8/3/2019 Sun et al

http://slidepdf.com/reader/full/sun-et-al 1/5

African Journal of Microbiology Research Vol. 4(23), pp. 2617-2621, 4 December, 2010Available online http://www.academicjournals.org/ajmrISSN 1996-0808 ©2010 Academic Journals

Full Length Research Paper 

A novel loop-mediated isothermal amplification (LAMP)method for detection of Fusobacterium necrophorum  

from footrot

Sun D. B., Wu R., He X. J., Zheng J. S., Wang J. F., Zhu D. B., Zhao X. Y., Guo T., Sun B., FanC. L. and Guo D. H.* 

College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing High-techIndustrial Development Zone, Daqing 163319, P.R. China.

Accepted 26 October, 2010

A loop-mediated isothermal amplification method (Fn-LAMP) was developed for detection ofFusobacterium necrophorum  from footrot using a set of four specific primers designed from the lkt Agene of Fusobacterium necrophorum . The Fn-LAMP method, performed for 45 min at 61°C, was capableof detecting 1 cfu/mL of F. necrophorum  and was 10 times more sensitive than conventional PCRmethod. The Fn-LAMP had no cross-reaction with enterotoxigenic Escherichia coli , Salmonella ,Pasteurella multocida , Mycoplasma , Campylobacter fetus  from cattle. Detection of clinical samplesindicated relative sensitivity and relative specificity of Fn-LAMP to PCR was 100 and 87.5%,respectively. The percentage of observed agreement was 92.0% between Fn-LAMP and PCR methods.Visual detection of the Fn-LAMP products showed negative and positive results could be clearlyconfirmed using fluorescent dyes as detection reagent.

Key words: Fusobacterium necrophorum , footrot, loop-mediated isothermal amplification (LAMP).

INTRODUCTION

Footrot is an infectious disease in cattle that ischaracterized by lameness, and the inflammation of softtissues between the hooves, and has a serious impact onanimal production performance, particularly for dairy cow(Smith et al., 1993; Saginala et al., 1997; Nagaraja et al.,2007). Footrot occurs year round but prevalence is higherin the wet seasons. All breeds and all ages of cattle canbe affected, although the youngest are most susceptible.Since footrot was firstly reported in Netherlands in 1960,

the disease has frequently broken out in many bovine-raising countries in recent decades, and has led tosevere economic losses, notably in Europe and Asia(Guo et al., 2010; Sun et al., 2009; Nagaraja et al., 2005).In China, incidence rate of footrot disease is about 8 to20%, but in cold and wet areas, the incidence rate is ableto reach 50% (Li, 2000). Footrot is generally caused by

*Corresponding author. E-mail: amu0406@yahoo.com.cn. Tel:+86-459-6819200. Fax: +86-459-6819190.

coinfections  with Fusobacterium necrophorum  (Fnecrophorum ), Dichelobacter nodosus , and othepathogenic factors (Berg et al., 1975; Roberts et al.1968). The present study demonstrates that footrot ismainly caused by the pathogen F. necrophorum . Furtheresearch reveals leukotoxin A (lkt A) of F . necrophorum isa major virulence factor that causes footrot (Narayanan etal., 2003; Tan et al., 1994).

Clinical diagnosis of footrot caused by F . necrophorum

is difficult because clinical signs of footrot are common toother pathogens. At present, these methods have beenused to detect F . necrophorum  in footrot, such asbacterium isolation (BI), polymerase chain reaction(PCR), and real-time polymerase chain reaction (Real-time PCR) (Baek et al., 2010; Aliyu et al., 2004). AlthoughBI is highly specific and sensitive, it is often too timeconsuming and expensive for routine use in clinical testPCR and Real-time PCR methods have been widelyapplied for laboratory diagnosis of F . necrophorum  infootrot because of its sensitivity, specificity, and rapiddiagnosis requiring about 3 h for detection of bacteria

8/3/2019 Sun et al

http://slidepdf.com/reader/full/sun-et-al 2/5

2618 Afr. J. Microbiol. Res.

Table 1. Primers for Fn-LAMP and PCR of the lkt A gene of F. necrophorum.

Primer name Oligonucleotide sequence of the primers

lkt A-F3 5’AAGAAAAAAGATGGAGCGG3’

lkt A-B3 5’CATTCACAACAACAGTAGATGA3’

lkt A-FIP (F1C+TTTT+F2) 5’GTATTGACTGCAATAGCTACTCCTCTTTTATTGTAAATGCTGCTTTATCGG3’

lkt A-BIP (B1C+TTTT+B2) 5’AATTGAGTGGAAGCAATAAGGAAGCTTTTCTCCACATTTACATGTTTCGC3’lkt A-U 5'AGGAGAATCTAAAAGCCA3'

lkt A-R 5'CCATTTAGTAAAGCCTGA3'

The primers lkt A-F3 and lkt A-B3 are forward outer primer and reverse outer primer, respectively. The primers lkt A-FIP and lkt A-BIPare forward inner primer and reverse inner primer, respectively. The primers lkt A-U and lkt A-R were used for PCR amplification of lkt Agene of F. necrophorum .

genomic DNA, but the two methods need to be carriedout in diagnostic laboratory with specialized equipment.Therefore, development of a simple and rapid assay fordetection of F . necrophorum  from footrot with high

specificity and sensitivity is imperative. In our study, theloop-mediated isothermal amplification (LAMP) methodwas introduced to establish a rapid diagnostic method fordetection of F. necrophorum from footrot of cattle.

MATERIALS AND METHODS

Bacterial strain and plasmid

F. necrophorum  strain H05 (Genbank accession no. DQ672338)was stocked in Clinical Veterinary Medicine Laboratory, College ofAnimal Science and Veterinary Medicine, Heilongjiang BayiAgricultural University. The field isolates from cattle, enterotoxigenicEscherichia coli , Salmonella , Pasteurella multocida , Mycoplasma ,and Campylobacter fetus were isolated and identified according tothe conventional culture and biochemical tests, respectively.

Primers for Fn-LAMP and PCR

Four specific oligonucleotide primers for Fn-LAMP, named lkt A-F3,lkt A-B3, lkt A-FIP, and lkt A-BIP, were designed using thePrimerExploer V3 software online (http://primerexplorer.jp/e/) basedon nucleotide sequence of lkt A gene of F. necrophorum  (Genbankaccession no. DQ672338). A pair of primers for PCR amplification,named lkt A-U and lkt A-R, respectively, were designed using thePrimer Premier 5.0 software based on nucleotide sequence of lkt A

gene of F. necrophorum  strain H05 (Genbank accession no.DQ672338). All primers were synthesized by Shanghai SangonBiological Engineering Technology and Services Co. Ltd.(Shanghai, China). All sequences of the primers are shown in Table1.

Fn-LAMP reaction

Three crucial components, Mg2+ concentration, reactiontemperature and reaction time, were optimized using the genomicDNA of F. necrophorum  strain H05 as template in electronicconstant temperature water bath pot. The best reaction of the

Fn-LAMP was carried out in a 25 µl mixtures containing 1 µl of theprimers lkt A-F3 (5 µM), lkt A-B3 (5 µM), lkt A-FIP (40 µM) and lkt ABIP (40 µM) each, 1 µl of MgSO4 (100 uM), 2 µl of dNTP (10 mM)1 µl  of Betaine (25 mM, Sigma Aldrich), 2.5 µl   of 10×Thermopobuffer (New England Biolabs, NEB), 1 µl  of Bst DNA polymerase(New England Biolabs, NEB), 1 µl of diluted genomic DNA of Fnecrophorum strain H05, and 12.5 µl of ddH2O. The mixture wasincubated at 61°C for 45 min, and 3 µl of Fn-LAMP products wasanalyzed by electrophoresis in 0.8% agarose gel.

PCR reaction

The 25-µl PCR mixtures contained 1 µl of diluted genomic DNA oF. necrophorum strain H05, 2.5 µl of 10×buffer, 0.25 µl of Tag DNApolymerase (Takara, Dalian, China), 2 µl of dNTP (2.5 mM each), 1µl of lkt A-U primer (10 µM), 1 µl of lkt A-R primer (10 µM), 17.25 µof ddH2O. The amplification conditions were 5 min of denaturationat 95°C, followed by 30 cycles of 95°C for 1 min, 50°C for 30 s, and

72°C for 30 s and a final extension step of 72°C for 10 min. 3 µl oPCR products was analyzed by electrophoresis in 0.8% agarosegel.

Evaluation of Fn-LAMP

The Fn-LAMP method was evaluated by sensitivity assayspecificity assay, and detection of clinical samples. In sensitivityassay, F. necrophorum  strain H05 was cultured according to therecommended methods. The fresh cultures were diluted from 10CFU/mL to 10-1 CFU/mL in phosphate buffered saline (PBS, pH7.4)Genomic DNAs of diluted bacteria were extracted using a DNeasyTissue Kit (Qiagen, Hilden, Germany) according to themanufacturer’s protocol, respectively. The extracted genomic DNAs

as templates were detected using the Fn-LAMP method andconventional PCR method, respectively. Products of Fn-LAMP andPCR were analyzed by electrophoresis in 0.8% agarose gel.

In specificity assay, the genomic DNAs of the field isolates fromcattle, enterotoxigenic E. coli , Salmonella , P. multocidaMycoplasma , and C. fetus , were extracted with the methoddescribed before. The extracted genomic DNAs were detected byusing the LAMP method. The genomic DNA of F. necrophorumstrain H05 was used as positive controls in the LAMP.

In detection of clinical samples, a total of 37 decomposed softtissues of hooves from cow with footrot were collected in 13 cattlefarms of Heilongjiang Province, northeast China. All samples werediluted 1:5 in PBS (pH 7.4), and the genomic DNA from each

8/3/2019 Sun et al

http://slidepdf.com/reader/full/sun-et-al 3/5

 

sample was extracted according to the method describedpreviously. The extracted genomic DNAs were simultaneouslydetected using LAMP method and PCR method. Using PCRmethod as the golden standard, relative sensitivity of LAMP to PCRand relative specificity of LAMP to PCR were analyzed based onthe following formula. Relative sensitivity = 100 × LAMP positivenumbers/PCR positive numbers. Relative specificity = 100 × LAMPnegative numbers/PCR negative numbers.

Visual detection of Fn-LAMP products with naked eye

In order to determine result of Fn-LAMP products by visualobservation quickly, the Fn-LAMP reaction was performed byadding 2 µl of fluorescent dye EvaGreenTM (Biotium Inc. Hayward,CA, USA) to a 25 µl total reaction mixture volume. The genomicDNAs of F. necrophorum  (102, 101, 100, and 10-1 CFU/mL,respectively) and the genomic DNA of enterotoxigenic E. coli  asnegative control were detected by the Fn-LAMP reaction containingfluorescent dye EvaGreenTM. Different fluorescent colors in thereaction mixture each were checked when the reaction wascompleted.

RESULTS

Fn-LAMP amplification

The amplified products of Fn-LAMP and PCR wereanalyzed by electrophoresis in 0.8% agarose gel. Resultindicated a ladder-like DNA electrophoresis band wasshowed in the lane of Fn-LAMP products, a 435 bp ofDNA band was shown in the lane of PCR products, andno amplified products were shown in the lane of Fn-LAMP negative control (Figure 1).

Sensitivity and specificity assay

In sensitivity assay, detection limit of the Fn-LAMPmethod was 1 cfu/mL of F. necrophorum , and detectionlimit of the PCR method was 10 cfu/mL of F.necrophorum  (Figure 2). In specificity assay, noamplification was shown in result of the Fn-LAMPamplification for the field isolates enterotoxigenic E. coli ,Salmonella , P. multocida , Mycoplasma , and C. fetus  (Figure 3).

Detection of clinical samples

A total of 37 decomposed soft tissues of hooves fromfootrot were simultaneously detected using Fn-LAMP andthe PCR methods. Result demonstrated that relativesensitivity of Fn-LAMP to PCR was 100%, relativespecificity of Fn-LAMP to PCR was 87.5%, andpercentage of the observed agreement was 92.0%between Fn-LAMP and PCR methods (Table 2).

Visual detection of the LAMP products

Reaction tubes of the genomic DNAs of F. necrophorum  

Sun et al. 2619

Figure 1. Amplification of lkt Agene by Fn-LAMP and PCR.Lane 1 is Fn-LAMP products.Lane 2 is Fn-LAMP negativecontrol. Lane 3 is PCR

products. Lane M is DNAMarker.

Figure 2. Comparison of sensitivity of Fn-LAMP and PCR. LaneM is DNA Marker. Lane 1-6 is Fn-LAMP amplification products ofthe diluted F. necrophorum . Lane 1 is 104 CFU/mL. Lane 2 is 103 CFU/mL. Lane 3 is 102 CFU/mL. Lane 4 is 101 CFU/mL. Lane 5 is1 CFU/mL. Lane 6 is 10-1 CFU/mL. Lane 7-12 is PCRamplification products of the diluted F. necrophorum . Lane 7 is104 CFU/mL. Lane 8 is 103 CFU/mL. Lane 9 is 102 CFU/mL. Lane10 is 101 CFU/mL. Lane 11 is 1 CFU/mL. Lane 12 is 10 -1 CFU/mL.

from 102

CFU/mL, 101

CFU/mL, and 1 CFU/mL showed

clearly green fluorescence, and no green fluorescencewas observed in reaction tubes of the genomic DNA of Fnecrophorum from 10

-1CFU/mL and the genomic DNA o

enterotoxigenic E. coli  as negative control (Figure 4)These observations agreed with gel electrophoresisresults. 

DISCUSSION

Footrot is a serious bovine disease resulting severeeconomic losses worldwide. In China, incidence rate of

8/3/2019 Sun et al

http://slidepdf.com/reader/full/sun-et-al 4/5

2620 Afr. J. Microbiol. Res.

Figure 3. Specificity of the Fn-LAMP. LaneM is DNA Marker. Lane 1 is F. necrophorum  strain H05. Lane 2 is EnterotoxigenicEscherichia coli . Lane 3 is Salmonella . Lane4 is Pasteurella multocida . Lane 5 isMycoplasma . Lane 6 is Campylobacter fetus .Lane 7 is Fn-LAMP negative control.

Table 2. Comparison of Fn-LAMP and PCR in detection ofclinical samples

Methods + – Total

+ 13 0 13PCR

  – 0 24 24

+ 13 3 16Fn-LAMP

  – 0 21 21

Percentage of observed agreement: (13 + 21)/37 × 100% = 92.0%.Relative sensitivity: 13/13 × 100% = 100%. Relative specificity: 21/24

× 100% = 87.5%. 

Figure 4. Visual detection of the Fn-LAMP products. Lane 1 is 102 CFU/mL of F. necrophorum ; Lane 2 is 101 CFU/mL of F.necrophorum ; Lane 3 is 1 CFU/mL of F. necrophorum . Lane 4 is10-1 CFU/mL of F. necrophorum . Lane 5 is Genomic DNA control ofEscherichia coli .

footrot reaches 8 to 20% in the cowshed. But the inci-dence rate is able to reach 50% in cold and wet areas (Li,2000). Early treatment of foot rot is usually successful,

especially when instituted early in the disease courseHowever, footrot disease is a slower cause of surgicadisease in clinical cases; its early symptoms are easilyoverlooked. Thus, it is desirable to develop a sensitiveand specific diagnostic method for detection of footrot Fnecrophorum . At present, specific pathogen detection

methods of F. necrophorum  mainly rely on PCR andReal-time PCR methods (Baek et al., 2010; Aliyu et al.2004). Two methods need expensive equipment, speciaoperation, and sophisticated determination of results. SoPCR and Real-time PCR methods are not suitable fordetection-on-spot field situations or primitive laboratoriesin developing countries. Loop-mediated isothermaamplification (LAMP), as a novel nucleic acid ampli-fication method, was developed for one-step amplificationof the target DNA sequence with high sensitivity andspecificity under isothermal conditions. Since LAMP wasoriginally reported by Notomi et al. (2000), LAMP hadbeen widely used in etiological diagnosis due to itsunique advantage as a rapid, accurate, cost-effectiveand visual product method (Notomi et al., 2000; Misawaet al., 2007; Hara-Kudo et al., 2005).

In this study, a specific and sensitive LAMP method(Fn-LAMP) was developed for detecting F. necrophorumfrom footrot of cattle based on lkt A gene which is aconservative virulence gene. The Fn-LAMP method didnot require special equipment and expensive reagentsand it could be performed in one hour in water bathResult of the Fn-LAMP method could be clearlyconfirmed by visual detection using fluorescent dyes asdetection reagent. The visual detection of the Fn-LAMPreaction is faster and easier than the PCR method andmay be applied in general clinical laboratories. The Fn-

LAMP method is high sensitive and specific for detectionof F. necrophorum  from footrot. Its detection limit is 1cfu/mL of F. necrophorum , and detection limit of the PCRmethod was 10 cfu/mL of F. necrophorum . The Fn-LAMPmethod was 10 times more sensitive than PCR methodThe Fn-LAMP method is high specific for detection of Fnecrophorum  from footrot. It had no cross-reaction withenterotoxigenic E. coli , Salmonella , P. multocidaMycoplasma , C. fetus  from cattle. In order to evaluatefeasibility of the Fn-LAMP method in fields, a total of 37decomposed soft tissues of hooves from footrot weresimultaneously detected using LAMP and PCR methodsResults demonstrate that compared with PCR method

the Fn-LAMP method has higher sensitivity. Althoughlimited numbers of clinical specimens were analyzed inthe present study, it has been shown that the Fn-LAMPmethod has the potential for use in early diagnosis ofcattle footrot caused by F. necrophorum .

ACKNOWLEDGMENTS

This work was supported by a grant from the InnovationFund of Daqing High-tech Industrial Development Zone

8/3/2019 Sun et al

http://slidepdf.com/reader/full/sun-et-al 5/5

 

of Heilongjiang Province (DQGX09YF015), EducationDepartment of Heilongjiang Province (11541250 and1154G60), and Doctor Start Fund of Heilongjiang BayiAgricultural University (B2009-4).

REFERENCES

Aliyu SH, Marriott RK, Curran MD, Parmar S, Bentley N, Brown NM,Brazier JS, Ludlam H (2004). Real-time PCR investigation into theimportance of Fusobacterium necrophorum  as a cause of acutepharyngitis in general practice. J. Med. Microbiol., 53: 1029-1035.

Baek DH, Kim C, Kook JK (2010). Development of strain-specific PCRprimers for the identification of Fusobacterium nucleatum  subsp.fusiforme ATCC 51190

Tand subsp. vincentii ATCC 49256

T.

Anaerobe, 16: 43-46.Berg JN, Loan RW (1975). Fusobacterium necrophorum  and

Bacteroides melaninogenicus as etiologic agents of foot rot in cattle.Am. J. Vet. Res., 36: 1115-1122.

Guo DH, Sun DB, Wu R, Yang HM, Zheng JS, Fan CL, Sun B, Wang JF(2010). An indirect ELISA for serodiagnosis of cattle footrot causedby Fusobacterium necrophorum. Anaerobe. [Epub ahead of print].PMID: 20304080.

Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M (2005). Loop-mediatedisothermal amplification for the rapid detection of Salmonella . FEMS.Microbiol. Lett., 253: 155-161. 

Li Y (2000). New technologies and experiences of animal footrotdisease. In Chinese. Contemporary livestock, 4: 5-26.

Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N (2007).Application of loop-mediated isothermal amplifi cation technique torapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures. J. Infect. Chemother., 13: 134-140.

Nagaraja T, Lechtenberg K (2007). Liver abscesses in feedlot cattle.Vet. Clin. North Am. Food Anim. Pract., 23: 351-369.

Sun et al. 2621

Nagaraja TG, Narayanan SK, Stewart GC, Chengappa MM (2005)Fusobacterium necrophorum infections in animals: Pathogenesis andpathogenic mechanisms. Anaerobe, 11: 239-246.

Narayanan S, Chengappa M, Stewart G, Nagaraja T (2003)Immunogenicity and protective effects of truncated recombinanleukotoxin proteins of Fusobacterium necrophorum  in mice. VetMicrobiol., 93: 335-347.

Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino

N, Hase T (2000). Loop-mediated isothermal amplification of DNANucleic Acids Res., 28: E63.

Roberts DS, Graham NP, Egerton JR (1968). Infective bulbar necrosis(heel-abscess) of sheep, a mixed infection with Fusiformisnecrophorus and Corynebacterium pyogenes. J. Comp. Pathol., 781-8.

Saginala S, Nagaraja T, Lechtenberg K, Chengappa M, Kemp K, Hine P(1997). Effect of Fusobacterium necrophorum  leukotoxin vaccine onsusceptibility to experimentally induced liver abscesses in cattle. JAnim. Sci., 75: 1160-1166.

Smith G, Thornton E (1993). Pathogenicity of Fusobacteriumnecrophorum strains from man and animals. Epidemiol. Infect., 110499-506.

Sun DB, Wu R, Li GL, Zheng JS, Liu XP, Lin YC. Guo DH (2009)Identification of three immunodominant regions on leukotoxin proteinof Fusobacterium necrophorum . Vet. Res. Commun., 33: 749-755.

Tan Z, Nagaraja T, Chengappa M, Smith J (1994). Biological andbiochemical characterization of Fusobacterium necrophorumleukotoxin. Am. J. Vet. Res., 55: 515-521.