Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex...
Transcript of Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex...
![Page 1: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/1.jpg)
Supplemental information
Precise A·T to G·C base editing in the rice genome
Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu
Contents
Supplemental Figure 1. TA cloning results of two base editing lines (SG1-7 and
SG1-15) containing pRABEsp-OsU6 with sgRNA1.
Supplemental Figure 2. pRABEsp-OsU6 can be used for multiplex base editing in
rice.
Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by
pRABEsa-OsU6sa.
Supplemental Table 1. Base editing activity window for ABE-P1.
Supplemental Table 2. Base editing frequency at potential off-target sites of
sgRNA1.
Supplemental Table 3. Base editing activity window for ABE-P2.
Supplemental Table 4. Base editing frequency at potential off-target sites of
sgRNA4.
Supplemental Table 5. Primers used in this study.
Supplemental Materials and Methods
Supplemental References
![Page 2: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/2.jpg)
Supplemental Figure 1. TA cloning results of two base editing lines (SG1-7 and
SG1-15) containing pRABEsp-OsU6 with sgRNA1. Twenty clones from each line
were randomly selected for sequencing. Representative sequence chromatograms for
each genotype are shown. Arrows point to the positions with edited base.
![Page 3: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/3.jpg)
Supplemental Figure 2. pRABEsp-OsU6 can be used for multiplex base editing
in rice. (A) sgRNA3 was designed for simultaneous editing of three genes in the rice
genome. The OsmiR156 binding sites in the three genes are highlighted in red. (B)
Representative sequence chromatograms at the target sites are shown. Note that in
lines SG3-11 and SG3-12, the target sites in OsSPL16 and OsSPL18 were
![Page 4: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/4.jpg)
simultaneously edited. Arrows point to the positions with edited base.
Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by
pRABEsa-OsU6sa. (A) The sgRNA5 was designed for simultaneous editing of
OsSPL16 and OsSPL18. (B) Representative sequence chromatograms for the two
![Page 5: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/5.jpg)
target sites in three transgenic lines, SG5-7, SG5-18, and SG5-44. Both target genes
were edited in the three lines. Arrows point to the positions with edited base.
Supplemental Table 1. Base editing activity window for ABE-P1
sgRNA Target Line number Baseediting position Editing form
sgRNA1 OsSPL14 SG1-11, SG1-21 5 T-C conversion
SG1-10, SG1-15 5,7 T-C conversion
SG1-7, SG1-23 5,10 T-C conversion
sgRNA2 SLR1 SG2-4, SG2-18, SG2-19, SG2-26, SG2-36 6 T-C conversion
sgRNA3 OsSPL16 SG3-3, SG3-11, SG3-12, SG3-13 7 T-C conversion
OsSPL18 SG3-11, SG3-12 7 T-C conversion
SG3-15 7,9 T-C conversion
SG3-19 5,7 T-C conversion
LOC_Os02g24720 SG3-6 5 T-C conversion
Note: Base editing position was counted from the PAM-distal end, scoring the PAM
as positions 21-23.
Supplementary Table 2. Base editing frequency at potential off-target sites of
sgRNA1
Site Chromosome Position Guide-PAM sequence Mismatch
numbers
Editing
efficiency
On target 8 25275163 AGAGAGAGCACAGCTCGAGTCGG 0 26%
Off-target 1 8 18918918 AGAGAGAGCACAGCTgGAGTCGG 1 0
Off-target 2 1 24179644 tGAtcGgGCACAGCTCGcGTCGG 5 0
Off-target 3 3 36137080 AGAaAGAGCAtgGgTCGAGTCGG 4 0
Off-target 4 3 8596704 AGAGtGAGCACAGCggGAGaCGG 4 0
Off-target 5 4 23025825 gGAGAGcGCgCgGCTCGAGgCGG 5 0
Off-target 6 5 10284901 AGAGtGtGCAgAGtTCGAGTCGG 4 0
Off-target 7 7 19030423 AGAGAGAGCtCgGCTCGgcTCGG 4 0
Off-target 8 10 1012640 AGAGAGAtCtCAGaTCGAGgCGG 4 0
Off-target 9 7 20804240 AGAcAGAGCACAGCaaGAaTCGG 4 0
Note: Nucleotides of the PAM sequence are written in bold, and the mismatch bases
in potential off-targets are shown in lowercase.
Supplementary Table 3. Base editing activity window for ABE-P2
sgRNA Target Line number Base editing position Editing form
sgRNA4 OsSPL14 SG4-6, SG4-11, SG4-16 8 T-C conversion
SG4-2, SG4-5, SG4-17, SG4-19 10 T-C conversion
SG4-4 6, 10 T-C conversion
SG4-1, SG4-24, SG4-27 8, 10 T-C conversion
SG4-7, SG4-10 6, 8, 10 T-C conversion
SG4-25 10, 12 T-C conversion
OsSPL17 SG4-2, SG4-7 8 T-C conversion
![Page 6: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/6.jpg)
SG4-8 10 T-C conversion
SG4-12, SG4-20 12 T-C conversion
SG4-1, SG4-5, SG4-6, SG4-10, SG4-16,
SG4-18, SG4-24, SG4-26
8, 10 T-C conversion
SG4-11, SG4-19 8, 10, 12 T-C conversion
SG4-27 8, 10,14 T-C conversion
SG-3 6, 10, 12, 14 T-C conversion
SG17, SG4-25 8, 10, 12, 14 T-C conversion
sgRNA5 OsSPL16 SG5-18, SG5-30, SG5-45 12 T-C conversion
SG5-7, SG5-23, SG5-32, SG5-33, SG5-44 14 T-C conversion
OsSPL18 SG5-18, SG5-21, SG5-29, SG5-37, SG5-38,
SG5-40, SG5-44, SG5-45
10 T-C conversion
SG5-7 10, 12 T-C conversion
SG5-23 8, 10, 12 T-C conversion
SG5-12 10, 12, 14 T-C conversion
Note: Base editing position was counted from the PAM-distal end, scoring the PAM
as positions 22-27.
Supplemental Table 4. Base editing frequency at potential off-target sites of
sgRNA4
Site Chromosome Position Guide-PAM sequence Mismatch
numbers
Editing
efficiency
On target 1 8 25275156 ACAGAAGAGAGAGAGCACAGCTCGAGT 0 45.2%
On target 2 9 18918911 ACAGAAGAGAGAGAGCACAGCTGGAGT 0 61.3%
Off-target 1 9 19647839 ACAGAAGAGAGAGAGCACAat CGGAGT 2 0
Off-target 2 11 17631827 ACAGAAGAGAGAGAGCACAct CCGGGT 2 0
Off-target 3 8 26505555 ACAGAAGAGAGAGAGCACAct CCGGGT 2 0
Off-target 5 3 36137083 ACgGAAGAGAaAGAGCAtgGg TCGAGT 5 0
Note: Nucleotides of PAM sequence are written in bold, and the mismatch bases in
potential off-targets are shown in lowercase.
Supplemental Table 5. Primers used in this study
Primer name Primer sequence 5’-3’ Purpose
sgRNA1-F TGTGAGAGAGAGCACAGCTCGAGT sgRNA1vector construction
sgRNA1-R AAACACTCGAGCTGTGCTCTCTCT
sgRNA2-F TGTGAGTGCACGGTGTCCGTGGCC sgRNA2 vector construction
sgRNA2-R AAACGGCCACGGACACCGTGCACT
sgRNA3-F TGTGCAGAAGAGAGAGAGCACAAT sgRNA3 vector construction
sgRNA3-R AAACATTGTGCTCTCTCTCTTCTG
sgRNA4-F TGTGTGACAGAAGAGAGAGAGCACAGC sgRNA4 vector construction
sgRNA4-R AAACGCTGTGCTCTCTCTCTTCTGTCA
sgRNA5-F TGTGTGACAGAAGAGAGAGAGCACAAT sgRNA5 vector construction
sgRNA5-R AAACATTGTGCTCTCTCTCTTCTGTCA
![Page 7: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/7.jpg)
SPL14-seq-F AGGGTTCCAAGCAGCGTAAGGA Genotyping the target sites in OsSPL14
SPL14-seq-R TGGTGCTGGGGCTGGACCGTTC
SLR-seq-F GCGCAATTATTACTAGCTATAGC Genotyping the target site in SLR1
SLR-seq-R AGCCGTCGCCACCACCGGTAAGG
SPL16-seq-F CAGCTGCTGCTGCTGCTTCAGTGTG Genotyping the target sites in OsSPL16
SPL16-seq-R ACATCCCATTGTAGTTCATCTCATTG
02G-seq-F GCCTGCAGGCGGAGGAGTGG Genotyping the target site in LOC_Os02g24720
02G-seq-R AGTTCATCTCATTGTCATTGGA
SPL17-seq-F GGACCTCGTTCAGCACAACCC Genotyping the target site in OsSPL17
SPL17-seq-R GGGTTCCAAGCAGTGTGAGGGA
SPL18-seq-F TGGGATCATCAAATCCGAGGAG Genotyping the target sites in OsSPL18
SPL18-seq-R CTGTCCATGCTCGGGCAGGCG
sgRNA1M1-F GGGACCTCGTTCAGCACAACCCC Off target site 1 detection for sgRNA1
sgRNA1M1-R GCAGGTCCAGAAGCTTTGTGGTA
sgRNA1M2-F TTGCTCCCTAAACAACTCCCAG Off target site 2 detection for sgRNA1
sgRNA1M2-R CCTGGTGCAGAGAGTACAAATG
sgRNA1M3-F TGCAATGCATCTACTCCCTCAG Off target site 3 detection for sgRNA1
sgRNA1M3-R GATCACACTAGCGACAGCGAGC
sgRNA1M4-F ACGAGAGCTTCGACTGAACGCA Off target site 4 detection for sgRNA1
sgRNA1M4-R AATCTGCCGCGTGTCAGCAGAG
sgRNA1M5-F TGCAGGTGGTCGGCGATCGCG Off target site 5 detection for sgRNA1
sgRNA1M5-R AGCGCGCGCAGCTTGGCCT
sgRNA1M6-F GATCACAACTGCTCGTAAGCTA Off target site 6 detection for sgRNA1
sgRNA1M6-R ATATGTCCTTATCGGACACGAC
sgRNA1M7-F CCAAACTCTATCTTGAGCCTTC Off target site 7 detection for sgRNA1
sgRNA1M7-R GAGTTCGACGAGGGAGAGAGA
sgRNA1M8-F ATATTCATAATCCCCCTAGAA Off target site 8 detection for sgRNA1
sgRNA1M8-R CCCCAACGCTTCGCGAATCGCA
sgRNA1M9-F CAGAGCCTGGACGGGTTCTAC Off target site 9 detection for sgRNA1
sgRNA1M9-R ACAGTACAGCAAATCGCACGT
sgRNA4M1-F GCAACAAGATGTTCTCCTCCG Off target site 1 detection for sgRNA4
sgRNA4M1-R CTGCCGCCGAACTGCTGCTGC
sgRNA4M2-F ACACCTGCCAAGAGAATGGCA Off target site 2 detection for sgRNA4
sgRNA4M2-R CCGATAGCTGATCAGAACGC
sgRNA4M3-F TTGGCATCAGCAGCAGGCAGCA Off target site 3 detection for sgRNA4
sgRNA4M3-R GAACCAGGCTGAGCTGCCGCC
sgRNA4M4-F TATTATTCGTGCAATGCATCTA Off target site 4 detection for sgRNA4
sgRNA4M4-R ATGCGAGCGGTCTAACCGACGA
Materials and methods
Vector construction
The mammalian codon-optimized wild type E. coli tRNA adenine deaminase
![Page 8: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/8.jpg)
ecTadA(wt) and its mutated form ecTadA*(7.10) with a 96 bp linker were synthesized
by GENEWIZ (Suzhou, China) as described in Gaudelli et al (Gaudelli et al., 2017).
Two AarI sites with appropriate overhangs were added at both ends of edTadA(wt)
and ecTadA*(7.10). The vector pCas9(OsU6), containing a Cas9 gene driven by the
maize ubiquitin promoter, was modified to construct adenine base editing vectors.
First, SpCas9 (D10A) nickase and SaCas9 (D10A) nickase flanked by two AarI sites
at 5’ terminal and VirD2 nuclear localization signal (NLS) at 3’ terminal were
amplified from pCas9(OsU6) and pX600 (Addgene, #61592) to replace the Cas9 gene
in the pCas9(OsU6) vector to form intermediate vectors pRSp-OsU6 and pRSa-OsU6,
respectively. Then, the edTadA(wt) and ecTadA*(7.10) with 96 bp linker were
inserted between two AarI sites of pRSp-OsU6 and pRSa-OsU6 by the Golden Gate
method, leading to pRABESp-OsU6 and pRABESa-OsU6. A fragment comprised of
the OsU6 promoter, two BsaI sites and the sgRNA scaffold matching SaCas9 was
obtained by overlap PCR. Then it was used to replace the OsU6-spsgRNA cassette in
pRABESp-OsU6 to form pRABESa-OsU6Sa. The backbone of the final vectors,
pRABESp-OsU6 and pRABESa-OsU6Sa, contains the hygromycin B
phosphotransferase (hpt) gene for transgene selection.
The 20 bp (for SpCas9) or 21 bp (for SaCas9) sgRNA target sequences were
synthesized and annealed on a PCR machine. The annealed oligo adaptors were
inserted into the BsaI digested pRABESp-OsU6 and pRABESa-OsU6Sa vectors. The
accuracy of vectors was confirmed by Sanger sequencing. Primers used for vector
construction are listed in Supplemental Table 5.
Rice transformation
All binary vectors were transformed into the A. tumefaciens strain EHA105 by the
freeze/thaw method. Transformation of embryogenic calli induced from mature seeds
of Nipponbare rice (Oryza sativa L. japonica. cv. Nipponbare) was performed as
described previously with minor modifications (Nishimura et al., 2007). Briefly, two
days after Agrobacterium infection, calli were transferred onto selection media for
one round of selection for two weeks. Then, the resistant calli were directly
transferred to regeneration media for shoot regeneration. After the shoots grew to 4-5
![Page 9: Supplemental information Precise A·T to G·C base editing ......Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by pRABEsa-OsU6sa. (A) The sgRNA5 was designed](https://reader034.fdocuments.us/reader034/viewer/2022042419/5f36079f127a154d85039f3f/html5/thumbnails/9.jpg)
cm in length, the plantlets were transferred to MS media for root induction. Two
weeks later, the plantlets were transplanted to soil pots and grew in a greenhouse
under standard conditions (12-h light 28°C and 12-h darkness at 22°C).
Genotyping editing events
Genomic DNA was extracted from the leaves of all T0 transgenic lines. Each target
locus was amplified by PCR and the PCR products were purified for Sanger
sequencing. Some PCR sequencing results were further confirmed by TA cloning and
sequencing. Base editing ratio was calculated by scoring the number of plants with
base editing events divided by the total number of genotyped transgenic lines. Primers
for genotyping each target site are shown in Supplemental Table 5.
Off-target detection
Off-target sites prediction was done by the online tool CRISPR-GE (Xie et al., 2017).
Homologous sequences with up to 5 bp mismatches to target sites were listed as
potential off-target sites. The potential off-target sites were each amplified from base
edited lines for Sanger sequencing. Primers for off-target amplification are listed in
Supplemental Table 5.
Supplemental References
Gaudelli, N.M., Komor, A.C., Rees, H.A., Packer, M.S., Badran, A.H., Bryson, D.I.,
and Liu, D.R. (2017). Programmable base editing of A•T to G•C in genomic
DNA without DNA cleavage. Nature 551:464-471.
Nishimura, A., Aichi, I., and Matsuoka, M. (2007). A protocol for
Agrobacterium-mediated transformation in rice. Nat. Protoc. 1:2796-2802.
Xie, X., Ma, X., Zhu, Q., Zeng, D., Li, G., and Liu, Y.-G. (2017). CRISPR-GE: A
Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant
10:1246-1249.