200µL methyl tert-butyl ether (MTBE), combined supernatant, dried in a Speed Vac™, reconstituted

6

in 200uL of a 10+90 (v/v) mixture of dH2O: EtOH with 0.1% Formic Acid (aqueous) and

transferred into HPLC vials for analysis on the system. LC-MS/MS was performed by the

Proteomics Service, Research Institute of McGill University Health Centre (RIMUHC). The

analytical instrumentation consisted of an AB Sciex 5600 Time of Flight Mass Spectrometer

(TOF-MS), incorporating a heated electrospray ionization (HESI) source, a Nexera XR LC-20

ADXR™ UHPLC system and autosampler. The TOF-MS instrumentation conditions were as

follows: the HESI ion spray voltage (ISVP) was 5500 V, the curtain gas (CUR) 30 L/min, ion

source gas (GS1 and GS2) 50 L/min, collision energy (CE) 10, declustering potential (DP) 100,

polarity positive ion mode, and the source temperature was 500 ◦C. Total accumulation time

0.0999 sec in Full Scan TOF MS with an accumulation time of ≈50 msec/analyte of interest in

high sensitivity mode over a mass range of 50µ - 400µ. Product ions of androstenedione (m/z

287.2), testosterone (m/z 289.2), cortisol (m/z 363.2), aldosterone (m/z 361.2), DHEA (m/z

289.2), progesterone (m/z 315.2), 17-OH-progesterone (m/z 331.2), pregnenolone ([M-18]+)

(m/z 229.2), and DHT (m/z 291.2) were scanned. The chromatography was resolved by

gradient elution of a binary solvent system incorporating (A) 0.1% formic Acid (FA) in water

and (B) ACN + 0.1% FA and using a Zorbax™ (Agilent) Eclipse C18 (2.1 X 50mm, 1.8µ

analytical column, 0 – 0.5 min 5% B, 0.51-5.0 min 5%-90% B, 5.1-10.0 min 90% B, 10.1 min

5% B, 10.2-14.2 min 5% B for column re-equilibration. The solvent flow rate was 200 µL/min.

A 10µL injection volume was used. All standards/blank solution were in 10:90 EtOH: 0.1%

formic acid in water. The MS/MS acquisition time was 12.1 min - the total run time was 14.2

min/injection allowing for 3 min column reconditioning. Analytical standards in solution were

used to establish the linearity and dynamic range.

Data acquisition and post-analysis were performed using MultiQuant 3.0.2 and Analyst TF

1.7 (SCIEX). For assay calibration, peak area ratios were used to construct calibration graphs,

with line fitted by linear regression. The intercepts were not forced through zero, and line

weighting was applied (1/concentration). For quantification of Δ4 and Δ5 steroids, the absolute

amounts of Δ4 steroids (P4 and A4) and Δ5 steroids (P5 and DHEA) were added together.

Since 17-OH-progenolone was not detected by LC-MS/MS, it was not calculated in the total

amount of Δ4 steroids. Testosterone standards from the ELISA kit were also confirmed by LC-

MS/MS analysis.

Transmission Electron Microscopy On day 1, hiPSCs or hLLCs were fixed using 1/2 strength Karnovsky's fixative (2.5%

glutaraldehyde and 2% paraformaldehyde in 0.1M phosphate buffer) at 4 ℃ overnight. On day

2, fixed cells were rinsed with 0.1M cacodylate buffer and post-fixed with a 50+50 (v/v)

mixture of 2% aqueous OsO4 and 0.2 M cacodylate buffer at 4 ℃ for 2 h. Then, cells were en-

block stained with a saturated uranyl acetate at 4 ℃ overnight and rinsed with 0.1M sodium

acetate buffer. On day 3, cells were dehydrated with each solution for 15 min in the following

order: 50% EtOH, 70% EtOH, 85% EtOH, 95% EtOH, 100% EtOH, 100% EtOH, propylene

oxide (PO)/EtOH (1:1), PO/ETOH (2:1), PO, PO. After that, the cells were dehydrated with

Epon resin/PO (1:1) overnight. On day 4, cells were place into Epon resin/PO resin (2:1) for 8

h and 100% Epon resin under vacuum overnight. On day 5, cells were embedded in fresh Epon

resin at 60 °C for 24 hr (minimum). Thereafter, samples were ultra-thin sectioned (~70nm) and

placed on grids. Electron microscopy was performed by the Doheny Eye Institute (Los Angeles,

USA), using standardized procedures.

7

Fig. S1. Induction of EMPs, hALCs, and hLLCs. (A) Quantitative real-time PCR (qRT-PCR) analyses of mesenchymal stem cell markers (CD73,

CD105, and CD90), and steroidogenic genes in EMPs. The low expressions of both MSC

markers and steroidogenic genes indicated that EMPs were neither mature MSCs nor

steroidogenic cells.

8

(B) Ingenuity pathway analysis (IPA) of LC development-associated factors. Note that SF-1

(NR5A1), DHH, hCG, and cAMP are located in the center of the network.

(C) Images of SF-1-mGFP and plenti-C-mGFP (NC, negative control) vector transfected cells

cultured in COLI-SF1 system and ACF-SF1 system. Transfection efficiencies indicated by

GFP signals (green channel) showing that at least 50% of cells were transfected with SF-1

vector. Scale bars, 200 μm.

9

Fig. S2. Characterization of hALCs, and hLLCs. (A) Immunofluorescent staining (IFC) of human adrenal cell (hAC) marker CYP21B in hiPSCs

and hALCs showing that both hiPSCs and hALCs expressed CYP21B. Scale bars, 200 μm.

(B) The table showing that the percentage of CYP21B positive cells induced by the ACF-SF1

system was 64.15 ± 19.59%.

(C) qRT-PCR analyses showing that hLLCs expressed significantly more testis-specific genes

HSD17B3 and CYP19A1 than hiPSCs and hALCs.

(D) Comparing testosterone (T) in the cell supernatants of hALCs and hLLCs showing that

hLLCs secreted substantially more T than hALCs.

(E) Comparing cortisol (F) in the cell supernatants of hALCs and hLLCs showing that hALCs

secreted significantly more F than hLLCs. Data in (A) and (F-H) are presented as mean ± SD,

N = 3. Not significant (n.s.) P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

10

Fig. S3. Transcriptome expression profile of hiPSCs, hALCs, and hiPSC. (A) Principle components analysis (PCA) mapping showing the unsupervised division of

samples into hiPSCs (green dots), hALCs (red dots), and hLLCs (blue dots).

(B) Heat map summarizing expressions of all detected transcripts (21,448) across the sample

groups. Note that the variability across the three cell populations was large.

11

Fig. S4. Transcriptome expression profile of hiPSCs, hALCs, and hiPSC. (A-C) Microarray analyses and qRT-PCR analyses showing gene expression of STAR,

LHCGR, and MC2R in hiPSCs, hALCs, and hLLCs. The consistent gene expression

determined by both microaray and qRT-PCR analyses confirmed that the dynamic range of the

microarray platform was appropriate for reliable detection. Data are presented as mean ± SD,

N = 3. Not significant (n.s.) P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

12

(D-F) IPA showing the top five biological functions that were most associated with clusters of

genes specifically expressed in hLLCs, hALCs, and hiPSCs. Noted that genes specifically

expressed in hLLCs were involved in lipid, vitamin, and mineral metabolism that are all

associated with steroidogenesis. The detailed categories under each biological function item

are summarized in Additional data, Table S3.

(G) Heat map displaying expression of selected differentially expressed transcripts in each of

the indicated categories. Note that most of genes involved in lipid-droplet-associated functions

were highly expressed in hALCs and hLLCs. However, genes participating in the cholesterol

biosynthesis were highly expressed in hiPSCs.

13

14

Fig. S5. Confirmation of microarray analyses by qRT-PCR analyses. (A-I) Comparison of microarray data and qRT-PCR data detecting the expression of genes

involved in the PKA-cAMP signaling pathway, androgen biosynthesis and signaling pathway,

pregnenolone biosynthesis, glucocorticoid biosynthesis, and lipid-droplet associated functions.

All selected gene were highly expressed in hLLCs and/or hALCs. The consistent gene

expression determined by both microarray and qPCR analyses confirmed that the dynamic

range of the microarray platform was appropriate for reliable detection. Data are presented as

mean ± SD, N = 3. Not significant (n.s.) P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; ****

P < 0.0001.

15

Fig. S6. Comparing gene expression in hLLCs, hLCs and hiPSCs. (A) Heat map summarizing expression of 3,385 transcripts that were detected in the comparison

of hiPSCs versus hLCs. Transcripts of clusters 1 (C1) and 3 (C3) represent transcripts that were

highly expressed in hiPSCs and hLCs, respectively. Transcripts of C2 and C4 represent

transcripts showing no significant differences between hiPSCs and hLCs.

(B) Venn diagram showing 151 transcripts were consistently highly expressed in both hLLCs

and hLCs (left, red circle), meanwhile 177 transcripts (right, green circle) were poorly

expressed in both hLLCs and hLCs. Overlapping transcripts found in both hLC upregulated

and downregulated (i.e. 28 and 88 in both diagrams) junctures were probably those transcripts

16

detected by sequencing analysis at more than one genomic loci, in which they showed reverse

expression tendencies.

17

Fig. S7. Protein expression profiles of hLLCs. (A) Western blot analyses of SF-1 and GAPDH expression in hiPSCs and hLLCs. Human

testicular lysate was used as a positive control. Two different sized bands (44 and 53 kDa) were

detected by SF-1 antibody in all samples.

(B) Quantitative analyses of SF-1 expression in hiPSCs and hLLCs when normalized to

GAPDH. Calculation of total intensities of two bands and the intensity of 53kDa bands

showing that SF-1 was expressed higher in hLLCs versus hiPSCs. Data are presented as mean

± SD, N = 3. Not significant (n.s.) P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P <

0.0001.

18

(C) Membrane processing for Western blot. Dashed boxes indicate the crops that are shown in

Fig. 3C.

(D) Membrane processing for Western blot of STAR protein. Dashed boxes indicate the crop

that are shown in Fig. 3C.

(E) Western blot analyses of STAR expression in human adrenal cell line H295. H295 were

treated with or without 1mM dbcAMP for 3 hours. 25-kDa form STAR was increased in H295

treated with dbcAMP.

19

Fig. S8. Protein expression profiles of hLLCs and hALCs. (A-D) Membrane processing for Western blot. Dashed boxes indicate the crop that are shown

in Fig. 3D.

20

Fig. S9. Ultrastructure of hLLCs. The detailed enlarged transmission electron microscopy (TEM) images of hLLCs shown in Fig.

3E. This figure shows that hLLCs possessed condensed smooth endoplasmic reticulum (SER,

indicated by arrow). Rough endoplasmic reticulum (RER) were also found in hLLCs. N,

nucleus. Scale bars, 500 nm.

21

Fig. S10. Ultrastructure of hLLCs. The detailed enlarged transmission electron microscopy (TEM) images of hLLCs shown in Fig.

3F. This figure shows that hLLCs possessed condensed smooth endoplasmic reticulum (SER,

indicated by arrow). Scale bars, 500 nm.

22

Fig. S11. Ultrastructure of hLLCs. The detailed enlarged transmission electron microscopy (TEM) images of hLLCs shown in Fig.

3G. This figure shows that the swirled variety of SER (WER) is also found in hLLCs and

presence of plentiful mitochondria (M) that were close together. Moderate amounts of lipid

droplets (LDs) were also found in hLLCs. Scale bars, 500 nm.

23

Fig. S12. Ultrastructure of hLLCs. The detailed enlarged transmission electron microscopy (TEM) images of hLLCs shown in Fig.

3H. This figure shows that presence of plentiful mitochondria (M) that were close together.

Note that their cristae were either lamellar or tubular. Scale bars, 500 nm.

24

Fig. S13. Ultrastructure of hiPSCs. (A-F) TEM images of hiPSCs indicating their ultrastructure. (A) and (D) show that hiPSCs

possessed large nucleoli (black arrows) with one to four nucleoli per cell. (B-C) and (E-F) show

that hiPSCs possessed numerous mitochondria (M) that were characterized with spherical

shape and poorly developed cristae. (E) show that hiPSCs contained lipid droplets (LD, red

arrows). Smooth endoplasmic reticulum (SER, arrows with white stroke), rough endoplasmic

reticulum (RER), golgi (G) were rarely seen in hiPSCs. N, nucleus. Scale bars, 500 nm.

25

Fig. S14. Expression of immunoractive STAR in hLLCs. Immunoprecipitation and immunoblotting analyses of immunoreactive STAR expression in

the differetiated cells at ID 18. Cells were cultured with only DHH and dbcAMP from ID 8 to

18. Cells were treated with 150 ng/ml hCG for 1 hour. Cell lysates were immunoprecipitated

with an anti-STAR antiserum and the preciptates were immunoblotted with an anti-

phosphoserine antiserum. A robust increase of the immunoreactive phosphorylated STAR

protein of 50 kDa molecular weight was seen in the presence of hCG. Although the 37kDa

STAR is not seen, the 25kDa phosphorylated STAR is detected. It is likely that the 50kDa

immunoreactive STAR protein is a STAR dimer formed during immunoprecipitation process.

26

Fig. S15. Measurement of T by ELISA and LC-MS/MS. To confirm the T concentrations in the standards provided by the ELISA kit (ELISA T) as

positive controls, a mass spectrometry analysis of ELISA T was performed.

(A) Standard curve of T detected by LC-MS/MS analyses.

(B) Standard curve of T detected by ELISA analyses.

27

(C) ELISA and LC-MC/MS analyses of different concentrations of T standard showing that

only the T standard with a concentration higher than 30000 pg/ml could be detected by LC-

MC/MS analyses.

28

Fig. S16. Steroid production in hLLCs upon the stimulation of 22(R)-

hydroxycholesterol. (A) ELISA analyses of T in the cell supernatants. hLLCs treated with 20 uM 22(R)-HC for 3

hours secreted significantly more T than hLLCs without 22(R)-HC.

(B-F) LC-MS/MS analyses of steroids in the cell supernatants. hLLCs treated with 22(R)-HC

secreted significantly more P5 and A4 than hLLCs without 22(R)-HC.

(G) Sum of the Δ5 steroids (P5 and DHEA) and Δ4 steroids (P4 and A4) in the cell supernatants

of hLLCs treated with or without 22(R)-HC. There is no significant difference between the

amount of Δ5 and Δ4 steroids that were stimulated by22(R)-HC. Data in (A-G) are presented

as mean ± SD, N ≥ 3. P value was generated by the student’s t-test. Not significant (n.s.) P >

0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

29

Fig. S17. Reproducibility of hLLC induction method in a second hiPSC line. (A) qRT-PCR analyses of steroidogenic cell markers in hiPSCs and hLLCs, respectively.

hLLCs highly expressed SF-1. hLLCs highly expressed most of steroidogenic genes except for

CYP21B, suggesting their gene expression is similar to that of hLCs.

(B-D) qRT-PCR analyses showing gene expression of OCT4, NANOG, LHCGR, and STAR

in hiPSCs and hLLCs. Pluripotency markers were downregulated significantly while LHCGR

and STAR were upregulated in hLLCs.

(C) ELISA analyses of T in the cell supernatants from ID 10 to 22. From ID 14 to 22,

differentiated cells were cultured with F12/FBS medium containing either hCG/dbcAMP/DHH

(+hCG/cAMP group) or DHH (-hCG/cAMP group). For comparison between groups, T

30

concentrations were compared at ID 14, 16, 18, 20, and 22, and P values were generated by

the student’s t-test. Not significant (n.s.); P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001;

**** P < 0.0001. For comparison within groups, T concentrations were compared across ID

14, 16, 18, 20, and 22, and P value were generated by ANOVA. Multiple comparisons were

corrected by Tukey’s t-test. For +hCG/cAMP group, P value of ANOVA < 0.0001, T

concentrations of ID 16, 18, 20, and 22 were significantly different from that of ID 14 (P <

0.05). For –hCG/cAMP group, P value of ANOVA < 0.0001, T concentrations of ID 18, 20,

and 22 were significantly different from that of ID 14 (P < 0.001).

Data are presented as mean ± SD, N = 3. Not significant (n.s.) P > 0.05; * P < 0.05; ** P <

0.01; *** P < 0.001; **** P < 0.0001.

31

Dataset S1 Differentially expressed (DE) genes in hiPSCs, hLLCs, and hALCs.

Dataset S2 Clusters of genes specifically expressed in hiPSCs, hLLCs, and hALCs.

Dataset S3 Biological functions associated with genes that were specifically expressed in hLLCs and

hALCs.

Dataset S4 DE genes that are involved in steroidogenesis.

Dataset S5 hLLC-specific and hALC-specific genes that are involved in cholesterol transport process.

Dataset S6 DE genes detected in both hLLCs and hLCs.

Dataset S7 Genes that were consistently upregulated or downregulated in hLLCs and hLCs when

compared with hiPSCs.

References 1. Kreitzer FR, et al. (2013) A robust method to derive functional neural crest cells from

human pluripotent stem cells. Am J Stem Cells 2(2):119-131. 2. Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402-408. 3. Jegou B, Sankararaman S, Rolland AD, Reich D, & Chalmel F (2017) Meiotic Genes Are

Enriched in Regions of Reduced Archaic Ancestry. Mol Biol Evol 34(8):1974-1980.