Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the...
Transcript of Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the...
![Page 1: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/1.jpg)
Cell Reports, Volume 7
Supplemental Information
MicroRNA Targeting of CoREST Controls
Polarization of Migrating Cortical Neurons
Marie-Laure Volvert, Pierre-Paul Prévot, Pierre Close, Sophie Laguesse, Sophie Pirotte,
James Hemphill, Florence Rogister, Nathalie Kruzy, Rosalie Sacheli, Gustave Moonen,
Alexander Deiters, Matthias Merkenschlager, Alain Chariot, Brigitte Malgrange, Juliette
D. Godin, and Laurent Nguyen
![Page 2: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/2.jpg)
1
Supplemental Data
Figure S1. Conditional removal of Dicer in cortical progenitors impairs corticogenesis
Microphotography of E14 mouse brains from Dicer conditional knockout (Dicerlox/lox;
FoxG1Cre/+) or corresponding wild-type (Dicerlox/+;FoxG1Cre/+) mice. Histogram on the left
shows cortical thickness in transgenic E14 embryos, genotypes as indicated (A).
Immunolabelings of cortex from Dicer knockout or wild-type embryos show: the distribution
of apical (Pax6+, red) or basal (Tbr2+, red) progenitors (B), the radial glia scaffold (BLBP in
![Page 3: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/3.jpg)
2
green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial
scaffold integrity) (C), the distribution of cortical progenitors (Sox2 in red) and neurons (BIII-
tubulin in green) or upper layer neurons (Tbr1 in green) (D), dying cells (ac-capsase-3 in red)
or cells accumulating DNA double-strand breaks (pH2AX in red) (E), nuclei are
counterstained with Hoechst 33342 (Hoechst) in blue. Scale bars represent 100 µm.
Figure S2. Conditional removal of Dicer impairs neuronal morphology and radial migration
A-D, acute depletion of Dicer thanks to NeuroD:Cre-GFP expression in Dicerlox/lox embryos
cell autonomously disturbs neuron migration. Immunolabelings of E18 NMRI brain sections
shows GFP+ electroporated cells (GFP in green) (A) with Cre (red) (B) or the radial glia
scaffold (BLBP in red) (C) or the upper layer marker Cux1 (red) (D). E-I, acute depletion of
![Page 4: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/4.jpg)
3
Dicer in postmitotic neurons leads to morphological and motility defects. Histogram shows
the proportion of Dicerlox/lox electroporated neurons at E14 that harbor distinct morphologies
two days later (E). Real time imaging on one day cultured brain slice from E17 embryos
electroporated at E14 reveals that distance (G, H, I) but not velocity (F) of somal
translocation is affected after conditional removal of Dicer. Time lapse sequences in minutes
(H, I).
Figure S3. Analysis of gene expression after acute removal of Dicer in migrating projection
neurons
Expression level of REST (A), Rnd2 (B), FilaminA (C), FoxP2 (D), Stathmin (E), Neuropilin
1 (F), COUPTF1 (G), Sin3A (H), MeCP2 (I), and CoREST (J) as quantified by qRT-PCR
from RNA-extracted from FACS-purified Dicerlox/lox electroporated neurons with
![Page 5: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/5.jpg)
4
NeuroD:GFP, NeuroD:Cre-GFP with or without shSCR or Sh CoREST. Western blot of
CoREST and actin in N2A cells transfected with either shSCR or shCoREST (K).
Immunolabelings showing the cortical distribution of E17 neurons electroporated (GFP,
green) with selected plasmids at E14, as annotated above individual pictures. Counterstaining
was performed with dapi (blue) (L) Relative distribution of corresponding electroporated
neurons throughout the cortical wall (N). Level of CoREST messengers in VZ/SVZ or IZ in
microdissected cortical E16 brain slices after in utero electroporation of shSCR or shCoREST
plasmids two days earlier (N). Abbreviations are subventricular zone (SVZ), intermediate
zone (IZ), and cortical plate (CP).
![Page 6: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/6.jpg)
![Page 7: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/7.jpg)
6
Figure S4. Heatmap of miRNA expression in the developing cerebral cortex at three
developmental milestones
Expression levels (in arbitrary values) of miRNAs in cerebral cortex extracts from E12, E14,
and E18 mouse embryos ranked top down according to E14. Undetected miRNAs are
excluded from the heatmap. The blue arrows point miRNAs that have been bioinformatically
predicted to target CoREST (miR-124>mir-22>mir-185).
Figure S5. Modulation of endogenous miRNA expression
Luciferase assay in HEK-293 cells with combination of vectors expressing the Luciferase
gene followed by the 3’UTR of CoREST, specific miRNAs mimics (miR-) and antagomiRs
as indicated on the histogram (A). Relative expression levels of Dicer in cortical extracts from
embryos of different genotypes, as indicated (B). Luciferase assay in HEK-293 cells with
combination of vectors expressing the Luciferase gene followed by the 3’UTR of CoREST,
specific miRNAs mimics (miR-) and NeuroD-driven miRNA sponges (SPGmiR-), as
![Page 8: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/8.jpg)
7
indicated on the histogram (C) or UV-activatable caged antagomiRs (D) (ANOVA-1,
Bonferoni post test, ***p<0.0001).
Figure S6. Rescue of radial migration defects induced by expression of selected miRNA
sponges
A-B, levels of Dcx (A) and CoREST (B) mRNA in 17 NMRI mouse embryos after in utero
electroporation of SPGmiRNAs (as indicated) at E14. Immunolabelings showing the cortical
distribution of neurons three (C; RFP, red) or four (E; GFP, green) days after electroporation
![Page 9: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/9.jpg)
8
of selected plasmids (as annotated above individual pictures) in E14 NMRI mouse brains ,.
Counterstaining was performed with dapi (blue). Inset show magnified field highlighting
neuronal polarity (E). Relative distribution of corresponding electroporated neurons
throughout the cortical wall (D, F). Abbreviations are subventricular zone (SVZ),
intermediate zone (IZ), and cortical plate (CP) (D, F, ANOVA-2, Bonferoni post test,
**p<0.001, ***p<0.0001).
Movie S1. Defects of multipolar to bipolar polarization in absence of Dicer expression.
Multipolar GFP-expressing projection neurons (pointed by red arrowhead) navigating in
upper SVZ to lower intermediate zone of cultured brain slices from E16.5 Dicerlox/lox mouse
embryos electroporated with either NeuroD:GFP (left) or NeuroD:Cre-GFP (right) expressing
plasmids. The magnification is 40X and the recording duration is 10 hours.
Movie S2. Defects of bipolar maintenance in absence of Dicer expression. Bipolar GFP-
expressing projection neurons (pointed by red arrowhead) navigating in the lower
intermediate zone of cultured brain slice from E16.5 Dicerlox/lox mouse embryos
electroporated with either NeuroD:GFP (left) or NeuroD:Cre-GFP (right) expressing
plasmids. The magnification is 40X and the recording duration is 10 hours.
Supplemental Experimental Procedures
Mouse lines and genotyping
Time-pregnant NMRI (Janvier labs, Saint Berthevin, France), Dicerlox/lox (M. Merkenschlager,
Londres), FoxG1Cre/+ (J.-M. Hébert, New York) and NEXCre/+ (K.A. Nave, Göttingen) mice
backrossed in MF1 genetic background were housed under standard conditions and treated
according to guidelines of the Belgian Ministry of Agriculture in agreement with the
European community Laboratory Animal Care and Use Regulations (86/609/CEE, Journal
Officiel des Communautés Européennes L358, 18 December 1986). Dicerlox/lox mice were
crossed with FoxG1Cre/+ mice to obtain Dicerloxp/+ FoxG1Cre/+ mice, and genetic invalidation of
Dicer was performed after crossing the latter with Dicerlox/lox. The resulting Dicerlox/+lox;
![Page 10: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/10.jpg)
9
FoxG1+/+ (control) and Dicerlox/lox; FoxG1Cre/+ (Dicer conditional knockout) littermates were
analyzed. The same strategy was used to obtain Dicerlox/lox; NEXCre/+. PCR-based genotyping
was performed with the following primers: Dicer Fwd
(AGTAATGTGAGCAATAGTCCCAG) and Dicer Rev
(CTGGTGGCTTGAGGACAAGAC) to detect Dicer lox alleles. The following primers were
used to detect Cre recombinase: Cre Fwd (ATCCGAAAAGAAAACGTTGA) and Cre Rev
(ATCCAGGTTACG GATATAGT).
Tissue processing
Embryonic brains were dissected in 0.1 M phosphate-buffered saline (PBS) (pH 7.4) and
further fixed in a solution containing 4% paraformaldehyde (PFA) at 4°C for 1.5 hours (for
immunohistochemistry) or overnight (for RNA in situ hybridization). P2 and P17 brains were
dissected from anesthetized animals subjected to intracardial perfusion of 0.9% NaCl,
followed by 4% PFA. Brains were further post-fixed for an additional 1.5 hours in 4% PFA.
Fixed samples were cryoprotected overnight in 20% sucrose in PBS at 4°C, then embedded in
OCT Compound (VWR International, Leuven, Belgium), cryosectioned (10-20 µm), and
placed onto slides for analyses (SuperFrost Plus, VWR International).
Immunohistochemistry and RNA in situ hybridization
For immunocytochemistry, samples were washed three times with PBS-Triton (0.1%) (PBST)
and blocked at room temperature for 1 hour in PBST containing 10% donkey serum (Jackson
Immunoresearch Laboratories, West Grove, USA). All primary antibodies were incubated
overnight at 4°C. The following primary antibodies were used: anti-GFP (1:1000, rabbit,
Invitrogen, Paisley, UK; 1:500, chicken, Millipore, Billerica, USA; 1:1000 Rat, Gentaur,
Belgium; 1:500, goat, Abcam, UK), anti-βIII tubulin (1:1000, rabbit, Covance, USA), anti-
Cre recombinase (1:500, rabbit, Covance, USA), anti-activated caspase3 (1:500, rabbit,
Promega, USA) anti-Brain Lipid-Binding Protein (BLBP) (1:500, rabbit, Millipore), anti-
CDP (Cux1) (1:500, goat, Santa Cruz, USA), anti-Sox5 (1:500, rabbit, Aviva systems
biology), anti-Tbr2 (1:500, rabbit, Millipore, USA), anti-Tbr1 (1:500, rabbit, Millipore,
USA), anti-Pax6 (1:100, Covance, USA), anti-Nestin (1:200, chicken, Novus Biologicals,
UK), anti-Sox2 (1:500, goat, Santa Cruz, USA), anti-CoREST (1:500, rabbit, Millipore USA),
![Page 11: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/11.jpg)
10
anti-Satb2 (1:500, Mouse, Abcam, UK), anti-Ctip2 (1:300, rat, Abcam, UK), anti-Dcx
(1:1000, goat, Santa Cruz, USA) anti-Ki67, clone B56 (1:50, mouse, BD Pharmingen,
Erembodegem, Belgium) anti-Kif1a (1:500, Mouse, BD Transduction), anti-Kif1a (1:500,
Goat Santa Cruz, USA). Cryosections were washed and incubated with corresponding
secondary antibodies coupled either with RHODredX, Cy5 or FITC (Jackson
Immunoresearch laboratories) for 1 hour at room temperature. Nuclei were counterstained
with Hoechst 33342 (1:1000, Invitrogen, Paisley, UK). Sections were analyzed by confocal
microscopy (Nikon A1 Eclipse).
RNA in situ hybridizations were performed on frozen brain sections with 3’-digoxigenin-
labeled LNATM antisense probes (Exiqon, Euroclone, Milano, Italy) to mouse miR-124,
miR185, miR-22 as described previously (De Pietri Tonelli et al., 2008).
Plasmids preparation
Plasmids DNA were prepared using a Plasmid Endofree Maxi Kit (Qiagen, Hilden,
Germany). pNeuroD-IRES-GFP was a gift from F. Polleux (SCRIPPS, CA, USA). p-
shCoREST and p-shSCR were gift from M. Kukuljan (Universidad de Chile, Santiago, Chile).
The targeting efficiency of p-shCoREST towards endogenous CoREST mRNAs was assessed
by qRT-PCR in extracts obtained from microdissected cortical VZ/SVZ and IZ obtained from
E16 embryos electroporated in utero two days earlier with p-shCoREST or p-shSCR (Figure
S3N). The Cre recombinase, CoREST, and Dcx coding sequence were subcloned into the
pNeuroD-IRES-GFP/RFP. The 3’UTR of CoREST was subcloned into a psiCHECK-2 vector
(Promega, USA). All constructs were checked by sequencing. Mutations in the 3’UTR of
CoREST were performed using QuikChange Lightning Site-‐Directed Mutagenesis Kit
(Agilent Technologies). Website for miRNA target prediction: Target scan,
http://www.targetscan.org/ MicroRNA.org,
http://www.microrna.org/microrna/home.do and Diana-‐microT V3.0,
http://diana.cslab.ece.ntua.gr/microT/
Dual luciferase assay
HEK-293T (human embryonic kidney) cells were seeded in 24-well plates and further
transfected in each well using Lipofectamine 2000 (Invitrogen) with 20ng psiCheck-2
containing CoREST 3’UTR and 250 ng p-CMV-miR vectors (microR-22, miR-124, miR-185)
(Origene, MD, USA) according to the manufacturer’s instructions. Cells were incubated 48
![Page 12: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/12.jpg)
11
hours at 37°C. psiCheck-2 containing CoREST 3’UTR with point mutations in the seed
sequences for miR-124 (guacauuuggaauuggugAACuc), miR-22
(caucucuguggacaagcGTAuau) were included as negative controls. Negative controls were
transfected with the p-CMV-microR empty vector. Antisens validation was performed after
transfection of antagomiRs (50 pmol, 25 nM) or sponge plasmids (500 ng). For caged
antagomiRs validation, HEK-293 cells were seeded in clear-bottom 96-well plates (BD
biosciences, San Jose,CA), and transfected with 5ng psiCheck-2 containing CoREST 3’UTR,
25 ng p-CMV-miR vectors, caged antagomiRs (10 pmol, 25nM) and 50 ng of centrin-Kaede
(Wang et al., 2009). Six hours after transfection, cells were either kept in dark or irradiated for
5 minutes with a mercury lamp (Nikon C-LHGFI Intensilight) and a DAPI filter cube for
excitation (Nikon A1 Eclipse Ti microscope, 4x objective, half power of the lamp). Cells
were incubated 15 hours at 37°C after exposition. Firefly and renilla luciferase activities were
measured with a luminometer using the Dual-Luciferase Reporter Assay System kit
(Promega).
NMRI E14 embryos were electroporated in utero with plasmids psiCheck-2 containing
CoREST 3’UTR, or containing CoREST 3’UTR with point mutations in the seed sequences
for miR-124 and miR-22. Brains were collected at E17 and homogenized in 250µl of passed
lysis buffer (PLB, Promega). Data are the mean of at least 10 samples (pool of two brains in
each sample). Firefly and renilla luciferase activities were measured with a luminometer using
the Dual-Luciferase Reporter Assay System kit (Promega).
Electroporation
In utero electroporation were performed as described previously (Creppe et al., 2010; Nguyen
et al., 2006), with minor modifications. Briefly, uteri of anaesthetized timed-pregnant mothers
(14.5 days) with isoflurane in oxygen carrier (Abbot Laboratories Ltd, Kent, UK) were
exposed through a 1.5 centimeter incision in the ventral peritoneum. Embryos were carefully
lifted using ring forceps through the incision and placed on humidified gauze pads. Plasmid
DNA solution (2 to 4 µg/µl), prepared using EndoFree plasmid purification kit (Qiagen
Benelux B.V.), mixed with 0.05% Fast Green (Sigma, St. Louis, MO) was injected through
the uterine wall into the telencephalic vesicle using pulled borosilicate needles and a Femtojet
microinjector (VWR International). Five electrical pulses were applied at 35V (50 ms
duration) across the uterine wall at one second intervals using five mm platinum tweezers
electrodes (CUY650P5, Sonidel, Ireland) and an ECM-830 BTX square wave electroporator
(VWR International). The uterine horns were then replaced in the abdominal cavity and the
![Page 13: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/13.jpg)
12
abdomen wall and skin were sutured using surgical needle and thread. The pregnant mouse
was injected with buprenorphine (Temgesic®, Schering-Plough, Brussels, Belgium) and
warmed on heating pad until it woke up. The whole procedure was complete within 45
minutes. Several days following surgery, pregnant mice were sacrificed by neck dislocation
and embryos were processed for tissue analyses to study radial migration.
Focal electroporation. Brains from E14 mouse embryos were dissected and transferred into
liquid 3% low-melting agarose (38 °C, BioRad) and incubated on ice for 1 hour. Embedded
brains were cut coronally (300 µm) with a vibratome (VT1000S, Leica). All steps were
performed at 4 °C. Slices were then subjected to ex vivo electroporation with pNeuroD-IRES-
GFP (3 µg/µl), pNeuroD-Cre-IRES-GFP (3 µg/µl) and miRIDIAN microRNA Mimics
(Thermo Scientific, Lafayette, CO, USA) or antagomiRs of cel-miR-67 (negative control
miRNA), miR-22, miR-185 or miR-124 (5µM). After cutting, brain slices were transferred
onto 1% low-melting agarose placed onto a petridish square platinum plate electrode
(Nepagene). We injected plasmid DNA solution with 0.05% Fast Green (Sigma, St. Louis,
MO) into the intermediate zone of brain slices using a pulled glass micropipette and a
microinjector (Femtojet, Eppendorf). Electroporations were performed by placing a cover
square platinum plate electrode (Nepagene) onto the microinjected region. Square electric
pulses (100 V, 5 ms) were injected five times at one second intervals using an electroporator
(ECM 830, BTX). Micropipettes and electrodes were guided using a micromanipulator (WPI)
under a stereomicroscope (Stemi DV4, Carl Zeiss). Following electroporation, slices were
transferred onto Matrigel (BD bioscience, USA) and cultured for three days in semi-dry
conditions in a humidified incubator at 37 °C in a 5% CO2 atmosphere in wells containing
Neurobasal medium supplemented with 1% B27, 1% N2, and 1% penicillin/streptomycin.
Ex vivo electroporation. They were performed as described previously (Nguyen et al., 2006) with minor
modifications. Briefly, NMRI mouse embryos (E14) were decapited and heads were placed in
PBS glucose, NeuroD Sponge SCR (SPG miR-SCR) (4µg/µl) + Kif1A myc (0.5µg/µl) (Tsai
et al., 2010), NeuroD sponge 124 (SPG miR-124) (2µg/µl) + NeuroD sponge 22 (SPG miR-
22) (2µg/µl) + Kif1A myc (0.5µg/µl) with 0.05% Fast Green (Sigma, St. Louis, MO) were
injected into lateral ventricles using a pulled glass micropipette and a microinjector (Femtojet,
Eppendorf). Electroporation experiments were carried out by placing heads between tweezer-
type electrodes (BTX). Five electrical pulses were applied at 35V (50 ms duration) across the
uterine wall at 1 second intervals using five mm platinum tweezers electrodes (CUY650P5,
Sonidel, Ireland) and an ECM-830 BTX square wave electroporator (VWR International).
Electroporated region were further dissected into OPTIMEM Glucose medium and then the
![Page 14: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/14.jpg)
13
tissue was mechanically dissociated to obtain a single cell suspension. Neurons were cultured
(300000 cells par 24 wells) on polyD lysine (40µg/ml; Sigma) and laminin (6µg/ml; Sigma)
coated coverslips during five days.
Time-lapse imaging
For slice culture, brains from E16 electroporated embryos from Dicerlox/lox or NMRI mice
were embedded in 3% agarose and sliced (300 µm) with a vibratome (VT1000S, Leica,
Wetzlar, Germany). Brain slices were cultured up to 24 hours in semi-dry conditions
(Millicell inserts, Merck Millipore), in a humidified incubator at 37 °C in a 5% CO2
atmosphere in wells containing Neurobasal medium supplemented with 1% B27, 1% N2, and
1% penicillin/streptomycin (Gibco, Life Technologies, Ghent, Belgium).
Slice cultures were placed in a humidified and thermo-regulated chamber maintained at 37°C
on the stage of an inverted confocal microscope. Time-lapse confocal microscopy was
performed with a Nikon A1 Eclipse Ti laser scanning confocal microscope. Images were
taken with a 40X objective and 25 successive “z” optical plans spanning 50 µm every 30
minutes during 10 hours. Sequences were analyzed using Image J.
Fluorescence Activated Cell Sorting (FACS)
Pregnant dam were sacrificed three days after in utero electroporation by neck dislocation.
Embryo brains were harvested and the electroporated regions (green) were dissected under a
GFP-microscope. Dissected tissue from four to five embryos were pooled and placed at 37°C
for 20 minutes into a papaïne and DNAse 0.01% containing solution (Worthington, NJ,
USA). After adding ovomucoide inhibitor and DMEM/10% fetal bovine serum, the tissue was
triturated to obtain a single cell suspension. The solution was filtered through 40 µm filter
(BD biosciences, San Jose,CA). The cell suspension was spun at 500g for 5 minutes at 4°C in
a microcentrifuge. The supernatant was removed and replaced with cold PBS into 5 mL tubes
for FACS using a BD biosciences FACsVantage SE cell sorter (San Jose, CA). A non-GFP
positive embryo was used as control to set up backround florescence level. Collection
windows were set based on GFP cell counts. The purity of the sorts for the GFP using the
established windowing level was 98%. The FACs sorting yielded ~100.000 GFP-expressing
cells for each sample.
![Page 15: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/15.jpg)
14
Quantitative RT-PCR
Quantification of RNAs. Four to five cortices were pooled for FACS and total RNA extraction
was perform using the Qiagen RNA micro kit (Qiagen, Valencia, CA). All RNA samples
were then subjected to treatment with DNaseI (Roche Diagnostics) at RT for 15 minutes.
Synthesis of cDNA was performed starting with total RNA, which was reverse-transcribed
with SuperScript II or III Reverse Transcriptase (Invitrogen) according to the manufacturer’s
instructions. This process was also performed without reverse transcriptase to confirm the
absence of contaminating genomic DNA in all samples. The resulting cDNA was used for
quantitative PCR with the Faststart Universal SYBR Green Master (Roche Diagnostics).
Thermal cycling was performed on an Applied Biosystems 7900HT Fast Real-Time PCR
detection system (Applied Biosystems, Foster City, CA, USA). Optimal annealing
temperature for the primers was determined to be 60°C (40 cycles). The quantity of each type
of mRNA transcript was measured and expressed relative to glyceraldehyde 3-phosphate
dehydrogenase (GAPDH). The following primers were designed with Primer3 software
(Rozen and Skaletsky, 2000). Rnd2, Fwd CTACACTGCCAGCTTCGAGA, Rev
GAGGCCGGACATTGTCATAG; MeCP2, Fwd GCCGATCTGCTGGAAAGTAT, Rev
CCCACCTTTTCAAAGTATGC; Sin3a, Fwd TCCTTGACATCATGAAGGAATTT, Rev
GGGTGGCCTTTAAATAGCTG; Stathmin-2, Fwd CACTGATCTGCTCCTGCTTCT, Rev
CACTGATCTGCTCCTGCTTCT; COUP-TF1, Fwd CCTCAAAGCCATCGTGCTAT, Rev
TGATTTCTCCTGCAGGCTTT; Dcx, Fwd TGCTTGTGGTCCTGAAAAATTCCGC, Rev
AGCTGCGGCAGATGGATTCCC; Dicer, Fwd GAACGAAATGCAAGGAATGGA Rev
GGGACTTCGATATCCTCTTCTTTCTC; REST, Fwd
CACACAGGAGAACGCCCGTATAAA, Rev CGCATGTGTCGCGTTAGATGAGT;
CoREST, Fwd CGGAGTGCAAGCCTGAGAGCC Rev GGTTGGGGGACCACACCAGC;
Foxp2, Fwd ATCCTGGAAAGCAAGCAAAA, Rev GCTGCTGGAAGACGAGCTG;
Filamin A, Fwd ACTGTTGGCCAAGCCTGTAA, Rev TTGAAGTCGGCTGTTTCCTT;
Neuropilin-1, Fwd CATGATCAACTTCAACCCACA, Rev
TCTCCCCATCGATTACTTCC.
Quantification of miRNAs. Reverse transcriptase reactions were performed using TaqMan
MicroRNA Reverse Transcription kit (Applied Biosystem, Foster City, CA, USA) as
described previously (Chen et al., 2005). Real-time PCRs were performed using a standard
TaqMan PCR kit protocol on a 7900HT Sequence Detection System (Applied Biosystems,
Foster City, CA, USA). The 20 µl PCR mix included 0.67 µl RT product, 1× TaqMan
![Page 16: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/16.jpg)
15
Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.2 µM TaqMan
probe. The reactions were incubated in a 384-well plate at 95°C for 10 minutes, followed by
40 cycles of 95°C for 15 seconds and 60°C for 1 minute. All reactions were run in triplicate.
The threshold cycle (CT) was defined as the fractional cycle number at which the fluorescence
passes the fixed threshold. TaqMan CT values were converted into absolute copy numbers
using a standard curve from U6 snRNA.
Microarrays
miRNA microarrays. Small RNAs were extracted from cortices dissected from E12.5 to E18.5
wild-type embryos. Three animals were tested for each genotype. RNA extraction was
performed using mirVana™ miRNA Isolation Kit (Ambion, USA) according to the
manufacturer’s instructions. These samples were outsourced (Febit, Germany) for microarray
processing and analysis. Each array contained the reverse complements of all major mature
miRNAs and the mature sequences published in the recent Sanger miRBase release (version
10.1, December 2007) from mouse.
mRNA microarrays. Cortices dissected from E12.5 FoxG1Cre/+; Dicerlox/lox and
FoxG1+/+;Dicerloxlox embryos were preserved in RNAlater (Ambion, USA). Samples were
outsourced to Miltenyi Biotech (Leiden, The Nederlands) for mRNA microarray processing
and analysis (see also appendix1).
Western blot
N2A cells were cultured in six-well plate and transfected with scramble or shCoREST
expressing plasmids (Fuentes et al., 2012) using with Lipofectamine 2000 (Invitrogen, USA).
After 72 hours in culture, cells were washed twice with cold PBS and incubated in a lysis
buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% triton, 10 mM NaF, 1 mM Na3VO4 and
proteases inhibitors; Roche, Basel, Switzerland). Cortices from E14, E18 and P0 were
dissected and transferred in lysis buffer and proteins were extracted by centrifugation
(10000g) for 10 minutes at 4°C, separated by SDS-PAGE and transferred to 0.45 µm
Nitrocellulose membranes (Millipore, Billerica, USA). Membranes were blocked for 1 hour in
a solution containing non-fat milk then incubated with antibody anti-CoREST antibodies
(1:250, rabbit, Millipore, USA) O/N at 4°C. After rinses, secondary antibodies (HRP-
conjugated antibodies (anti-rabbit 1:10000, GE Healthcare, Waukesha, USA) were applied
during one hour at RT Membranes were developed with the ECL chemiluminescent reagent
(Thermo scientific, Rockford, USA) using Hyperfilm ECL (GE Healthcare, Waukesha, USA).
![Page 17: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/17.jpg)
16
Chromatin immunoprecipitation
ChIP assays were essentially performed as described previously (Close et al., 2006) by using
anti-REST and anti-CoREST antibodies (Millipore, USA), or IgG antibody as negative
control. Extracts from E17 or Dicer CKO cortices were precleared by 1 h incubation with
protein A or G/Herring sperm DNA, and immunoprecipitation was performed by incubating
overnight at 4°C with the relevant antibody and then 1 hr with protein A or G/Herring sperm
DNA. Protein-DNA complexes were washed as per standard ChlP techniques. After elution,
proteinase K treatment, and reversal of crosslinks, DNA fragments were analyzed by real time
PCR with SYBr Green detection. Input DNA was analyzed simultaneously and used for
normalization. For the histone-related ChIP, modifed-histone-specific ChIP values were
normalized according to the total H3 signal. Anti-H3 anti-H3 acetyl-K9 and anti-H3 tri-
methyl-K4 were from Abcam. The following primers were used to study the DCX gene: DCX
RE1 Forward: 5’- gatccctagctcttaggtaaatacacac - 3’, Reverse: 5’- agctcatggagctaatgaccaccc -
3’ ; DCX negative Forward: 5’- gacccaaggctagcaaagac -3’, Reverse: 5’- cctgcactttcttggtcgta -
3’; DCX -1000 Forward: 5’- ttcccaatctttaaaacacacttc -3’, Reverse: 5’- aaaagggaaagcagcaccta -
3’ ; DCX TATA Forward: 5’- ggcagaaggttttagccaag -3’, Reverse: 5’- ggaaattgcagggtaggaaa -
3’.
Supplementary movies
Movie S1: mutlipolar to bipolar morpholgy transition of electroported neurons with NeuroD-
GFP (left) or NeuroD-Cre-GFP (right).
Movies S2: stability of bipolar morphlogy of electroported neurons with NeuroD-GFP (left) or
NeuroD-Cre-GFP (right).
Supplementary table
Table S1 : Statistical analyses.
![Page 18: Supplemental Information MicroRNA Targeting of CoREST ... · ! 2! green and nestin in red, the inset shows holes in nestin labelling corresponding to loss of glial scaffold integrity)](https://reader033.fdocuments.us/reader033/viewer/2022050509/5f99ff5d2bce3f6378236c87/html5/thumbnails/18.jpg)
17
Supplemental References
Chen, C., Ridzon, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., Barbisin, M., Xu, N.L.,
Mahuvakar, V.R., Andersen, M.R., et al. (2005). Real-‐time quantification of microRNAs by
stem-‐loop RT-‐PCR. Nucleic Acids Res 33, e179.
Close, P., Hawkes, N., Cornez, I., Creppe, C., Lambert, C.A., Rogister, B., Siebenlist, U.,
Merville, M.P., Slaugenhaupt, S.A., Bours, V., et al. (2006). Transcription impairment and
cell migration defects in elongator-‐depleted cells: implication for familial dysautonomia.
Mol Cell 22, 521-‐531.
Creppe, C., Malinouskaya, L., Volvert, M.L., Close, P., Laguesse, S., Gillard, M., Chariot, A.,
and Nguyen, L. (2010). [Elongator orchestrates cerebral cortical neurogenesis]. Med Sci
(Paris) 26, 135-‐137.
De Pietri Tonelli, D., Pulvers, J.N., Haffner, C., Murchison, E.P., Hannon, G.J., and Huttner,
W.B. (2008). miRNAs are essential for survival and differentiation of newborn neurons
but not for expansion of neural progenitors during early neurogenesis in the mouse
embryonic neocortex. Development 135, 3911-‐3921.
Fuentes, P., Canovas, J., Berndt, F.A., Noctor, S.C., and Kukuljan, M. (2012). CoREST/LSD1
control the development of pyramidal cortical neurons. Cereb Cortex 22, 1431-‐1441.
Nguyen, L., Besson, A., Heng, J.I., Schuurmans, C., Teboul, L., Parras, C., Philpott, A.,
Roberts, J.M., and Guillemot, F. (2006). p27kip1 independently promotes neuronal
differentiation and migration in the cerebral cortex. Genes Dev 20, 1511-‐1524.
Rozen, S., and Skaletsky, H. (2000). Primer3 on the WWW for general users and for
biologist programmers. Methods Mol Biol 132, 365-‐386.
Tsai, J.W., Lian, W.N., Kemal, S., Kriegstein, A.R., and Vallee, R.B. (2010). Kinesin 3 and
cytoplasmic dynein mediate interkinetic nuclear migration in neural stem cells. Nature
Neuroscience 13, 1463-‐U1443.
Wang, X., Tsai, J.W., Imai, J.H., Lian, W.N., Vallee, R.B., and Shi, S.H. (2009). Asymmetric
centrosome inheritance maintains neural progenitors in the neocortex. Nature 461, 947-‐
955.